Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Medicine

Analizzando Effetti benefici dei supplementi nutrizionali sulle funzioni intestinali epiteliali barriera durante Experimental Colitis

doi: 10.3791/55095 Published: January 5, 2017

Summary

Gli attuali trattamenti di malattie infiammatorie croniche intestinali (IBD) hanno lo scopo di alleviare i sintomi della malattia, ma possono causare gravi effetti collaterali. Così, strategie alternative sono allo studio in modelli animali colite. Qui, viene spiegato come gli effetti benefici della dieta completa sui segni clinici IBD sono analizzati in un tale modello di colite.

Abstract

malattie infiammatorie croniche intestinali (IBD), tra cui il morbo di Crohn e la colite ulcerosa, sono patologie croniche recidivanti dell'intestino. Essi causano gravi problemi, come crampi addominali, diarrea con sangue, e perdita di peso, in individui affetti. Purtroppo, non vi è ancora alcuna cura, e trattamenti mirano solo per alleviare i sintomi. Gli attuali trattamenti comprendono farmaci anti-infiammatori e immunosoppressori che possono causare gravi effetti collaterali. Questo garantisce la ricerca di opzioni di trattamento alternativi, come integratori alimentari, che non causano effetti collaterali. Prima della loro applicazione negli studi clinici, questi composti devono essere rigorosamente testati per l'efficacia e la sicurezza nei modelli animali. Un modello sperimentale affidabile è il modello di destrano solfato di sodio (DSS) la colite nei topi, che riproduce molti dei segni clinici della colite ulcerosa negli esseri umani. Recentemente abbiamo applicato questo modello per testare gli effetti benefici di un integratore alimentare contenentevitamine C ed E, L-arginina, e gli acidi grassi polinsaturi ω3-(PUFA). Abbiamo analizzato diversi parametri di malattia e abbiamo trovato che questo supplemento è stato in grado di migliorare la formazione di edema, danni ai tessuti, l'infiltrazione dei leucociti, stress ossidativo, e la produzione di citochine pro-infiammatorie, che porta a un miglioramento complessivo dell'indice di attività della malattia. In questo articolo, si spiega in dettaglio la corretta applicazione di supplementi nutrizionali che utilizzano il modello di colite DSS in topi C57BL / 6, e come parametri di malattie come l'istologia, lo stress ossidativo e l'infiammazione sono valutati. Analizzando gli effetti benefici dei diversi integratori alimentari può poi eventualmente aprire nuove strade per lo sviluppo di strategie terapeutiche alternative che alleviano i sintomi IBD e / o che prolungano le fasi di remissione senza causare gravi effetti collaterali.

Introduction

La colite è una condizione infiammatoria del colon che può causare diarrea e dolore addominale. Colite può essere acuta, in risposta a infezione o allo stress, o può svilupparsi come una malattia cronica, come nella colite ulcerosa (UC), che appartiene al gruppo di malattie infiammatorie croniche intestinali (IBD). Anche se i segni clinici di UC sono stati ben descritti, la patogenesi è ancora poco conosciuta 1. E 'accettato tra gli esperti che UC è una malattia multifattoriale, con mutazioni genetiche e le risposte immunitarie aberranti che giocano un ruolo importante 2. Tuttavia, i fattori ambientali, come ad esempio lo stile di vita e l'alimentazione, contribuiscono allo sviluppo della malattia e la progressione 3.

Purtroppo, IBD non è curabile, ma ci sono molte opzioni di trattamento che hanno lo scopo di alleviare i sintomi clinici. Gli attuali trattamenti comprendono farmaci anti-infiammatori, come la sulfasalazina e corticosteroidi; immunosoppressori, come azathioPrine; anticorpi monoclonali che catturano pro-infiammatori citochine, come il fattore di necrosi tumorale-α (TNF-α), o molecole di adesione a blocchi, come integrine, per ridurre un eccessivo reclutamento dei leucociti; e inibitori che hanno come target le chinasi che attivano percorsi pro-infiammatorie, come Janus chinasi (JAK) 4. Non tutti i pazienti rispondono a tutti i trattamenti, in modo da strategie terapeutiche devono essere personalizzati 5. Inoltre, la maggior parte di questi farmaci terapeutici interferire con il metabolismo e risposte immunitarie, causando spesso gravi effetti collaterali. Per questo motivo, le opzioni di trattamento alternativi sono stati indagati.

Trattamenti alternativi includono probiotici e integratori alimentari, che sono state applicate in modelli animali e studi clinici con diversi livelli di successo 6,7. Abbiamo recentemente dimostrato che l'applicazione di diversi supplementi nutrizionali singoli, quali vitamine antiossidanti o acidi grassi ω3-poli-insaturi (PUFAS), è inferiore alla applicazione di una combinazione di tali integratori per alleviare colite e sintomi della malattia cardiovascolare 8,9. Questi studi sono stati effettuati su topi, così studi clinici devono essere effettuate in esseri umani per determinare se questi risultati saranno applicabili anche agli esseri umani. Prima di studi clinici sono iniziati, l'efficacia e la sicurezza di nuove opzioni di trattamento devono essere valutati in modelli animali.

Per IBD, il modello destrano solfato di sodio (DSS) è stato ampiamente utilizzato per studiare i meccanismi di sviluppo della malattia e gli effetti benefici dei farmaci e integratori alimentari 6,10. Nella maggior parte degli studi, solo una malattia acuta per un periodo di sette giorni è indotti; tuttavia, i segni clinici osservati in questi animali sono molto simili a quelli osservati nei pazienti con malattia infiammatoria intestinale (ad esempio, diarrea con sangue, perdita di peso, disfunzione epiteliale, e l'infiltrazione di cellule immunitarie) 10. DSS induce erosioni della mucosa,con conseguente disfunzione barriera e in un aumento della permeabilità epiteliale intestinale 11. L'esatto meccanismo resta sconosciuto. Tuttavia, uno studio suggerisce che DSS interagisce con acidi a catena media lunghezza grassi per formare nano-lipocomplexes che sono in grado di entrare nelle cellule epiteliali e indurre segnalazione infiammatoria Percorsi di 12. In questo articolo, si descrive in dettaglio come colite è indotta e analizzato nei topi, come integratori alimentari sono applicate dalla sonda gastrica per garantire un dosaggio costante in ogni animale, e in che modo vengono esaminati gli effetti di tali supplementi su vari sintomi colite.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Tutti gli esperimenti sugli animali sono stati approvati dal Comitato di Cura e uso istituzionale degli animali di Cinvestav.

1. Preparazione del DSS acqua potabile e l'induzione della colite

  1. Preparare un 3,5% w / v soluzione di destrano solfato di sodio (DSS) in acqua potabile autoclavato. DSS scioglie facilmente e non è necessario filtrare la soluzione finale.
    NOTA: 7 giorni di trattamento DSS induce grave colite. Se inducendo la colite lieve, 3 - sono raccomandati 4 giorni di trattamento. Finché l'acqua potabile DSS rimane chiara, non è necessario cambiare l'acqua. Tuttavia, se diventa torbida, deve essere sostituito.
  2. Registrare il peso di base di topi maschi. Garantire che essi sono 8 - 12 settimane di età e in un intervallo di 21 - 25 g di peso corporeo.
    NOTA: La concentrazione DSS appropriato deve essere ottimizzata in ogni laboratorio. I risultati possono variare notevolmente, a seconda delle condizioni abitative. Concentrazioni 2,5-5% di solito sono segnalati per indurre forti colitis in C57Bl / 6J WT topi 10. DSS da diverse società e diversi lotti deve essere testato, come i risultati possono anche variare con diverse fonti di DSS.
  3. Fornire acqua ad libitum e sostituirla con acqua fresca DSS 3,5%, se necessario.

2. Applicazione di integratori alimentari da Gavage

  1. Preparare una soluzione "alimentabile" dei supplementi nutrizionali desiderati in un solvente appropriato. Per questo studio, abbiamo utilizzato una miscela contenente 200 mg / kg di L-arginina, 83 mg / kg di vitamina C, 46 mg / kg di vitamina E, 77 mg / kg eicosapentaenoico acido (EPA) e / kg acido docosaesaenoico 115 mg (DHA ) in una soluzione 1: 1 di acqua e olio di cartamo.
  2. Riempire una siringa da 1 mL collegato ad un ago sonda gastrica (15 G x 50 mm) con la miscela integratore nutrizionale. Pulire l'esterno dell'ago gavage per rimuovere qualsiasi composto esterna dell'ago e per assicurare l'applicazione giusta dose.
  3. Trattenere il mouse afferrando la base della coda conuna mano e saldamente presa una piega della pelle nella parte posteriore del collo con il pollice e l'indice dell'altra mano. Posizionare la coda tra il terzo dito e la base del pollice della stessa mano che impugna il manico.
  4. Pur mantenendo il mouse in posizione verticale, inserire l'ago nel lato sinistro della bocca dell'animale e seguire attentamente il tetto della bocca per individuare l'esofago. Se si incontra alcuna resistenza, far avanzare l'ago verso lo stomaco.
    NOTA: verificare che l'animale sta respirando correttamente prima di procedere.
  5. Somministrare la miscela lentamente, rimuovere il tubo lentamente tirando fuori la siringa, e rilasciare il mouse. Applicare supplementi nutrizionali volta al giorno mediante sonda gastrica nel corso dell'esperimento colite.

3. Determinazione del Disease Activity Index

NOTA: L'indice di attività della malattia è la combinazione dei punteggi per la perdita di peso, sanguinamento perianale, e la consistenza delle feci, che sono obnuto giornaliera 13.

  1. Misurare il peso corporeo al giorno e assegnare un punteggio da 0 a 4 in base alla percentuale di perdita di peso (0: 0%, 1: 1 - 5%, 2: 5 - 10%, 3: 10 - 20% e 4:> 20 %).
    NOTA: peso corporeo perdita è determinato calcolando la differenza percentuale tra il peso basale prima dell'induzione di DSS-colite e il peso reale.
  2. Per determinare il livello di sanguinamento perianale, raccogliere un campione di feci fresco e utilizzare i applicatori forniti per applicare un sottile striscio su un vetrino da un kit di guaiaco fecale test del sangue occulto. Utilizzare un applicatore fresco per ogni campione.
    1. Chiudere il coperchio sulla parte anteriore e aprire la finestra sul retro del vetrino. Applicare due gocce di soluzione di sviluppo alla parte posteriore nella posizione del campione.
    2. Leggere i risultati dopo 30 s. Qualsiasi traccia di colore blu è positivo per sangue occulto. Assegnare un punteggio di 0 a 4 (0: nessuno, 0,5-2,5: guaiaco positivo di test fecale del sangue occulto (a seconda della potenza del segnale), e 3 - 4: gross sanguinamento).
      NOTA: Se il sangue nelle feci è visibile, il test del sangue occulto fecale guaiaco non deve essere eseguito, e un punteggio di 3, 3,5, o 4 viene assegnato, a seconda della quantità di sangue visibile.
  3. Determinare la consistenza delle feci osservando un campione di feci fresco. Assegnare un punteggio di 0 a 4 (0: normale solido, 0,5 / - 2,5: sgabello pastosa, e 3 - 4: diarrea).

4. Determinazione epiteliali intestinali permeabilità In Vivo da Evans Blu Assay

  1. Anestetizzare gli animali iniettando loro per via intraperitoneale con una miscela di ketamina (100 mg / kg di peso corporeo) e xilazina (13 mg / kg di peso corporeo) diluito in soluzione salina (0,9% NaCl), e valutare la profondità dell'anestesia monitorando il colpo ritiro reflex.
  2. Mettere gli animali anestetizzati in posizione supina ed eseguire una laparotomia per esporre l'intestino.
  3. Individuare il cieco e fare una piccola incisione nel segmento prossimale del colon unscendens (idealmente, immediatamente adiacente al cieco).
  4. Inserire un ago di alimentazione (G22) e fissarlo con una legatura con un filo di seta comune. Attenzione a filo abbondante PBS attraverso il tubo di sciacquare tutti feci dal colon. Instillare soluzione Evans blue (1,5% w / v in PBS) nel colon fino a raggiungere l'ano.
  5. Incubare il blu di Evans per 15 min. Lavare il colorante irrigando il tubo con abbondante PBS fino a quando il washout perianale è chiara.
  6. Eutanasia gli animali da dislocazione cervicale.
  7. Accise L'colon e sciacquare di nuovo con abbondante PBS. Risciacquare una volta con 1 ml di 6 mm N -acetylcysteine in PBS per eliminare il colorante attaccarsi alla mucosa del colon.
  8. Tagliare il colon longitudinalmente e risciacquare ancora una volta con PBS e 1 mL di 6 mM N -acetylcysteine.
  9. Registrare il peso e lunghezza. Per estrarre il colorante blu Evans, posizionare il colon in 2 ml di N, N -dimethylformamide notte a temperatura ambiente con delicata agitation. Misurare la concentrazione di colorante spettrofotometricamente a 610 nm.

5. Tessuto Collection

  1. Anestetizzare gli animali iniettando loro per via intraperitoneale con una miscela di ketamina (100 mg / kg di peso corporeo) e xilazina (13 mg / kg di peso corporeo) diluito in soluzione salina (0,9% NaCl), e valutare la profondità dell'anestesia monitorando il colpo ritiro reflex.
  2. Eutanasia gli animali da dislocazione cervicale.
  3. Posizionare gli animali in posizione supina ed eseguire una laparotomia per esporre la cavità addominale.
  4. Utilizzando le forbici, sezionare tutto il colon e registrare la sua lunghezza.
  5. Lavare il colon con cura più volte con refrigerata PBS per rimuovere le feci. Registrare il peso del tessuto e preparare le seguenti esperimenti, come descritto ai punti 5.6 - 5.8.
  6. Per l'isolamento di RNA e mieloperossidasi (MPO) saggi, tagliare un campione di tessuto di dimensioni adeguate (100 mg di solito è sufficiente), posizionarlo all'interno di un tubo, e SNAp-congelare in azoto liquido. Conservare i tessuti a -80 ° C per un uso futuro.
  7. Per immunofluorescenza e la determinazione dello stress ossidativo (vedi sotto), tagliare un piccolo campione del colon (0,5-1 cm) e immergere in tazze in alluminio piccoli pieni di temperatura di taglio ottimale (OCT) composto. Posizionare le coppe su ghiaccio secco e lasciarli congelare lentamente, per evitare la formazione di bolle. campioni di tessuto congelati possono essere conservati a -80 ° C per un uso futuro.
  8. Per svizzero rotola 14, aprire il colon longitudinalmente e rimuovere con cautela le feci con pinze. Arrotolare, con la mucosa rivolto verso l'interno, con pinze punta fine o una sottile, tondo bastone di legno. Posizionare con cura dentro una cassetta embedding e continuare con il passo 6.1.
    NOTA: DSS induce danni nel colon. Tuttavia, la distribuzione danni varia dal prossimale al colon distale, con la maggior parte dei danni di solito visto nel colon distale e del retto. Così, si consiglia di analizzare l'istologia sia nella col distaleo in ruoli svizzeri di tutto il colon.

6. Analisi di Colon Istologia da ematossilina-eosina

  1. Preparazione del tessuto
    1. Per l'analisi istologica, immergere entrambi i rulli svizzeri o piccoli pezzi di tessuto da alcune regioni del colon di controllo e topi trattati in 5 mL di formaldeide al 10% per 48 ore a temperatura ambiente (RT) per ottenere il corretto fissaggio.
      NOTA: Tutte le fasi successive al passaggio 6 vengono effettuate a temperatura ambiente, se non diversamente indicato.
    2. lavarli con acqua corrente per 18 h.
    3. li Disidratare con 15 ml di etanolo al 70% per 1 h, 96% per 1 h, ed etanolo assoluto per 1 h. Ripetere ogni passo con l'alcol fresca prima di procedere alla successiva concentrazione.
    4. Continuare la disidratazione in una miscela di 7,5 ml di etanolo assoluto e 7,5 ml di xilene assoluta per 1 h. Ripetere una volta prima di passare i campioni da 15 ml di xilene assoluta per 1 h. Ripetere questo passaggio una volta con xilene fresco.
    5. Incorporare campioni Colon tessuti in paraffina
      1. Immergere i campioni in 50 mL di paraffina liquida per 17 h. Ripetere questo passaggio una volta, ma solo per 3 ore.
      2. Immergere i campioni a cubetti (plastica, stampo quadrato, formato: 22 x 22 x 22 mm) in 810 ml di paraffina liquida.
      3. Lasciare la paraffina con i campioni di tessuto del colon solidificare per 24 ore a RT.
    6. Taglio del tessuto sezioni trasversali utilizzando un microtomo
      1. Tagliare i campioni del colon utilizzando un microtomo, secondo le istruzioni del produttore, con uno spessore di 5 micron.
      2. Raccogliere i tagli in un bagno d'acqua (1 L) contenente 0,3% di gelatina. Ciò impedisce la piegatura del tessuto sezioni trasversali. Recuperare le sezioni di tessuto e montarli su vetrini.
    7. Colorazione ematossilina-eosina di tessuto Sezioni
      1. Deparaffinare i campioni per 18 ore a 60 ° C in un incubatore. A questo scopo, utilizzare un vetro slide cremagliera con un manico.
      2. Dopo deparaffinizzazione, immergere i vetrini in 70 ml di xilene assoluto per 5 min. Ripetere questo passaggio una volta con xilene fresco.
      3. Trasferire i campioni in 70 ml di alcool assoluto per 1 min. Ripetere questo passaggio una volta con l'alcol fresco.
      4. Incubare i campioni di tessuto del colon in 70 ml di etanolo al 96% per 1 min. Ripetere questo passaggio una volta con l'alcol fresco.
      5. Lavare i campioni in acqua di rubinetto due volte per 2 s.
      6. Incubare i tessuti in ematossilina di Harris per 7 minuti.
      7. Lavare i campioni in acqua di rubinetto due volte per 2 s.
      8. Incubare i campioni in alcol acida (70 ml di etanolo al 70% e 700 ml di 1 M di acido cloridrico) per 7 s.
      9. Lavare i campioni in acqua di rubinetto due volte per 2 s.
      10. Incubare i campioni di tessuto in 70 mL di carbonato di litio (1 g di carbonato di litio in 100 ml di acqua distillata) per 7 s.
      11. Lavare i campioni in acqua di rubinetto due volte per 2 s.
      12. Incubare i campioni in 70 ml di etanolo 80% Per 1 min.
      13. Trasferire i campioni in 70 ml di Eosina-Y per 15 s.
      14. incubare in 70 ml di etanolo al 96% per 1 min. Ripetere questo passaggio una volta con l'alcol fresco.
      15. Incubare i campioni di tessuto in 70 ml di etanolo assoluto (alcool etilico anidro assoluto) per 1 min. Ripetere questo passaggio una volta con l'alcol fresco.
      16. Incubare i campioni in 70 mL di una miscela di 35 ml di alcol assoluto e 35 ml di xilene assoluta per 1 min.
      17. Trasferire i campioni in 70 mL di xilene assoluta per 1 min. Ripetere questa operazione per 5 minuti in 70 ml di xilene fresco assoluta.
      18. Aggiungere 80 ml di resina sintetica per i campioni di tessuto del colon, coprirli con coprioggetto, e lasciarli asciugare per 24 ore a temperatura ambiente. Infine, analizzare i campioni utilizzando in campo chiaro microscopia a 8.

    7. Analisi Junction Composizione per immunofluorescenza

    1. Preparare il tessuto come descritto al punto 5.7 e tagliare 8 micron di spessore sezioniutilizzando un criostato.
    2. Fissare e permeabilize colon sezioni con 96% di etanolo a -20 ° C per 20 min.
      NOTA: Tutte le incubazioni successive deve essere effettuata a temperatura ambiente, se non diversamente specificato, in una scatola buia umido per evitare l'essiccazione e fluorocromo sbiadimento.
    3. campioni di aria secca, e poi sciacquare li 3 volte per 5 minuti ciascuno con PBS 1x
    4. Incubare i campioni con soluzione bloccante (PBS contenente 0,01% di Tween e il 2% BSA) per 2 ore.
    5. Rimuovere la soluzione di saturazione e sciacquarlo con PBS-Tween 0,01% per 10 min.
    6. Durante questo tempo, diluire gli anticorpi primari alle concentrazioni desiderate in PBS-Tween 0,01%.
    7. Rimuovere la soluzione di lavaggio, applicare la soluzione di anticorpi dal passaggio precedente, e incubare una notte a 4 ° C in una scatola umidificata.
    8. Rimuovere la soluzione di anticorpi e lavare 3 volte con PBS-Tween 0,01% per 5 minuti ciascuno e una volta con acqua deionizzata per 10 min, con molto blanda agitazione.
    9. Durante il lavaggio, centrifuga Fluorochromeconjugated, specie-specifici anticorpi secondari a 14000g per 20 min a 4 ° C.
    10. Diluire gli anticorpi secondari senza precipitati come indicato dal fornitore in PBS-Tween 0,01%, applicarle, e incubare per 1 ora a temperatura ambiente.
    11. Ripetere passaggio 7.8 e rimuovere la soluzione di lavaggio più completo possibile.
    12. Dispensare 4 ml di agente anti-sbiadimento sopra ogni campione sul vetrino.
    13. Coprire i campioni con un coprioggetto.
    14. asciugare all'aria per 1 ora.
    15. scivolo Seal con smalto. Diapositive possono essere conservati a -20 ° C fino ad ulteriore analisi.
    16. Analizzare su un microscopio laser confocale 8.

    8. Determinazione dello Stress Ossidativo per ossidazione di etidio

    1. Dopo 7 giorni di DSS colite, preparare il tessuto come descritto al punto 5.7 e tagliare sezioni del colon in un criostato ad uno spessore di 5 micron. Mount sezioni su vetrini trattati con soluzione di lisina poli-L-e incubare il campione ingegnoh 5 mM di dihydroethidium (DHE) in acqua a 37 ° C per 30 minuti al buio.
    2. Lavare i campioni con PBS (pH 7,6) tre volte per 15 minuti ciascuno con agitazione a temperatura ambiente. Far asciugare i campioni e aggiungere una goccia di mezzo di montaggio per proteggere la fluorescenza. Osservare la fluorescenza di etidio ossidato su un microscopio confocale a scansione laser (ingrandimento 40X, 568 nm).

    9. Analisi dei leucociti reclutamento da parte MPO Assay

    1. Dopo 7 giorni di DSS colite, raccogliere il tessuto del colon e omogeneizzare i campioni (200-400 mg) con 1 ml di esadeciltrimetilammonio (HTAB) tampone (0,5% HTAB in tampone fosfato 50 mM, pH 6,0) usando un omogeneizzatore sul ghiaccio.
    2. Risciacquare la punta del omogeneizzatore due volte con 1 ml di tampone di HTAB per includere tutti i tessuti nel lisato e sonicare cinque volte a 40% di ampiezza per 10 s ciascuno. Gelo-disgelo in azoto liquido per tre volte.
    3. Centrifugare a 14.000 xg per 15 minuti e raccogliere il surnatante.Preparare 2,2'-Azino-bis soluzione (3-ethylbenzothiazoline-6-solfonico) (ABTS) mescolando ABTS, 5 ml di citrato di sodio (1 M in acqua), 0,1 ml di perossido di idrogeno, e 45 mL di bi -acqua distillata.
    4. Mescolare 0,1 ml di ciascun surnatante con 0,1 ml di ABTS soluzione in una piastra da 96 pozzetti a fondo piatto. Dopo 10 minuti, misurare l'assorbanza a 460 nm utilizzando uno spettrofotometro.

    10. Valutare l'espressione di citochine pro-infiammatorie mediante PCR

    1. Tissue omogeneizzazione
      1. Omogeneizzare 50 a 100 mg di campioni di tessuto del colon in 1 mL di una miscela guanidinio tiocianato-fenolo-cloroformio acido usando un omogeneizzatore alimentazione.
      2. Incubare a temperatura ambiente per 15 min.
    2. fase di separazione
      1. Aggiungere 0,2 ml di cloroformio e agitare vigorosamente per 30 s.
      2. Incubare a 4 ° C per 30 min.
      3. Centrifugare a 12.000 xg per 60 min a 4 ° C.
      4. Trasferire la ufase acquosa pper in una nuova provetta (~ 500 mL).
    3. RNA Precipitazione e Resuspension
      1. Aggiungere 0,5 ml di alcool isopropilico e incubare i campioni a 4 ° C per 60 min.
      2. Centrifugare a 12.000 xg per 30 min a 4 ° C.
      3. Rimuovere completamente il surnatante.
      4. Aggiungere 1 ml di etanolo al 75% e vortice.
      5. Centrifugare a 12.000 xg per 30 min a 4 ° C.
      6. Rimuovere il surnatante.
      7. Consentire l'etanolo restante asciugare all'aria per 3-5 minuti.
        NOTA: E 'importante non lasciare che il pellet di RNA asciughi completamente, in quanto questo diminuisce notevolmente la sua solubilità.
      8. Re-sciogliere il pellet in 0,3 ml di dietilpirocarbonato (DEPC) acqua -treated. trascrivere immediatamente i campioni di RNA in cDNA (più stabile, vedere il punto 10.5) o conservare a -80 ° C.
    4. RNA Quantificazione
      1. Diluire 1 ml di RNA con 99 ml di acqua DEPC-trattata.
      2. Leggere THe OD a 260 nm e 280 nm usando un UV / VIS spettrofotometro per determinare la concentrazione del campione e purezza.
    5. cDNA Synthesis
      1. Mescolare campioni di RNA (1-5 mcg) con 1 ml di Oligo (dT) 12-18 (0,5 mg / mL) e acqua DEPC trattati (volume totale di 12 mL) in provette sterili RNase-free.
      2. Incubare a 70 ° C per 10 min.
      3. Aggiungere 2 ml di 10x PCR Buffer, 1 ml di 50 mM MgCl 2, 1 ml di 10 mM dNTP mix, e 2 ml di 0,1 M ditiotreitolo (DTT).
      4. Incubare a 4 ° C per 5 min.
      5. Aggiungere 1 ml di trascrittasi inversa e incubare a 42 ° C per 5 min.
      6. Incubare a 70 ° C per 15 min.
      7. Incubare a 4 ° C per 15 min. cDNA può essere conservato a -20 ° C fino all'utilizzo.
    6. PCR
      1. Mescolare 2,5 ml di 10x PCR Buffer, 1,5 ml di 25 mM MgCl 2, 0,5 ml di 10 mM dNTP Mix, 0,25 μL di Taq DNA polimerasi, 0,25 ml di ciascun primer (10 pM) e cDNA (100 ng), e acqua sterile fino ad un volume totale di 25 microlitri.
      2. Eseguire i campioni su un termociclatore a 96 pozzetti. Per evitare l'amplificazione del DNA genomico, avanti e indietro primer devono essere situati in differenti esoni: IL1β-FW: GCAACTGTTCCTGAACTCAACT e IL1β-RE: TCTTTTGGGGTCCGTCAACT; IL6-FW: CCTTCCTACCCCAATTTCCAA e IL6-RE: AGATGAATTGGATGGTCTTGGTC; KC-FW: TGTCAGTGCCTGCAGACCAT e KC-RE: CCTGAGGGCAACACCTTCA; e Actina-FW: TATCCACCTTCCAGCAGATGT e Actina-RE: AGCTCAGTAACAGTCCGCCTA. Utilizzare le seguenti condizioni di PCR: 95 ° C per 5 min seguita da 30 cicli a 95 ° C per 15 s, 58 ° C per 30 s, e 72 ° C per 30 s, più una estensione finale per 10 minuti a 72 ° C .

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Dieta Supplementi possono proteggere dal DSS colite

supplementi dietetici anti-infiammatorie e antiossidanti, come la vitamina C, vitamina E, l'ossido nitrico (NO) -source L-arginina, e acidi grassi polinsaturi ω3-(ω3-PUFA), sono stati utilizzati con successo variabile in animali modelli per alleviare i segni di malattie infiammatorie 3,6,15. Malnutrizione, stress ossidativo, e la produzione di citochine pro-infiammatorie possono attivare sia colite acuta e cronica 3. In uno studio precedente, abbiamo dimostrato che una combinazione di micronutrienti mostrato effetti protettivi contro colite DSS-indotta in vivo. Qui, forniamo i protocolli dettagliate su come questi effetti sono stati misurati 8. In primo luogo, abbiamo analizzato gli effetti di supplementi nutrizionali sulla progressione della malattia determinando l'indice di attività della malattia (DAI), composto da tre parametri di perdita di peso,consistenza delle feci, e sanguinamento perianale. Risultati rappresentativi mostrato che il trattamento DSS ha portato ad un continuo aumento DAI, come previsto, raggiungendo un massimo di 8,2 ± 0,46 del giorno sette (Figura 1A). supplementazione dieta anti-infiammatoria ritardato l'insorgenza di colite, ma in momenti successivi, quando la colite era molto forte, l'effetto protettivo era marginale e non è più statisticamente significativa, il che suggerisce che i supplementi dietetici sono efficaci solo quando la colite non è ancora troppo forte. Importante, intervento dietetico potrebbe impedire l'aumento DSS-indotta intestinale permeabilità epiteliale, che è una caratteristica importante della colite (Figura 1B). DSS colite portato a lunghezze colon ridotte, e questo accorciamento è stato anche migliorato dalla dieta integratore anti-infiammatori e anti-ossidativo (Figura 1C). Così, i sintomi clinici della colite possono infatti essere alleviati dai cambiamenti nella composizione della dieta.

Per analizzare il motivo per cui colite progressione è stato meno grave negli animali trattati con un integratore alimentare, la morfologia dei tessuti è stata studiata dopo ematossilina / eosina (H / E) colorazione dei tessuti del colon distale inclusi in paraffina. I campioni di controllo hanno mostrato una morfologia normale (Figura 2A, pannello superiore), considerando che gli animali trattati con 3,5% DSS hanno mostrato segni tipici di colite (vale a dire, l'infiltrazione dei leucociti, la formazione di edema, displasia cripta, e ulcerazioni, figura 2A, pannello centrale). Da segnalare, il trattamento parallelo con la supplementazione dieta chiaramente alleviato cambiamenti morfologici colite indotta, con una morfologia complessiva che era più paragonabile al gruppo di controllo (Figura 2A, pannello inferiore). Queste osservazioni erano molto simili a quanto è statoriportato per co-trattamenti con batteri probiotici 13 e mostrano chiaramente che i cambiamenti nella dieta possono contrastare lo sviluppo della colite.

Sapevamo già che la permeabilità epiteliale intestinale colite indotta potrebbe essere neutralizzata da supplementazione di dieta. Aumento della permeabilità è una caratteristica della IBD, ed è in gran parte causata dalla smontaggio delle giunzioni di stabilizzazione adherens (AJ) e giunzioni strette (Tj). Destabilizzazione dei contatti di cellule epiteliali nel internalizzazione delle proteine giunzionali è indotta da citochine pro-infiammatorie, che sono abbondantemente prodotti durante la colite 16. Abbiamo trovato, attraverso la colorazione di immunofluorescenza di tessuto del colon distale, che le TJ molecola zonula occludere-1 (ZO-1) e l'AJ molecola di E-caderina sono stati internalizzati durante la colite DSS-indotta e che la co-localizzazione di queste proteine ​​è stato in parte perduta a contatti cellule epiteliali cripta (Figura 2B). iomportantly, internalizzazione di E-caderina e ZO-1 è stato ridotto quando i topi DSS trattati sono stati co-trattati con una dieta integratore anti-infiammatori e anti-ossidativo (Figura 2B). Nel complesso, le strutture della cripta e di giunzione sono stati più paragonabili a controlli quando è stato applicato il supplemento dieta, suggerendo che l'effetto protettivo osservato era almeno in parte dovuto alla conservazione dell'architettura del tessuto.

Intervento dietetico può contrastare infiammatoria neutrofili reclutamento, lo stress ossidativo, e la produzione di citochine pro-infiammatorie

Un altro segno distintivo di IBD è incontrollata infiltrazione dei neutrofili. Neutrofili reclutati contribuiscono al danno tissutale producendo e rilasciando le specie reattive dell'ossigeno (ROS) e proteasi 17. L'utilizzo di un saggio di attività MPO, abbiamo trovato una forte reclutamento dei neutrofili nel colon in risposta al DSS, che è stato contrastatodalla supplementazione di dieta (figura 3A).

Lo stress ossidativo è un'altra caratteristica importante della colite, causato dal rilascio di ROS dai neutrofili reclutati. Così, abbiamo analizzato la produzione di ROS in colon sezioni trasversali. Figura 3B dimostra che il trattamento DSS fortemente aumentato stress ossidativo. Da segnalare, cambiamenti nella dieta completamente impedito DSS stress ossidativo indotto (Figura 3B), che è più probabile una conseguenza della ridotta reclutamento dei neutrofili (Figura 3A).

Citochine pro-infiammatorie e chemochine sono fortemente prodotte da vari tipi di cellule durante la colite 18. Tali mediatori infiammatori contribuiscono a neutrofili di reclutamento e di proteine ​​di derivazione internalizzazione-caratteristiche che noi già sapevamo potrebbe essere attenuato da cambiamenti nella dieta. Analisi di espressione di mRNA mediante RT-PCR ha rivelato che il DSSaumentato l'espressione di IL1β, IL-6, e cheratinociti derivato chemochina (KC), come previsto (Figura 3C), e che la supplementazione dieta anti-infiammatoria diminuiva questo aumento DSS-indotta (Figura 3C). Questi dati implicano che i supplementi dietetici possono effettivamente servire a contrastare i segni clinici della malattia infiammatoria intestinale.

Figura 1
Figura 1. Integratori alimentari possono alleviare Disease Activity Index, intestinale epiteliale permeabilità, e Colon accorciamento. (A) L'indice di attività della malattia (DAI, valori da 0 - 12) si compone di tre parametri di perdita di peso, la consistenza delle feci, e sanguinamento perianale ed è stato registrato quotidianamente nei gruppi sperimentali di controllo (CTRL), la colite, e la colite + integratore alimentare (colite + suppl.). Il gruppo di controllo non ha mostrato alcun segno di colite, con un conseguente DAI di 0 throughout del periodo sperimentale. n = 5 per gruppo. (B) intestinale permeabilità epiteliale è stata misurata da Evans perdite blu in gruppi sperimentali di cui sopra e stata espressa come assorbimento a 620 nm per g di tessuto. n = 8 per gruppo. Tutti i dati sono riportati come media ± la deviazione standard della media (SDM). * P <0,05; ** P <0.01; *** P <0.001. Sono state calcolate statistiche per ANOVA. (C) Immagini rappresentative di intere due punti dei rispettivi gruppi sperimentali dopo 7 giorni di trattamento. La scala sulla sinistra è in cm. Clicca qui per vedere una versione più grande di questa figura.

figura 2
Figura 2. Tissue Morfologia e Junction Architettura vengono conservati meglio durante Colite in sede di applicazione nutrizionale Supplements. (A) 5 micron paraffina sezione di biopsie di tessuti dai due punti distali dei rispettivi gruppi sperimentali sono state colorate con ematossilina / eosina e analizzate per i segni tipici della colite, come la formazione di edema (frecce), infiltrazione leucocitaria (frecce), e ulcerazioni (*). la morfologia del tessuto complessivo della colite + suppl. gruppo più assomiglia a quello del controllo rispetto al gruppo colite, dimostrando un effetto protettivo contro complessiva DSS colite. Le immagini sono rappresentativi di 3 preparati tissutali indipendenti per gruppo. Le immagini sono state scattate con un obiettivo 10X. Bar = 100 micron. (B) 8 micron colon crio-sezioni dei rispettivi gruppi sono state colorate con anticorpi contro ZO-1 (verde) e E-caderina (rossi). Co-localizzazione (giallo nelle immagini fuse; frecce) di E-caderina e ZO-1 a contatti di cellule epiteliali della cripta, che si perde durante la colite, è in gran parte conservato nella colite + suppl. gruppo. Le immagini sono rappresentativi di 3preparazioni di tessuto indipendenti. Bar = 50 micron. Clicca qui per vedere una versione più grande di questa figura.

Figura 3
Figura 3. neutrofili reclutamento, lo stress ossidativo, e la produzione di citochine pro-infiammatorie può essere ridotta di supplementi nutrizionali. (A) mieloperossidasi (MPO) l'attività è stata misurata per analizzare la quantità di reclutamento dei leucociti nei tessuti del colon nei gruppi sperimentali: controllo (CTRL), la colite, e la colite + integratore alimentare (colite + suppl.). n = 5 per gruppo; * P <0,05. I dati sono mostrati come media ± SDM. Sono state calcolate statistiche per ANOVA. (B) La fluorescenza di etidio ossidato, raffigurato in rosso come la misura dello stress ossidativo a 8-micron crio-sezioni di cotessuti LON, è stato registrato mediante microscopia confocale laser. Le immagini sono rappresentativi di 3 preparati tissutali indipendenti. Bar = 100 micron. (C) La produzione di citochine pro-infiammatorie IL1β e IL-6 e chemochine KC è stato determinato semi-quantitativa RT-PCR in un gel di agarosio 1,5% (in bianco e nero sono stati ritornato per motivi di chiarezza). β-actina servito come il gene housekeeping. Immagini rappresentative della tre preparati cDNA indipendenti sono mostrati. Clicca qui per vedere una versione più grande di questa figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Per poter utilizzare integratori alimentari negli studi clinici, i benefici e la sicurezza di tali supplementi devono essere attentamente valutati in vivo negli studi sugli animali. Nel caso di colite, diversi modelli animali appropriati che ricordano i segni clinici di IBD sono state stabilite, compresi i modelli chimici utilizzando DSS, TNBS, o acido acetico; modelli (KO), come IL10-KO out knock-; e la colite immuno-mediata dalle cellule utilizzando il trasferimento adottivo di cellule T 19-21. Il modello DSS di colite è un metodo rapido e affidabile di indurre colite che assomiglia a molti sintomi della malattia di IBD umana ed è stato utilizzato in una pletora di studi che hanno valutato i meccanismi molecolari di colite 22. Inoltre, DSS colite è reversibile e consente così anche per lo studio di guarigione dei tessuti dopo lo stimolo colitogenic è stato rimosso. Il protocollo fornito descrive in dettaglio il modello di colite DSS che sia già stato ottimizzato nel nostro laboratorio 8.

23. Inoltre, DSS deve essere in un intervallo di peso molecolare di 40 - 50 kDa per indurre colite. Per il ricercatore inesperto, sarà importante sviluppare un occhio per una valutazione imparziale dei parametri DAI della consistenza delle feci e sanguinamento perianale. Se la valutazione viene eseguita da un ricercatore inesperto, è consigliabile avere un collega confermare la valutazione, idealmente in cieco.

Per analizzare la permeabilità epiteliale intestinale per macromolecole, tre metodi principali sono stati utilizzati in tutta la letteratura: il saggio Evans blue dye, come qui descritto; l'instillazione di 4-kDa FITC-destrano in un'ansa intestinale; e alla somministrazione di 13,24,25 4-kDa FITC-destrano. In quest'ultimo test, FITC-destrano è alimentato con sonda gastrica, E la quantità di destrano FITC che ha attraversato l'epitelio e perdeva nel sangue viene misurata fluorometrically da campioni di siero. In questo saggio, la permeabilità dell'intero tratto gastrointestinale è misurata, poiché il tracciante passa tutto il percorso da esofago al retto e la maggior parte del tracciante passerà prima di raggiungere il colon. Nel modello loop, permeabilità viene misurata in una regione intestinale confinato usato per il loop (di solito tenue) 25. Al contrario, il blu Evans test ha il vantaggio che solo permeabilità epiteliale nel colon viene misurata, poiché il tracciante viene direttamente instillata tutto il colon. Quindi, da questo test, possiamo concludere che l'epitelio del colon è protetto dalla integratore alimentare.

E 'sempre importante per registrare il peso e la lunghezza del colon dopo l'estrazione e prima di utilizzare i tessuti per altri test, perché alcuni dati (ad esempio, trapelato Evans blu nel assa permeabilitày) sono espressi per g di tessuto. Inoltre, il rapporto peso-lunghezza è una lettura-out indipendenti di danno tissutale 26. In generale, la morfologia del tessuto viene analizzato utilizzando tessuti inclusi in paraffina colorate con ematossilina ed eosina, come descritto qui. Paraffina ha il vantaggio che la morfologia del tessuto è molto meglio conservata rispetto ad altri metodi di incorporamento. Ciò consente l'identificazione univoca di tipi cellulari all'interno della mucosa (ossia, cellule immunitarie, epiteliali, cellule caliciformi, ecc) e l'analisi delle alterazioni tissutali durante colite, come la formazione di edema, infiltrazione leucocitaria, ed erosioni apicali epiteliali. D'altra parte, paraffina ha lo svantaggio che immunofluorescenza può essere eseguita solo dopo il recupero epitopo tempo. Pertanto, abbiamo sempre prepariamo diverse biopsie di tessuto congelato incorporati in mescola ottobre Tali campioni di tessuto possono essere facilmente sezionati utilizzando un criostato e mostrano bassi livelli di autofluorescence. Usiamo l'etanolo per la fissazione da disidratazione, perché essa non interferisce con i filamenti di actina (come metanolo fa), né Inneschiamo autofluorescenza (come fa PFA). Utilizzando queste tecniche, abbiamo trovato che un integratore dieta anti-infiammatoria ed anti-ossidante può migliorare la morfologia tissutale e architettura giunzione durante colite (confronta figura 2).

Un'eccessiva assunzione neutrofili è un evento critico durante colite che è indotta dalla produzione di fattori chemiotattici in risposta all'infiammazione 17. reclutamento dei neutrofili è un evento fisiologico perché neutrofili contribuiscono alla rimozione della stecca infiammatoria e conseguente guarigione della ferita. Tuttavia, se questa risposta immunitaria innata non è adeguatamente controllato e terminato, neutrofili nella mucosa possono contribuire al danno tissutale da proteasi che liberano e le specie reattive dell'ossigeno. I neutrofili contengono MPO, che può essere facilmente misurata e quantificati tramite untest colorimetrico, dove la quantità di MPO è direttamente proporzionale al numero di neutrofili. La figura 3A mostra che neutrofili aumenta di reclutamento durante la colite e che l'intervento dietetico possono impedire questa risposta immunitaria eccessiva e incontrollata. In conformità con la presenza dei neutrofili abbondanti nella mucosa, lo stress ossidativo aumenta durante colite (Figura 3B).

La nostra integrazione dieta protegge chiaramente la mucosa dallo stress ossidativo, che è più probabile una conseguenza della ridotta reclutamento dei neutrofili. Come detto, i neutrofili sono attratti dalle chemochine e la produzione di chemochine è indotta da citochine pro-infiammatorie che sono secreti da vari tipi cellulari durante colite. Così, abbiamo ipotizzato che la ridotta assunzione dei neutrofili è una conseguenza della riduzione di citochine e chemochine di produzione. Figura 3C mostra che le citochine pro-infiammatorie IL-1β e IL-6, nonché lachemochine KC, sono upregulated durante la colite DSS-indotta. Il supplemento dieta invertito i livelli di IL-6 torna a controllare i livelli e migliorato l'aumento della produzione di IL-1β e KC. Da segnalare, KC è il fattore chemiotattico più importante per i neutrofili nei topi.

Così, si è tentati di speculare che la conservazione osservato di morfologia tissutale è dovuta alla ridotta infiltrazione dei neutrofili, che è, a sua volta, una conseguenza della ridotta produzione di KC. Analizzando produzione di RNA nei tessuti DSS-trattati mediante RT-PCR è problematico quando DSS residua è presente nel RNA isolato. Questo perché DSS inibisce entrambe le transcriptasi inversa e Taq-polimerasi. Se nessuna amplificazione può essere realizzato, sarà necessario purificare ulteriormente i campioni di RNA mediante precipitazione LiCl-mediata, come descritto altrove 27.

In sintesi, abbiamo descrivere in dettaglio diversi metodi per l'analisi dei danni ai tessuti durante DSS colite e come questo dAmage può essere migliorata con integratori alimentari. Le conoscenze acquisite da tali esperimenti sugli animali possono comportare la costituzione di coorti di pazienti per studiare gli effetti protettivi dei supplementi analizzati in IBD umana. I dati ottenuti da studi clinici possono quindi aprire nuove strade per sviluppare strategie di trattamento alternativo per la gestione di IBD.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori non hanno nulla da rivelare.

Acknowledgments

Questo lavoro è stato sostenuto da sovvenzioni dal Consiglio messicano per la Scienza e la Tecnologia (Conacyt, 207.268 e 233.395 a Michael Schnoor). KFCO è un destinatario di una borsa di studio Conacyt (396.260) per ottenere una laurea magistrale.

Materials

Name Company Catalog Number Comments
0.3% of gelatin  Bioxon 158
10% formaldehyde J.T. Baker 2106-03
96-well plate with flat bottom Corning 3368
Absolute ethanol  J.T. Baker 9000-03
Absolute xylene J.T. Baker 9490-03
ABTS Sigma Aldrich H5882
Bovine Serum Albumin Sigma-Aldrich 9048-46-8
ColoScreen Helena Laboratories 5072
Corabion (Kindly provided by Merck, Naucalpan, Mexico) Merck
Dextran Sulfate Sodium Salt Affymetrix 9011-18-1 (M.W. 40,000-50,000)
Dihydroethidium Life Technology D11347
Eosin-Y  J.T. Baker L087-03
Evans blue Sigma-Aldrich 314-13-6
Feeding  needle Cadence Science Inc. 9921
Glass slide rack with handle Electron Microscopy 70312-16
Glass Slides Corning 2947
Harris hematoxylin  Sigma-Aldrich H3136
Hexadecyltrimethyammonium (HTAB) Sigma Aldrich H6269
Histosette (Embedding cassette) Simport M498.2
Hydrochloric acid 1 M J.T. Baker 9535-62
Hydrogen peroxide Sigma Aldrich H3410
Ketamine PiSA Agropecuaria Q-7833-028
Liquid paraffin  Paraplast 39501-006
Lithium carbonate  Sigma-Aldrich 2362
N,N-dimethylformamide J.T. Baker 68-12-2
N-acetylcysteine Sigma-Aldrich A9165
Plastic cubes Electron Microscopy 70181
Poly-L-Lysine Solution Sigma-Aldrich 25988-63-0
Prism 5 statistical software GraphPad Software Prism 5
Saline Solution 0.9% NaCl CS PiSA Q-7833-009
Sodium citrate Sigma-Aldrich W302600
Synthetic resin  Poly Mont 7987
Taq DNA polymerase Invitrogen 11615-010
Tissue-tek. O.C.T Compound Sakura Finetek 4583
Tuberculine Syringe BD Plastipak 305945
Tween 20 Sigma-Aldrich 9005-64-5
VECTASHIELD Antifade Mounting Medium with DAPI Vector Laboratories H-1200
Xylazine PiSA Agropecuaria Q-7833-099

DOWNLOAD MATERIALS LIST

References

  1. Souza, H. S., Fiocchi, C. Immunopathogenesis of IBD: current state of the art. Nat Rev Gastroenterol Hepatol. 13, 13-27 (2016).
  2. Xavier, R. J., Podolsky, D. K. Unravelling the pathogenesis of inflammatory bowel disease. Nature. 448, 427-434 (2007).
  3. Neuman, M. G., Nanau, R. M. Inflammatory bowel disease: role of diet, microbiota, life style. Transl Res. 160, 29-44 (2011).
  4. Lowenberg, M., D'Haens, G. Next-Generation Therapeutics for IBD. Current Gastroenterol Rep. 17, 21 (2015).
  5. Bernstein, C. N. Does everyone with inflammatory bowel disease need to be treated with combination therapy. Curr Opin Gastroenterol. (2016).
  6. Nanau, R. M., Neuman, M. G. Nutritional and probiotic supplementation in colitis models. Dig Dis Sci. 57, 2786-2810 (2012).
  7. Yamamoto, T. Nutrition and diet in inflammatory bowel disease. Curr Opin Gastroenterol. 29, 216-221 (2013).
  8. Vargas Robles, H., et al. Experimental Colitis Is Attenuated by Cardioprotective Diet Supplementation That Reduces Oxidative Stress, Inflammation, and Mucosal Damage. Ox Med Cell Longev. 8473242 (2016).
  9. Vargas-Robles, H., Rios, A., Arellano-Mendoza, M., Escalante, B. A., Schnoor, M. Antioxidative diet supplementation reverses high-fat diet-induced increases of cardiovascular risk factors in mice. Ox Med Cell Longev. 2015, 467471 (2015).
  10. Perse, M., Cerar, A. Dextran sodium sulphate colitis mouse model: traps and tricks. J Biomed Biotechnol. 2012, 718617 (2012).
  11. Chassaing, B., Aitken, J. D., Malleshappa, M., Vijay-Kumar, M. Dextran sulfate sodium (DSS)-induced colitis in mice. Curr. Protoc. Immunol. 104, Unit 15 25 (2014).
  12. Laroui, H., et al. Dextran sodium sulfate (DSS) induces colitis in mice by forming nano-lipocomplexes with medium-chain-length fatty acids in the colon. PLoS One. 7, 32084 (2009).
  13. Mennigen, R., et al. Probiotic mixture VSL#3 protects the epithelial barrier by maintaining tight junction protein expression and preventing apoptosis in a murine model of colitis. Am J Physiol Gastrointest Liver Physiol. 296, 1140-1149 (2009).
  14. Park, C. M., Reid, P. E., Walker, D. C., MacPherson, B. R. A simple, practical 'swiss roll' method of preparing tissues for paraffin or methacrylate embedding. J Microsc. 145, 115-120 (1987).
  15. Shen, W., Gaskins, H. R., McIntosh, M. K. Influence of dietary fat on intestinal microbes, inflammation, barrier function and metabolic outcomes. J Nutr Biochem. (2013).
  16. Bruewer, M., et al. Interferon-gamma induces internalization of epithelial tight junction proteins via a macropinocytosis-like process. FASEB J. 19, 923-933 (2005).
  17. Fournier, B. M., Parkos, C. A. The role of neutrophils during intestinal inflammation. Muc Immunol. 5, 354-366 (2012).
  18. Yan, Y., et al. Temporal and spatial analysis of clinical and molecular parameters in dextran sodium sulfate induced colitis. PLoS One. 4, 6073 (2009).
  19. Maxwell, J. R., Viney, J. L. Overview of mouse models of inflammatory bowel disease and their use in drug discovery. Curr Prot Pharmacol, S.J. Enna. Chapter 5, Unit 5.57 (2009).
  20. Ostanin, D. V., et al. T cell transfer model of chronic colitis: concepts, considerations, and tricks of the trade. Am J Physiol Gastrointest Liver Physiol. 296, 135-146 (2009).
  21. Randhawa, P. K., Singh, K., Singh, N., Jaggi, A. S. A review on chemical-induced inflammatory bowel disease models in rodents. Kor J Physiol Pharmacol. 18, 279-288 (2014).
  22. Whittem, C. G., Williams, A. D., Williams, C. S. Murine Colitis modeling using Dextran Sulfate Sodium (DSS). JoVE. (2010).
  23. Wirtz, S., Neufert, C., Weigmann, B., Neurath, M. F. Chemically induced mouse models of intestinal inflammation. Nat Prot. 2, 541-546 (2007).
  24. Naydenov, N. G., et al. Nonmuscle Myosin IIA Regulates Intestinal Epithelial Barrier in vivo and Plays a Protective Role During Experimental Colitis. Sci Rep. 6, 24161 (2016).
  25. Sumagin, R., Robin, A. Z., Nusrat, A., Parkos, C. A. Transmigrated neutrophils in the intestinal lumen engage ICAM-1 to regulate the epithelial barrier and neutrophil recruitment. Muc Immunol. 7, 905-915 (2014).
  26. Laukoetter, M. G., et al. JAM-A regulates permeability and inflammation in the intestine in vivo. J Exp Med. 204, 3067-3076 (2007).
  27. Viennois, E., Chen, F., Laroui, H., Baker, M. T., Merlin, D. Dextran sodium sulfate inhibits the activities of both polymerase and reverse transcriptase: lithium chloride purification, a rapid and efficient technique to purify RNA. BMC Res Notes. 6, 360 (2013).
Analizzando Effetti benefici dei supplementi nutrizionali sulle funzioni intestinali epiteliali barriera durante Experimental Colitis
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Vargas Robles, H., Castro Ochoa, K. F., Nava, P., Silva Olivares, A., Shibayama, M., Schnoor, M. Analyzing Beneficial Effects of Nutritional Supplements on Intestinal Epithelial Barrier Functions During Experimental Colitis. J. Vis. Exp. (119), e55095, doi:10.3791/55095 (2017).More

Vargas Robles, H., Castro Ochoa, K. F., Nava, P., Silva Olivares, A., Shibayama, M., Schnoor, M. Analyzing Beneficial Effects of Nutritional Supplements on Intestinal Epithelial Barrier Functions During Experimental Colitis. J. Vis. Exp. (119), e55095, doi:10.3791/55095 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter