Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Medicine

Analisando Efeitos benéficos de suplementos nutricionais sobre as funções intestinais epitelial de barreira Durante Experimental Colite

doi: 10.3791/55095 Published: January 5, 2017

Summary

Os tratamentos actuais de doenças inflamatórias do intestino (IBD) destinam-se a atenuar os sintomas da doença, mas pode causar efeitos laterais graves. Assim, estratégias alternativas estão a ser investigados em modelos de colite em animais. Aqui, vamos explicar como os efeitos benéficos da dieta suplementos em sinais clínicos IBD são analisados ​​de tal modelo de colite.

Abstract

doenças inflamatórias intestinais (DII), incluindo a doença de Crohn e colite ulcerativa, são doenças reincidentes crônicas dos intestinos. Eles causar problemas graves, como cólicas abdominais, diarreia com sangue, perda de peso e, em indivíduos afetados. Infelizmente, não existe nenhuma cura ainda, e tratamentos só têm como objectivo aliviar os sintomas. Os tratamentos actuais incluem drogas anti-inflamatórias e imunossupressoras que podem causar efeitos colaterais graves. Isso garante que a busca de opções alternativas de tratamento, tais como suplementos nutricionais, que não causam efeitos colaterais. Antes de sua aplicação em estudos clínicos, tais compostos devem ser rigorosamente testados para a eficácia e segurança em modelos animais. Um modelo experimental de confiança é o modelo de dextrano sulfato de sio (DSS) A colite em ratos, que reproduz muitas das manifestações clínicas de colite ulcerativa em seres humanos. Recentemente aplicado este modelo para testar os efeitos benéficos de um suplemento nutricional contendovitaminas C e E, L-arginina, e os ácidos gordos poli-insaturados de w3-(PUFA). Foram analisados ​​vários parâmetros de doença e descobriram que este suplemento foi capaz de melhorar a formação de edema, danos nos tecidos, a infiltração de leucócitos, o stress oxidativo, e a produção de citocinas pró-inflamatórias, conduzindo a uma melhoria global do índice de actividade da doença. Neste artigo, vamos explicar em detalhe a correcta aplicação de suplementos nutricionais utilizando o modelo de colite DSS em camundongos C57BL / 6, bem como a forma como parâmetros de doença, tais como histologia, estresse oxidativo e inflamação são avaliados. Analisando os efeitos benéficos de diferentes suplementos dietéticos podem, eventualmente, abrir novos caminhos para o desenvolvimento de estratégias de tratamento alternativo que aliviam sintomas de DII e / ou que prolongam as fases de remissão, sem causar efeitos colaterais graves.

Introduction

A colite ulcerosa é uma doença inflamatória do cólon que podem causar diarreia e dor abdominal. A colite pode ser aguda, em resposta à infecção ou ao stress, ou pode desenvolver-se como uma doença crónica, tal como em colite ulcerosa (UC), que pertence ao grupo das doenças inflamatórias do intestino (IBD). Embora os sinais clínicos da UC têm sido bem descrito, a patogênese ainda é pouco compreendida 1. Ele é aceito entre os especialistas que a UC é uma doença multifatorial, com mutações genéticas e respostas imunes aberrantes que jogam um papel importante 2. No entanto, fatores ambientais, tais como o estilo de vida e nutrição, também contribuem para o desenvolvimento e progressão da doença 3.

Infelizmente, IBD não é curável, mas existem muitas opções de tratamento que visam aliviar os sintomas clínicos. Os tratamentos actuais incluem medicamentos anti-inflamatórios, tais como sulfassalazina e corticosteróides; imunossupressores, tais como azathioPrine; Os anticorpos monoclonais que captura de citocinas pró-inflamatórias, tais como o factor de necrose tumoral-α (TNF-α), ou moléculas de adesão de bloco, tais como integrinas, para reduzir o recrutamento de leucócitos em excesso; e inibidores de quinases que têm como alvo que desencadeiam vias pró-inflamatórias, tais como Janus quinase (JAK) 4. Nem todos os pacientes respondem a todos os tratamentos, assim que estratégias terapêuticas deve ser individualizada 5. Além disso, a maior parte destes fármacos terapêuticos interferir com o metabolismo e as respostas imunes, causando muitas vezes efeitos colaterais graves. Por esta razão, as opções de tratamento alternativas têm sido investigadas.

Os tratamentos alternativos incluem probióticos e suplementos nutricionais, que tenham sido aplicadas em modelos animais e em ensaios clínicos com variados níveis de sucesso 6,7. Descobrimos recentemente que a aplicação de diferentes suplementos nutricionais individuais, tais como vitaminas anti-oxidantes, e ácidos gordos ω3-poli-insaturados (PUFAS), é inferior à aplicação de uma combinação de tais suplementos para aliviar os sintomas da colite e doença cardiovascular 8,9. Estes estudos foram realizados em ratinhos, assim estudos clínicos devem ser realizados em humanos para determinar se estes resultados também serão aplicáveis ​​aos seres humanos. Antes de estudos clínicos são iniciados, a eficácia ea segurança de novas opções de tratamento deve ser avaliada em modelos animais.

Para o IBD, o modelo de dextrano sulfato de sio (DSS) tem sido amplamente utilizada para estudar os mecanismos do desenvolvimento da doença e os efeitos benéficos dos medicamentos e suplementos nutricionais 6,10. Na maioria dos estudos, somente uma doença aguda ao longo de um período de tempo de sete dias é induzida; No entanto, os sinais clínicos observados nestes animais assemelham-se muito aos observados em pacientes com DII (isto é, diarreia com sangue, perda de peso, disfunção epitelial e infiltração de células imunes) 10. DSS induz erosões na mucosa,resultando em disfunção da barreira e no aumento da permeabilidade epitelial intestinal 11. O mecanismo exato permanece desconhecido. No entanto, um estudo sugere que DSS interage com ácidos gordos de comprimento de cadeia médio para formar nano-lipocomplexes que são capazes de entrar nas células epiteliais e para induzir a sinalização inflamatória vias 12. Neste artigo, descrevemos em detalhes como Colite é induzida e analisada em ratos, como os suplementos nutricionais são aplicadas por sonda para garantir uma dosagem constante em cada animal, e como os efeitos de tais suplementos sobre vários sintomas de colite são examinados.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Todos os experimentos com animais foram aprovados pelo Comitê de Cuidado e Uso Institucional animal de CINVESTAV.

1. Preparação de DSS água potável ea indução da colite

  1. Prepare uma solução / 3,5% w v sulfato de dextrano de sódio (DSS) em água potável autoclavado. DSS dissolve-se facilmente e não é necessária para filtrar a solução final.
    NOTA: 7 dias de tratamento com DSS induz colite grave. Se indução de colite ligeira, 3 - são recomendados 4 dias de tratamento. Enquanto a água de beber DSS permanece clara, não é necessário mudar a água. No entanto, se se turva, ele deverá ser substituído.
  2. Registar o peso de base de ratinhos machos. Certifique-se de que eles são de 8 - 12 semanas de idade e dentro de uma gama de 21 - 25 g de peso corporal.
    NOTA: A concentração DSS apropriada deve ser optimizada em cada laboratório. Os resultados podem variar bastante, dependendo das condições de habitação. Concentrações entre 2,5 - 5% são normalmente relatados para induzir forte colitis em camundongos C57BL / 6J WT ratos 10. DSS a partir de diferentes empresas e diferentes lotes deve ser testado, como resultado também pode variar com diferentes fontes de DSS.
  3. Fornecer água ad libitum e substituí-lo com água fresca DSS 3,5%, se necessário.

2. Aplicação de suplementos nutricionais por sonda

  1. Prepara-se uma solução "feedable" dos suplementos nutricionais desejados, num solvente adequado. Para este estudo, utilizou-se uma mistura contendo 200 mg / kg de L-arginina, 83 mg / kg de vitamina C, 46 mg / kg de vitamina E, 77 mg / kg de ácido eicosapentaenóico (EPA), e kg de ácido 115 mg / docosahexaenóico (DHA ) numa solução 1: 1 de água e óleo de cártamo.
  2. Encha uma seringa de 1 ml ligada a uma agulha de gavagem (15 g x 50 mm) com a mistura de suplemento nutricional. Passe o exterior da agulha de gavagem para remover qualquer composto fora da agulha e para assegurar a aplicação da dose adequada.
  3. Contenha o mouse, segurando a base da cauda comum lado, e ao agarrar firmemente uma dobra de pele na parte posterior do pescoço com o polegar e o dedo indicador da outra mão. Coloque a cauda entre o terceiro dedo e a base do polegar da mesma mão que segura o pescoço.
  4. Enquanto se mantém o rato numa posição vertical, inserir a agulha no lado esquerdo da boca do animal e seguir cuidadosamente o céu da boca para localizar o esófago. Se não for encontrada resistência, avançar a agulha para o estômago.
    NOTA: Verifique se o animal está respirando corretamente antes de prosseguir.
  5. Administrar a mistura lentamente, retirar o tubo lentamente puxando para fora da seringa, e solte o mouse. Aplicar suplementos nutricionais uma vez por dia por gavagem durante o curso da experiência colite.

3. Determinação do Índice de Atividade da Doença

NOTA: O índice de atividade da doença é a combinação das pontuações para perda de peso, sangramento perianal e consistência das fezes, que são obtained diária 13.

  1. Medir o peso corporal diariamente e atribuir uma pontuação de 0 a 4 de acordo com a percentagem de perda de peso (0: 0%, 1: 1 - 5%, 2: 5 - 10%, 3: 10 - 20%, e 4:> 20 %).
    NOTA: Peso corporal perda é determinada calculando a diferença em percentagem entre o peso basal antes da indução de colite DSS-e o peso real.
  2. Para determinar o nível de hemorragia perianal, recolher uma amostra de fezes frescas e usar os aplicadores fornecidos para aplicar uma mancha fina em um slide a partir de um kit fecal guaiac exame de sangue oculto. Use um novo aplicador para cada amostra.
    1. Fechar a tampa na parte da frente e abrir a janela na parte de trás da lâmina. Aplicar duas gotas da solução de revelação para a parte de trás na localização da amostra.
    2. Leia os resultados após 30 s. Qualquer traço de cor azul é positivo para sangue oculto. Atribuir uma pontuação de 0 a 4 (0: nenhum, 0,5-2,5: teste positivo guaiac fecal de sangue oculto (dependendo da intensidade do sinal) e 3-4: groSS sangramento).
      NOTA: Se o sangue nas fezes é visível, o teste de sangue oculto fecal com guaiaco não tem de ser realizada, e uma pontuação de 3, 3,5, ou 4 é atribuído, dependendo da quantidade de sangue visível.
  3. Determinar a consistência das fezes, observando uma amostra de fezes frescas. Atribuir uma pontuação de 0 a 4 (0: sólido, 0,5 Normal / - 2,5: fezes pastosas e 3-4: diarreia).

4. Determinar intestinal epitelial Permeabilidade in vivo por Evans Blue Assay

  1. Anestesiar os animais por injecção de lhes por via intraperitoneal com uma mistura de cetamina (100 mg / kg de peso corporal) e xilazina (13 mg / kg de peso corporal) diluído em solução salina (NaCl 0,9%), e avaliar a profundidade da anestesia através da monitorização do beliscão reflexo de retirada.
  2. Colocar os animais anestesiados numa posição supina e executar uma laparotomia para expor os intestinos.
  3. Localizar o ceco e fazer uma pequena incisão no segmento proximal do cólon umascendens (idealmente, imediatamente adjacentes ao ceco).
  4. Inserir uma agulha de alimentação (G22) e fixe-o com uma ligadura usando um fio de seda comum. Cuidadosamente lave abundante PBS através do tubo para lavar todas as fezes do cólon. Incutir solução de azul de Evans (1,5% w / v em PBS) no cólon até que se atinge o ânus.
  5. Incubar a azul de Evans para 15 min. Lavar o corante através de lavagem do tubo com abundante PBS até o washout perianal é clara.
  6. Eutanásia dos animais por deslocação cervical.
  7. Extirpar o cólon e lave-o novamente com abundante PBS. Lavar uma vez com 1 ml de 6 N -acetylcysteine mM em PBS para eliminar qualquer corante que adere ao muco do cólon.
  8. Cortar o cólon longitudinalmente e lavá-lo mais uma vez com PBS e 1 ml de 6 N -acetylcysteine mM.
  9. Grave o peso e comprimento. Para extrair o corante azul de Evans, colocar o cólon em 2 mL de N, N-dimetilformamida durante a noite à temperatura ambiente com suave Agitation. Medir a concentração do corante espectrofotometricamente a 610 nm.

Coleção 5. Tissue

  1. Anestesiar os animais por injecção de lhes por via intraperitoneal com uma mistura de cetamina (100 mg / kg de peso corporal) e xilazina (13 mg / kg de peso corporal) diluído em solução salina (NaCl 0,9%), e avaliar a profundidade da anestesia através da monitorização do beliscão reflexo de retirada.
  2. Eutanásia dos animais por deslocação cervical.
  3. Colocar os animais em decúbito dorsal e executar uma laparotomia para expor a cavidade abdominal.
  4. Com uma tesoura, dissecar todo o cólon e registrar o seu comprimento.
  5. Lavar o cólon cuidadosamente várias vezes com PBS arrefecido para remover as fezes. Registe o peso do tecido e para preparar as seguintes experiências, conforme descrito nas etapas 5.6 - 5.8.
  6. Para o isolamento do RNA e ensaios (MPO), corte uma amostra de tecido de tamanho apropriado (100 mg é geralmente suficiente), coloque-o dentro de um tubo, e snap congelar-lo em azoto líquido. Armazenar os tecidos a -80 ° C para uso futuro.
  7. Para a coloração de imunof luorescência e determinação estresse oxidativo (veja abaixo), cortado uma pequena amostra de cólon (0,5-1 cm) e mergulhe em taças de alumínio pequenos cheios com temperatura de corte óptima composto (OCT). Colocar os copos em gelo seco e deixá-los congelar lentamente, a fim de evitar a formação de bolhas. amostras de tecido congeladas podem ser armazenadas a -80 ° C para uso futuro.
  8. Para Swiss rolos 14, abra o cólon longitudinalmente e retire cuidadosamente fezes usando uma pinça. Enrolá-lo, com a mucosa virada para dentro, usando uma pinça de ponta fina ou, uma vara de madeira redonda fina. Com cuidado, coloque-o dentro de uma cassete de incorporação e continue com a etapa 6.1.
    NOTA: DSS induz danos no cólon. No entanto, a distribuição de danos varia de proximal para distal, do cólon, com a maioria dos danos geralmente visto no cólon distai e do recto. Assim, recomendamos a analisar a histologia, quer no colo distalou em papéis suíços de todo o cólon.

6. Análise de Histologia Colon por coloração de hematoxilina-eosina

  1. Preparação do tecido
    1. Para a análise histológica, quer submergir os rolos suíços ou os pequenos pedaços de tecido de certas regiões do cólon de controlo e murganhos tratados em 5 ml de formaldeído a 10% durante 48 h à temperatura ambiente (TA) para obter uma fixação adequada.
      NOTA: Todos os outros passos no passo 6 são realizadas à temperatura ambiente, a menos que indicado de outra forma.
    2. Lavá-los com água da torneira durante 18 horas.
    3. Desidratar-los com 15 mL de etanol a 70% durante 1 h, 96% durante 1 h, e etanol absoluto, durante 1 h. Repita cada etapa com álcool fresco antes de prosseguir para a próxima concentração.
    4. Continuar a desidratação em uma mistura de 7,5 ml de etanol absoluto e 7,5 mL de xileno absoluto, durante 1 h. Repetir uma vez antes de passar as amostras a 15 ml de xileno absoluto, durante 1 h. Repita este passo uma vez com xileno fresco.
    5. Incorporação amostras de tecido do cólon em parafina
      1. Mergulhar as amostras em 50 ml de parafina líquida durante 17 h. Repita este passo uma vez, mas por apenas 3 h.
      2. Mergulhar as amostras em cubos (plástico, molde quadrado, tamanho: 22 x 22 x 22 mm) em 810 ml de parafina líquida.
      3. Permitir que a parafina com as amostras de tecido do cólon para solidificar durante 24 h à TA.
    6. Corte de tecidos Secções usando um Microtome
      1. Cortar amostras do cólon usando um micrótomo, de acordo com as instruções do fabricante, com uma espessura de 5 um.
      2. Recolher os cortes em um banho de água (1 L) contendo 0,3% de gelatina. Isto evita a dobragem do tecido secções transversais. Recuperar os cortes de tecido e montá-los em lâminas de vidro.
    7. Hematoxilina e eosina de tecido Secções
      1. Desparafinar as amostras durante 18 h a 60 ° C em uma incubadora. Para esta finalidade, utilizar um vidro slide acumular com uma alça.
      2. Após desparafinização, mergulhe as lâminas em 70 mL de xileno absoluta para 5 min. Repita este passo uma vez com xileno fresco.
      3. Transferir as amostras em 70 ml de álcool absoluto para 1 min. Repita este passo uma vez com álcool fresco.
      4. Incubar as amostras de tecido do cólon em 70 ml de etanol a 96% durante 1 min. Repita este passo uma vez com álcool fresco.
      5. Lave as amostras da água de torneira duas vezes por 2 s.
      6. Incubar os tecidos em hematoxilina de Harris durante 7 min.
      7. Lave as amostras da água de torneira duas vezes por 2 s.
      8. Incubar as amostras em álcool ácida (70 mL de etanol a 70% e 700 ul de 1 M de ácido clorídrico) por 7 s.
      9. Lave as amostras da água de torneira duas vezes por 2 s.
      10. Incubar as amostras de tecido em 70 ml de carbonato de lítio (1 g de carbonato de lítio em 100 mL de água destilada) durante 7 s.
      11. Lave as amostras da água de torneira duas vezes por 2 s.
      12. Incubar as amostras em 70 ml de etanol a 80% Durante 1 min.
      13. Transferir as amostras em 70 mL de Eosina-Y durante 15 s.
      14. Incubar-los em 70 ml de etanol a 96% durante 1 min. Repita este passo uma vez com álcool fresco.
      15. Incubar as amostras de tecido em 70 ml de etanol absoluto (álcool etílico anidro absoluto) durante 1 min. Repita este passo uma vez com álcool fresco.
      16. Incubar as amostras em 70 ml de uma mistura de 35 ml de álcool absoluto e 35 ml de xileno absoluto durante 1 min.
      17. Transferir as amostras em 70 ml de xileno absoluto durante 1 min. Repetir esta etapa para 5 min em 70 ml de xileno absoluto fresco.
      18. Adicionar 80 ul de resina sintética para as amostras de tecido do cólon, cobri-los com lamelas, e deixar secar durante 24 h à TA. Finalmente, analisar as amostras usando microscopia de campo brilhante 8.

    7. Analisar junção Composição por imunofluorescência

    1. Prepara-se o tecido, tal como descrito no passo 5.7 e cortar secções transversais 8 um de espessurautilizando um criostato.
    2. Fix e permeabilizar cólon secções transversais com 96% de etanol a -20 ° C durante 20 min.
      Nota: Todas as incubações subsequentes deve ser levada a cabo a temperatura ambiente, a menos que indicado de outra forma, dentro de uma caixa escura húmido para evitar a secagem e fluorocromo desvanecimento.
    3. amostras de ar seco, e em seguida lavá-los 3 vezes durante 5 minutos cada um com 1x PBS
    4. Incubar as amostras com a solução de bloqueio (PBS contendo 0,01% de Tween e BSA a 2%) durante 2 h.
    5. Remover a solução de bloqueamento e enxaguar com PBS-0,01% de Tween durante 10 minutos.
    6. Durante este tempo, dilui-se os anticorpos primários para as concentrações desejadas em PBS-0,01% de Tween.
    7. Remover a solução de lavagem, aplicam-se a solução de anticorpo a partir do passo anterior, e incubar durante a noite a 4 ° C numa caixa humidificada.
    8. Remover a solução de anticorpos e lavar 3 vezes com PBS-Tween 0,01% durante 5 min cada e uma vez com água desionizada durante 10 min, com agitação muito suave.
    9. Enquanto a lavagem, fluor centrífugaochromeconjugated, específicas da espécie anticorpos secundários a 14000 xg durante 20 min a 4 ° C.
    10. Dilui-se a anticorpos secundários, sem precipitados, tal como indicado pelo fornecedor em PBS-0,01% de Tween, aplicá-los, e incubar durante 1 h a RT.
    11. Repetir o passo 7.8 e remover a solução de lavagem tão completamente quanto possível.
    12. Pipeta de 4 mL de agente anti-desvanecimento sobre cada amostra no slide.
    13. Cobrir as amostras com uma lamela.
    14. Secar ao ar durante 1 h.
    15. slides Seal com unha polonês. As lâminas podem ser armazenadas a -20 ° C até análise posterior.
    16. Analisar num microscópio confocal de laser 8.

    8. Determinação do estresse oxidativo por oxidação de Ethidium

    1. Após 7 dias de DSS colite, preparar o tecido, tal como descrito no passo 5.7 e cortar secções de cólon em um criostato com uma espessura de 5 um. Montagem de secções transversais em lâminas de vidro tratadas com uma solução de lisina de poli-L-e incubar o engenho amostrasH 5? M de dihydroethidium (DHE) em água a 37 ° C durante 30 min no escuro.
    2. Lavam-se as amostras com PBS (pH 7,6) três vezes durante 15 minutos cada, com agitação suave à temperatura ambiente. Ar secar as amostras e adicionar uma gota de meio de montagem para proteger a fluorescência. Observar a fluorescência do etídio oxidado em um microscópio confocal de varredura a laser (40X, 568 nm de comprimento de onda).

    9. Análise de leucócitos Recrutamento pela MPO Ensaio

    1. Após 7 dias de DSS colite, recolher o tecido do cólon e homogeneizar as amostras (200-400 mg) com 1 ml de hexadeciltrimetilamónio (HTAB) tampão (0,5% HTAB em tampão fosfato 50 mM, pH 6,0) utilizando um homogeneizador em gelo.
    2. Lavar a ponta do homogeneizador duas vezes com 1 ml de tampão HTAB a incluir todo o tecido no ligado e sonicar que cinco vezes, em 40% de amplitude durante 10 s cada. Congelamento e descongelamento em azoto líquido três vezes.
    3. Centrifugar a 14000 xg durante 15 minutos e recolher o sobrenadante.Prepare 2,2'-azino-bis solução de (3-etilbenzotiazolina-6-sulfónico) (ABTS) por mistura de ABTS, 5 mL de citrato de sódio (1 M em água), 0,1 ml de peróxido de hidrogénio, e 45 ml de bi -água destilada.
    4. Misturar 0,1 ml de cada sobrenadante com 0,1 ml de solução de ABTS em uma placa de 96 poços de fundo plano. Após 10 min, medir a absorvência a 460 nm utilizando um espectrofotómetro.

    10. Avaliação da expressão de citocinas pró-inflamatórias por PCR

    1. A homogeneização de tecidos
      1. Homogeneizar 50 a 100 mg de amostras de tecido do cólon em 1 mL de uma mistura de tiocianato de guanidina-fenol-clorofórmio ácido usando um homogeneizador de energia.
      2. Incubar-la à temperatura ambiente durante 15 min.
    2. A separação de fases
      1. Adicionar 0,2 ml de clorofórmio e agitar vigorosamente durante 30 s.
      2. Incubar a 4 ° C durante 30 min.
      3. Centrifuga-se a 12000 xg durante 60 min a 4 ° C.
      4. Transferir o upper fase aquosa para um tubo fresco (~ 500 mL).
    3. RNA Precipitation e ressuspensão
      1. Adicionar 0,5 mL de álcool isopropílico e incubar as amostras a 4 ° C durante 60 min.
      2. Centrifuga-se a 12000 xg durante 30 min a 4 ° C.
      3. Remover o sobrenadante completamente.
      4. Adicionar 1 mL de etanol 75% e vortex.
      5. Centrifuga-se a 12000 xg durante 30 min a 4 ° C.
      6. Remover o sobrenadante.
      7. Permitir que o etanol remanescente secar ao ar durante 3-5 min.
        NOTA: É importante não deixar o sedimento RNA secar completamente, pois isso irá diminuir consideravelmente a sua solubilidade.
      8. Re-dissolver o sedimento em 0,3 ml de dietilpirocarbonato (DEPC) de água tenha sido tratada com. transcrever imediatamente as amostras de RNA em cDNA (mais estáveis, consulte o passo 10.5) ou armazenar a -80 ° C.
    4. RNA Quantificação
      1. Dilui-se 1 uL de ARN com 99 uL de água tratada com DEPC.
      2. Leia the OD a 260 nm e 280 nm usando um UV / VIS para determinar a concentração e pureza da amostra.
    5. Síntese de ADNc
      1. Misturar as amostras de ARN (1-5 ug) com 1 ul de Oligo (dT) 12-18 (0,5 mg / mL) e água tratada com DEPC (volume total de 12 uL) em RNase tubos estéreis.
      2. Incubar a 70 ° C durante 10 min.
      3. Adicionar 2 mL de tampão de PCR 10x, 1 L de 50 mM MgCl 2, 1 mL de 10 mM de dNTP mix, e 2 mL de 0,1 M ditiotreitol (DTT).
      4. Incubar a 4 ° C durante 5 min.
      5. Adicionar 1 ml de transcriptase reversa e incubar a 42 ° C durante 5 min.
      6. Incubar a 70 ° C durante 15 min.
      7. Incubar a 4 ° C durante 15 min. ADNc pode ser armazenado a -20 ° C até à sua utilização.
    6. PCR
      1. Misture 2,5 ul de tampão 10X PCR, 1,5 mL de 25 mM de MgCl 2, 0,5? L de dNTP 10 mM de mistura, de 0,25 μL de polimerase de ADN de Taq, 0,25 L de cada iniciador (10 uM) e o ADNc (100 ng), e água estéril para um volume total de 25 uL.
      2. Executar as amostras num aparelho de ciclos térmicos de 96 poços. Para evitar a amplificação de DNA genômico, frente e verso, primers devem estar localizados em diferentes exons: IL1β-FW: GCAACTGTTCCTGAACTCAACT e IL1β-RE: TCTTTTGGGGTCCGTCAACT; IL6-FW: CCTTCCTACCCCAATTTCCAA e IL6-RE: AGATGAATTGGATGGTCTTGGTC; KC-FW: TGTCAGTGCCTGCAGACCAT e KC-RE: CCTGAGGGCAACACCTTCA; e actina-FW: TATCCACCTTCCAGCAGATGT e actina-RE: AGCTCAGTAACAGTCCGCCTA. Use as seguintes condies de PCR: 95 ° C durante 5 min, seguido de 30 ciclos a 95 ° C durante 15 s, 58 ° C durante 30 s, e 72 ° C durante 30 s, mais uma extensão final de 10 min a 72 ° C .

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Dieta Suplementos pode proteger do DSS Colite

suplementos de dieta anti-inflamatórias e anti-oxidantes, tais como a vitamina C, a vitamina E, o óxido nítrico (NO) -fonte L-arginina, e os ácidos gordos poli-insaturados de w3-(de w3-PUFA), têm sido utilizados com sucesso variável em animais modelos para aliviar os sinais de doenças inflamatórias 3,6,15. A má nutrição, o stress oxidativo, e a produção de citocinas pró-inflamatórias pode provocar tanto a colite aguda e crónica 3. Em um estudo anterior, provámos que uma combinação de micronutrientes mostraram efeitos protetores contra a colite induzida por DSS in vivo. Aqui, nós fornecemos protocolos detalhados sobre como esses efeitos foram medidos 8. Em primeiro lugar, analisamos os efeitos de suplementos nutricionais sobre a progressão da doença através da determinação do índice de atividade da doença (DAI), constituído pelos três parâmetros de perda de peso,consistência das fezes e sangramento perianal. Os resultados representativos mostraram que o tratamento com DSS levou a uma DAI continuamente crescente, como esperado, atingindo um máximo de 8,2 ± 0,46 no dia sete (Figura 1A). suplementação anti-inflamatório dieta atrasou o início da colite, mas em momentos posteriores, quando a colite era muito forte, o efeito protetor foi marginal e já não estatisticamente significativa, o que sugere que os suplementos de dieta só são eficazes quando a colite ainda não é muito forte. Importante, a intervenção dietética pode impedir que o aumento induzido por DSS na permeabilidade epitelial intestinal, o que é uma característica importante da colite (Figura 1B). Colite DSS levou a comprimentos de cólon reduzidas, e esta redução foi também melhorada pelo suplemento anti-inflamatória e anti-oxidativa dieta (Figura 1C). Assim, os sintomas clínicos da colite pode, efectivamente, ser aliviadas por alterações na composição da dieta.

Para analisar por colite progressão foi menos grave em animais que receberam um suplemento de dieta, morfologia do tecido foi investigada após hematoxilina / eosina (H / E) coloração dos tecidos do cólon distal embebidos em parafina. As amostras de controlo mostraram uma morfologia normal (Figura 2A, painel superior), enquanto que os animais tratados com 3,5% de DSS mostrou sinais típicos de colite (isto é, a infiltração de leucócitos, formação de edemas, displasia cripta, e ulcerações; Figura 2A, painel do meio). De nota, o tratamento paralelo com a suplementação da dieta alterações morfológicas com colite induzida claramente aliviados, com uma morfologia geral de que era mais comparável ao grupo controle (Figura 2A, painel inferior). Estas observações foram muito semelhante ao que tem sidorelatados para co-tratamentos com bactérias probióticas 13 e mostram claramente que as mudanças na dieta pode neutralizar o desenvolvimento de colite.

Nós já sabíamos que a permeabilidade do epitélio intestinal induzida por colite poderia ser neutralizada pela suplementação de dieta. O aumento da permeabilidade é uma característica marcante de DII, e é em grande parte causadas por a desmontagem das junções aderentes de estabilização (AJ) e junções apertadas (TJ). A desestabilização de contactos de células epiteliais pela internalização das proteínas de junção é induzida por citocinas pró-inflamatórias, que são produzidos em abundância durante 16 colite. Descobrimos, através da coloração de imunofluorescência de tecido do cólon distai, que as TJ molécula zonula occludens-1 (ZO-1) e a molécula AJ E-caderina foram internalizado durante a colite induzida por DSS e que a co-localização destas proteínas foi parcialmente perdida em contactos de células epiteliais das criptas (Figura 2B). Eumportantly, a internalização de E-caderina e ZO-1 foi reduzida quando os ratos tratados com DSS foram co-tratados com um suplemento de anti-inflamatório e anti-oxidativa dieta (Figura 2B). Em geral, estruturas de cripta e de junção eram mais comparáveis ​​com os controlos, quando o suplemento de dieta foi aplicado, o que sugere que o efeito protector observado foi de, pelo menos, em parte devido à preservação da arquitectura dos tecidos.

A intervenção dietética pode neutralizar inflamatória de neutrófilos Recrutamento, estresse oxidativo e da produção de citocinas pró-inflamatórias

Outra marca registrada do IBD é a infiltração de neutrófilos descontrolada. Neutrófilos recrutados contribuir para danos nos tecidos, produzindo e liberando espécies reactivas de oxigénio (ROS) e proteases 17. Utilizando um ensaio de actividade de MPO, encontramos o recrutamento de neutrófilos forte no cólon, em resposta à DSS, que foi neutralizadapela suplementação da dieta (Figura 3A).

O estresse oxidativo é outra característica importante da colite, causada pela liberação de ROS a partir de neutrófilos recrutados. Assim, analisamos a produção de ROS no cólon secções transversais. A Figura 3B demonstra que o tratamento aumentou fortemente DSS estresse oxidativo. De nota, alterações na dieta impediu completamente o stress oxidativo induzido por DSS (Figura 3B), que é provavelmente uma consequência do recrutamento de neutrófilos reduzida (Figura 3A).

As citocinas pró-inflamatórias e quimiocinas são fortemente produzido por vários tipos de células durante 18 a colite. Tais mediadores inflamatórios contribuir para recrutamento e proteína de junção de internalização-características de neutrófilos que já sabia que poderia ser atenuado por mudanças na dieta. Análise da expressão de ARNm por RT-PCR revelou que DSSaumentou a expressão de IL1β, IL-6, e quimioquina derivada de queratinócitos (KC), tal como esperado (Figura 3C), e que a suplementação de anti-inflamatório dieta diminuiu este aumento induzido por DSS (Figura 3C). Estes dados implicam que os suplementos de dieta pode realmente servir para neutralizar sinais clínicos de IBD.

figura 1
Figura 1. suplementos nutricionais podem aliviar Índice de Atividade de Doença, Intestinal epitelial permeabilidade, e encurtamento Colon. (A) O índice de actividade da doença (DAI, valores de 0 - 12) é constituído pelas três parâmetros de perda de peso, a consistência das fezes, e sangramento peri-anal e foi registado diariamente nos grupos experimentais de controlo (Ctrl), colite e colite + suplemento nutricional (colite + Supl.). O grupo controle não mostrou quaisquer sinais de colite, resultando em um DAI de 0 throughout o período experimental. N = 5 por grupo. (B) a permeabilidade intestinal epitelial foi medida por vazamento de azul de Evans nos grupos experimentais acima mencionados e foi expressa como a absorção a 620 nm por g de tecido. n = 8 por grupo. Todos os dados são apresentados como a média ± o desvio padrão da média (SDM). * P <0,05; ** P <0,01; *** P <0,001. Estatísticas foram calculadas pela one-way ANOVA. (C) Imagens representativas de dois pontos inteiros dos respectivos grupos experimentais após 7 dias de tratamento. A escala do lado esquerdo está em cm. Por favor clique aqui para ver uma versão maior desta figura.

Figura 2
Figura 2. Tissue Morfologia e junção Arquitetura ficarão mais bem preservadas durante a colite quando Aplicando Nutricional Supplements. (A) 5-iM parafina secção transversal de biópsias de tecidos a partir dos dois pontos distais dos respectivos grupos experimentais foram coradas com hematoxilina / eosina e analisadas para sinais típicos de colite, tais como a formação de edema (setas), leucócitos de infiltração (pontas de seta), e ulceração (*). morfologia do tecido geral do colite + Suppl. grupo mais se assemelha ao do controle do que o grupo colite, provando um efeito protector global contra DSS colite. As imagens são representativos de 3 preparações de tecido independentes por grupo. As imagens foram tiradas com uma objectiva 10X. Barra = 100 um. (B) 8 mm de cólon crio-secções dos respectivos grupos foram coradas com anticorpos contra ZO-1 (verde) e E-caderina (vermelho). Co-localização (amarelo nas imagens fundidas; setas) de E-caderina e ZO-1 a contactos de células epiteliais das criptas, que é perdida durante a colite, é na maior parte preservada na colite + Suppl. grupo. Imagens são representativos de trêspreparações de tecido independentes. Barra = 50 uM. Por favor clique aqui para ver uma versão maior desta figura.

Figura 3
Figura 3. neutrófilos Recrutamento, estresse oxidativo e da produção de citocinas pró-inflamatórias pode ser reduzido em suplementos nutricionais. Actividade (A), mieloperoxidase (MPO) foi medida ao analisar a quantidade de recrutamento de leucócitos para os tecidos do cólon nos grupos experimentais: controlo (ctrl), colite, colite e + suplemento nutricional (colite + Supl.). N = 5 por grupo; * P <0,05. Os dados são apresentados como a média ± o SDM. Estatísticas foram calculadas pela one-way ANOVA. (B) A fluorescência de etídio oxidado, representado em vermelho como a medida do stress oxidativo em 8 mícrons crio-secções de COtecidos lon, foi gravado por microscopia confocal laser. As imagens são representativos de 3 preparações de tecido independentes. Barra = 100 um. (C) A produção de citocinas pró-inflamatórias IL1β e IL-6 e a quimiocina KC foi determinada por semi-quantitativa por RT-PCR num gel de agarose a 1,5% (preto e branco foram revertidos por uma questão de clareza). β-actina serviu como o gene de manutenção. Imagens representativas de três preparações independentes de ADNc são mostradas. Por favor clique aqui para ver uma versão maior desta figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

A fim de usar suplementos nutricionais em estudos clínicos, os benefícios ea segurança de tais suplementos devem ser cuidadosamente avaliados in vivo em estudos com animais. No caso da colite, vários modelos animais apropriados que se assemelham aos sinais clínicos de DII foram estabelecidas, incluindo modelos químicos utilizando DSS, TNBS, ou ácido acético; modelos (KO), tais como IL10-KO fora knock-; e colite-célula imunitária mediada usando transferência adoptiva de células T 19-21. O modelo de colite DSS é um método rápido e fiável de induzir a colite que se assemelha a muitos sintomas de doença da DII humana e tem sido utilizada em um grande número de estudos que investigam os mecanismos moleculares da colite 22. Além disso, a colite DSS é reversível e, assim, também permite o estudo de cicatrização do tecido após o estímulo colitogenic foi removido. O protocolo fornecido descreve em pormenor o modelo de colite DSS que tenha sido previamente optimizado no nosso laboratório 8.

23. Além disso, DSS deve estar numa gama de pesos moleculares de 40-50 kDa para induzir a colite. Para o pesquisador inexperiente, será importante desenvolver um olho para uma avaliação imparcial dos parâmetros DAI de consistência das fezes e sangramento perianal. Se a avaliação é realizada por um pesquisador inexperiente, é recomendável ter um colega confirmar a avaliação, de preferência de forma cega.

Para analisar a permeabilidade epitelial intestinal para macromoléculas, três métodos principais foram utilizados em toda a literatura: o ensaio de azul de Evans do corante, tal como descrito aqui; a instilação de 4 kDa FITC-dextrano numa ansa do intestino; e a alimentação de 13,24,25-4 kDa FITC-dextrano. No último ensaio, FITC-dextrano é alimentado por sonda esofágicaE a quantidade de FITC dextrano que atravessava o epitélio e vazou para a corrente sanguínea é medida fluorimetricamente de amostras de soro. Neste ensaio, a permeabilidade de todo o tracto gastrointestinal é medida, uma vez que o marcador passa por todo o caminho desde o esófago até ao recto, e a maior parte do marcador irá passar antes de atingir o cólon. No modelo de ansa, a permeabilidade é medido numa região confinada intestinal usado para o circuito (normalmente o intestino delgado) 25. Em contraste, o ensaio de azul de Evans tem a vantagem de que somente a permeabilidade epitelial no cólon é medida, uma vez que o marcador está directamente instilada em todo o cólon. Assim, utilizando este ensaio, pode-se concluir que o epitélio do cólon é protegido pelo suplemento de dieta.

É sempre importante para registrar o peso do cólon e duração após a extração e antes de utilizar os tecidos para outros ensaios, porque alguns dados (por exemplo, vazou Evans azul no assa permeabilidadey) são expressos por g de tecido. Além disso, a proporção de peso-para-comprimento é uma leitura de saída independente de danos nos tecidos 26. Em geral, morfologia do tecido é analisada utilizando tecidos embebidos em parafina corados com hematoxilina e eosina, conforme descrito aqui. Parafina tem a vantagem de que a morfologia do tecido é muito melhor conservada em comparação com outros métodos de incorporação. Isto permite a identificação inequívoca dos diferentes tipos de células dentro da mucosa (isto é, células do sistema imunológico, epitélio e das células caliciformes, etc.) e a análise de alterações de tecidos durante a colite, tais como a formação de edemas, infiltração de leucócitos, e erosões epiteliais apicais. Por outro lado, a parafina tem a desvantagem de que a coloração imunofluorescente só pode ser realizada após a recuperação de epítopo demorado. Por isso, sempre se preparar diferentes biópsias de tecidos congelados embutidos em composto outubro Essas amostras de tecido podem ser facilmente segmentado utilizando um criostato e apresentam baixos níveis de autofluorescence. Nós usamos etanol para fixação por desidratação, porque nem interfere com filamentos de actina (como o metanol faz), nem desencadear autofluorescência (como PFA faz). Utilizando estas técnicas, verificou-se que um suplemento anti-inflamatória e anti-oxidativa dieta pode melhorar a morfologia do tecido e arquitectura de junção durante a colite (comparar com a figura 2).

O recrutamento de neutrófilos excessiva é um evento crítico durante a colite induzida por que é a produção de quimioatractores na resposta a inflamação 17. o recrutamento de neutrófilos é um evento fisiológico porque os neutrófilos contribuem para a remoção do taco inflamatória e para a cicatrização de feridas subsequente. No entanto, se esta resposta imune inata não é adequadamente controlada e terminadas, neutrófilos na mucosa pode contribuir para a lesão do tecido através da libertação de proteases e espécies reactivas de oxigénio. Os neutrófilos contêm MPO, que pode ser facilmente medido e quantificado usando umensaio colorimétrico, onde a quantidade de MPO é directamente proporcional ao número de neutrófilos. A Figura 3A mostra que os aumentos de recrutamento de neutrófilos durante a colite e que a intervenção nutricional pode evitar esta resposta imunitária excessiva e descontrolada. De acordo com a presença de neutrófilos abundante na mucosa, o stress oxidativo aumenta durante a colite (Figura 3B).

Nossa suplementação dietética protege claramente a mucosa do estresse oxidativo, que é mais provável uma consequência do recrutamento de neutrófilos reduzida. Como mencionado, os neutrófilos são atraídos por quimiocinas e a produção de quimiocinas é induzida por citocinas pró-inflamatórias que são secretadas por vários tipos de células durante a colite. Assim, assumimos que reduzida recrutamento de neutrófilos é uma consequência da redução de citocinas e produção de quimiocinas. A Figura 3C demonstra que as citoquinas pró-inflamatórias de IL-1β e IL-6, bem como oquimiocina KC, são regulados positivamente durante a colite induzida por DSS. O suplemento de dieta reverteu os níveis de IL-6 de volta para controlar os níveis melhorados e o aumento da produção de IL-1β e KC. De nota, KC é o quimioatrativo mais importante para os neutrófilos em camundongos.

Deste modo, é tentador especular que a preservação da morfologia do tecido observado é devido à redução da infiltração de neutrófilos, o qual é, por sua vez, uma consequência da diminuição da produção de KC. Analisando a produção de ARN em tecidos tratados com DSS por RT-PCR é problemático quando DSS residual está presente no RNA isolado. Isto é porque DSS inibe ambas as transcriptases reversas e polimerases Taq. Se nenhuma amplificação pode ser conseguida, será necessário purificar ainda mais as amostras de RNA por precipitação com LiCl-mediada, como descrito noutro local 27.

Em resumo, descrever em detalhe métodos diferentes para a análise do dano tecidual durante DSS colite e como isso dAmage pode ser melhorada por suplementos dietéticos. O conhecimento obtido a partir de tais experiências com animais pode justificar o estabelecimento de coortes de pacientes para investigar os efeitos protetores dos suplementos analisados ​​em IBD humana. Os dados obtidos a partir de estudos clínicos pode, então, abrir novos caminhos para desenvolver estratégias de tratamento alternativo para a gestão do IBD.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores não têm nada para revelar.

Acknowledgments

Este trabalho foi financiado por doações do Conselho Mexicano para a Ciência e Tecnologia (Conacyt, 207268 e 233395 para Michael Schnoor). KFCO é um beneficiário de uma bolsa Conacyt (396.260) para obter um mestrado.

Materials

Name Company Catalog Number Comments
0.3% of gelatin  Bioxon 158
10% formaldehyde J.T. Baker 2106-03
96-well plate with flat bottom Corning 3368
Absolute ethanol  J.T. Baker 9000-03
Absolute xylene J.T. Baker 9490-03
ABTS Sigma Aldrich H5882
Bovine Serum Albumin Sigma-Aldrich 9048-46-8
ColoScreen Helena Laboratories 5072
Corabion (Kindly provided by Merck, Naucalpan, Mexico) Merck
Dextran Sulfate Sodium Salt Affymetrix 9011-18-1 (M.W. 40,000-50,000)
Dihydroethidium Life Technology D11347
Eosin-Y  J.T. Baker L087-03
Evans blue Sigma-Aldrich 314-13-6
Feeding  needle Cadence Science Inc. 9921
Glass slide rack with handle Electron Microscopy 70312-16
Glass Slides Corning 2947
Harris hematoxylin  Sigma-Aldrich H3136
Hexadecyltrimethyammonium (HTAB) Sigma Aldrich H6269
Histosette (Embedding cassette) Simport M498.2
Hydrochloric acid 1 M J.T. Baker 9535-62
Hydrogen peroxide Sigma Aldrich H3410
Ketamine PiSA Agropecuaria Q-7833-028
Liquid paraffin  Paraplast 39501-006
Lithium carbonate  Sigma-Aldrich 2362
N,N-dimethylformamide J.T. Baker 68-12-2
N-acetylcysteine Sigma-Aldrich A9165
Plastic cubes Electron Microscopy 70181
Poly-L-Lysine Solution Sigma-Aldrich 25988-63-0
Prism 5 statistical software GraphPad Software Prism 5
Saline Solution 0.9% NaCl CS PiSA Q-7833-009
Sodium citrate Sigma-Aldrich W302600
Synthetic resin  Poly Mont 7987
Taq DNA polymerase Invitrogen 11615-010
Tissue-tek. O.C.T Compound Sakura Finetek 4583
Tuberculine Syringe BD Plastipak 305945
Tween 20 Sigma-Aldrich 9005-64-5
VECTASHIELD Antifade Mounting Medium with DAPI Vector Laboratories H-1200
Xylazine PiSA Agropecuaria Q-7833-099

DOWNLOAD MATERIALS LIST

References

  1. Souza, H. S., Fiocchi, C. Immunopathogenesis of IBD: current state of the art. Nat Rev Gastroenterol Hepatol. 13, 13-27 (2016).
  2. Xavier, R. J., Podolsky, D. K. Unravelling the pathogenesis of inflammatory bowel disease. Nature. 448, 427-434 (2007).
  3. Neuman, M. G., Nanau, R. M. Inflammatory bowel disease: role of diet, microbiota, life style. Transl Res. 160, 29-44 (2011).
  4. Lowenberg, M., D'Haens, G. Next-Generation Therapeutics for IBD. Current Gastroenterol Rep. 17, 21 (2015).
  5. Bernstein, C. N. Does everyone with inflammatory bowel disease need to be treated with combination therapy. Curr Opin Gastroenterol. (2016).
  6. Nanau, R. M., Neuman, M. G. Nutritional and probiotic supplementation in colitis models. Dig Dis Sci. 57, 2786-2810 (2012).
  7. Yamamoto, T. Nutrition and diet in inflammatory bowel disease. Curr Opin Gastroenterol. 29, 216-221 (2013).
  8. Vargas Robles, H., et al. Experimental Colitis Is Attenuated by Cardioprotective Diet Supplementation That Reduces Oxidative Stress, Inflammation, and Mucosal Damage. Ox Med Cell Longev. 8473242 (2016).
  9. Vargas-Robles, H., Rios, A., Arellano-Mendoza, M., Escalante, B. A., Schnoor, M. Antioxidative diet supplementation reverses high-fat diet-induced increases of cardiovascular risk factors in mice. Ox Med Cell Longev. 2015, 467471 (2015).
  10. Perse, M., Cerar, A. Dextran sodium sulphate colitis mouse model: traps and tricks. J Biomed Biotechnol. 2012, 718617 (2012).
  11. Chassaing, B., Aitken, J. D., Malleshappa, M., Vijay-Kumar, M. Dextran sulfate sodium (DSS)-induced colitis in mice. Curr. Protoc. Immunol. 104, Unit 15 25 (2014).
  12. Laroui, H., et al. Dextran sodium sulfate (DSS) induces colitis in mice by forming nano-lipocomplexes with medium-chain-length fatty acids in the colon. PLoS One. 7, 32084 (2009).
  13. Mennigen, R., et al. Probiotic mixture VSL#3 protects the epithelial barrier by maintaining tight junction protein expression and preventing apoptosis in a murine model of colitis. Am J Physiol Gastrointest Liver Physiol. 296, 1140-1149 (2009).
  14. Park, C. M., Reid, P. E., Walker, D. C., MacPherson, B. R. A simple, practical 'swiss roll' method of preparing tissues for paraffin or methacrylate embedding. J Microsc. 145, 115-120 (1987).
  15. Shen, W., Gaskins, H. R., McIntosh, M. K. Influence of dietary fat on intestinal microbes, inflammation, barrier function and metabolic outcomes. J Nutr Biochem. (2013).
  16. Bruewer, M., et al. Interferon-gamma induces internalization of epithelial tight junction proteins via a macropinocytosis-like process. FASEB J. 19, 923-933 (2005).
  17. Fournier, B. M., Parkos, C. A. The role of neutrophils during intestinal inflammation. Muc Immunol. 5, 354-366 (2012).
  18. Yan, Y., et al. Temporal and spatial analysis of clinical and molecular parameters in dextran sodium sulfate induced colitis. PLoS One. 4, 6073 (2009).
  19. Maxwell, J. R., Viney, J. L. Overview of mouse models of inflammatory bowel disease and their use in drug discovery. Curr Prot Pharmacol, S.J. Enna. Chapter 5, Unit 5.57 (2009).
  20. Ostanin, D. V., et al. T cell transfer model of chronic colitis: concepts, considerations, and tricks of the trade. Am J Physiol Gastrointest Liver Physiol. 296, 135-146 (2009).
  21. Randhawa, P. K., Singh, K., Singh, N., Jaggi, A. S. A review on chemical-induced inflammatory bowel disease models in rodents. Kor J Physiol Pharmacol. 18, 279-288 (2014).
  22. Whittem, C. G., Williams, A. D., Williams, C. S. Murine Colitis modeling using Dextran Sulfate Sodium (DSS). JoVE. (2010).
  23. Wirtz, S., Neufert, C., Weigmann, B., Neurath, M. F. Chemically induced mouse models of intestinal inflammation. Nat Prot. 2, 541-546 (2007).
  24. Naydenov, N. G., et al. Nonmuscle Myosin IIA Regulates Intestinal Epithelial Barrier in vivo and Plays a Protective Role During Experimental Colitis. Sci Rep. 6, 24161 (2016).
  25. Sumagin, R., Robin, A. Z., Nusrat, A., Parkos, C. A. Transmigrated neutrophils in the intestinal lumen engage ICAM-1 to regulate the epithelial barrier and neutrophil recruitment. Muc Immunol. 7, 905-915 (2014).
  26. Laukoetter, M. G., et al. JAM-A regulates permeability and inflammation in the intestine in vivo. J Exp Med. 204, 3067-3076 (2007).
  27. Viennois, E., Chen, F., Laroui, H., Baker, M. T., Merlin, D. Dextran sodium sulfate inhibits the activities of both polymerase and reverse transcriptase: lithium chloride purification, a rapid and efficient technique to purify RNA. BMC Res Notes. 6, 360 (2013).
Analisando Efeitos benéficos de suplementos nutricionais sobre as funções intestinais epitelial de barreira Durante Experimental Colite
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Vargas Robles, H., Castro Ochoa, K. F., Nava, P., Silva Olivares, A., Shibayama, M., Schnoor, M. Analyzing Beneficial Effects of Nutritional Supplements on Intestinal Epithelial Barrier Functions During Experimental Colitis. J. Vis. Exp. (119), e55095, doi:10.3791/55095 (2017).More

Vargas Robles, H., Castro Ochoa, K. F., Nava, P., Silva Olivares, A., Shibayama, M., Schnoor, M. Analyzing Beneficial Effects of Nutritional Supplements on Intestinal Epithelial Barrier Functions During Experimental Colitis. J. Vis. Exp. (119), e55095, doi:10.3791/55095 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter