Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Medicine

Анализируя Благотворное влияние пищевых добавок на Кишечный Эпителиальное барьерные функции Во время экспериментального колита

doi: 10.3791/55095 Published: January 5, 2017

Summary

Современные способы лечения воспалительных заболеваний кишечника (IBD) направлены на облегчение симптомов болезни, но может вызвать серьезные побочные эффекты. Таким образом, альтернативные стратегии исследуются в животных моделях колита. Здесь мы объясним, как благотворное влияние пищевых добавок на клинические признаки IBD анализируются в такой модели колита.

Abstract

Воспалительные заболевания кишечника (IBD), включая болезнь Крона и неспецифический язвенный колит, хронические расстройства, рецидивирующий кишечника. Они вызывают серьезные проблемы, такие как спастические боли в животе, кровавый понос и потеря веса, в пострадавших лиц. К сожалению, нет никакого лечения до сих пор, и методы лечения направлены только для облегчения симптомов. Современные методы лечения включают противовоспалительные и иммуносупрессивные препараты, которые могут вызвать серьезные побочные эффекты. Это гарантирует, поиск альтернативных вариантов лечения, таких как пищевые добавки, которые не вызывают побочных эффектов. Перед их применением в клинических исследованиях, такие соединения должны быть тщательно протестированы на предмет эффективности и безопасности в животных моделях. Надежная экспериментальная модель является декстран сульфата натрия (DSS), модель колита у мышей, которая воспроизводит многие клинические признаки язвенного колита у людей. Недавно мы применили эту модель для того чтобы испытать благотворное влияние пищевой добавки, содержащейвитамины С и Е, L-аргинин, и & omega; 3-полиненасыщенные жирные кислоты (ПНЖК). Мы проанализировали различные параметры заболевания и обнаружили, что эта добавка была способна улучшить образование отек, повреждение тканей, лейкоцитарную инфильтрацию, окислительный стресс, а также выработку провоспалительных цитокинов, что приводит к общему улучшению индекса активности заболевания. В этой статье мы подробно объяснить правильное применение пищевых добавок с использованием модели колита DSS в мышей C57BL / 6, а также параметры, как заболевания, такие как гистологии, окислительный стресс и воспаление оцениваются. Анализируя благотворное влияние различных пищевых добавок может затем в конце концов открыть новые возможности для развития альтернативных стратегий лечения, которые облегчают симптомы IBD и / или которые продлевают фазы ремиссии, не вызывая серьезных побочных эффектов.

Introduction

Колит это воспаление толстой кишки, что может вызвать понос и боли в животе. Колит может быть острым, в ответ на инфекцию или стресс, или он может развиваться как хроническое заболевание, например, при язвенном колите (UC), который принадлежит к группе воспалительных заболеваний кишечника (IBD). Хотя клинические признаки UC были хорошо описаны, патогенез до сих пор плохо изучены 1. Принято считать , что среди экспертов UC является многофакторным заболеванием, с генетическими мутациями и аберрантных иммунных реакций , играющих важную роль 2. Тем не менее, факторы окружающей среды, такие как стиль жизни и питания, а также способствуют развитию заболевания и прогрессирования 3.

К сожалению, IBD не излечим, но есть много вариантов лечения, которые направлены для облегчения клинических симптомов. Современные методы лечения включают в себя противовоспалительные препараты, такие как сульфасалазин и кортикостероиды; иммунодепрессанты, такие как azathioПрайн; моноклональные антитела, которые захватывают провоспалительных цитокинов, таких как фактор некроза опухоли-альфа (TNF-alpha), или блок молекул адгезии, такие как интегрины, в целях уменьшения чрезмерного набора лейкоцитов; и ингибиторы киназ , которые нацелены на которые вызывают провоспалительных пути, такие как Янус - киназы (JAK) 4. Не все пациенты реагируют на все виды лечения, поэтому терапевтические стратегии должны быть индивидуализированы 5. Кроме того, большинство из этих терапевтических препаратов препятствовать метаболизму и иммунных реакций, часто вызывает серьезные побочные эффекты. По этой причине, альтернативные варианты лечения были исследованы.

Альтернативные методы лечения включают пробиотики и пищевые добавки, которые были применены в моделях на животных и клинических испытаний с разной степенью успеха 6,7. Недавно мы обнаружили, что применение различных единичных пищевых добавок, таких как анти-окислительные витамины или ω3-полиненасыщенных жирных кислот (РUFAS), уступает применению комбинации таких добавок в облегчении симптомов колита и сердечно - сосудистых заболеваний 8,9. Эти исследования проводились на мышах, поэтому клинические исследования должны быть выполнены на людях, чтобы определить, будут ли эти данные также быть применимы к людям. Перед тем как клинические исследования инициируются, эффективность и безопасность новых методов лечения должна быть оценена на животных моделях.

Для IBD, модель (DSS) декстран сульфат натрия широко используется для изучения механизмов развития заболевания и благотворное воздействие лекарственных средств и пищевых добавок 6,10. В большинстве исследований, только острое заболевание в течение периода времени в семь дней индуцируется; Тем не менее, клинические признаки , наблюдаемые у этих животных очень похожи на те , наблюдается у пациентов с воспалительной болезнью кишечника (например, кровавый понос, потеря веса, эпителиальная дисфункция, и клеточная инфильтрация иммунитет) 10. ДСС вызывает эрозий в слизистой оболочке,что приводит к барьерной дисфункции и повышенной кишечной проницаемости эпителия 11. Точный механизм остается неизвестным. Тем не менее, исследование показало, что DSS взаимодействует с средней цепью длиной жирных кислот с образованием нано-lipocomplexes , которые способны проникать в эпителиальные клетки и вызывать воспалительные сигнальных путей 12. В этой статье мы подробно описывают, как колиты индуцируется и проанализированы на мышах, как пищевые добавки, применяемые затравки, чтобы обеспечить постоянную дозировку в каждом животном, и как исследуют воздействие таких добавок на различные симптомы колита.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Все эксперименты на животных были одобрены Institutional Animal Care и использования Комитетом по CINVESTAV.

1. Получение DSS питьевой воды и индукции колита

  1. Готовят раствор 3,5% вес / об сульфата натрия декстрана (DSS) в автоклавного питьевой воде. ДСС легко растворяется и не требуется для фильтрации конечного раствора.
    Примечание: 7 дней лечения DSS вызывает сильную колита. Если вызывать легкое колита, 3 - рекомендуется 4 дней лечения. До тех пор пока питьевой воды DSS остается ясно, что нет необходимости менять воду. Тем не менее, если окажется мутным, его необходимо заменить.
  2. Запишите базовый вес самцов мышей. Убедитесь, что они являются 8 - 12 недель от возраста и в диапазоне от 21 - 25 г веса тела.
    Примечание: в соответствующей концентрации DSS должна быть оптимизирована в каждой лаборатории. Результаты могут сильно варьироваться в зависимости от жилищных условий. Концентрации от 2,5 - 5%, как правило, сообщается, вызывают сильную Colitis в C57BL / 6J WT мышей 10. DSS от разных компаний и разных партий должны быть проверены, а результаты могут также меняться в зависимости от различных источников DSS.
  3. Обеспечить вволю воды и заменить его свежим 3,5% DSS воды в случае необходимости.

2. Применение пищевых добавок с помощью желудочного зонда

  1. Подготовить "feedable" раствор желаемого пищевых добавок в подходящем растворителе. Для этого исследования мы использовали смесь, содержащую 200 мг / кг L-аргинина, 83 мг / кг витамина С, 46 мг / кг витамина Е, 77 мг / кг эйкозапентаеновой (ЭПК) и 115 мг / кг докозагексаеновой кислоты (DHA ) в 1: 1 растворе воды и сафлоровое масло.
  2. Заполните 1 мл шприц, соединенный с зондового иглы (15 G х 50 мм) с пищевой добавки смеси. Протрите наружную поверхность зондового иглы, чтобы удалить любое соединение снаружи иглы и обеспечить надлежащее применение дозы.
  3. Сдерживайте мышь, взявшись за основание хвостас одной стороны, и Плотно зажав складку кожи на задней части шеи с большим и указательным пальцами другой руки. Поместите хвост между третьим пальцем и основанием большого пальца той же руки, которая удерживает шею.
  4. Поддерживая мышь в вертикальном положении, вставить иглу в левую сторону рта животного и внимательно следить за крышу рта, чтобы найти пищевод. Если сопротивление не встречается, продвигать иглу к животу.
    ПРИМЕЧАНИЕ: Убедитесь в том, что животное дышать правильно, прежде чем продолжить.
  5. Администрирование смесь медленно, снимите трубку, медленно потянув шприц и отпустите левую кнопку мыши. Применяют пищевые добавки один раз в день через желудочный зонд в течение эксперимента колита.

3. Определение болезней Индекс активности

Примечание: Индекс активности заболевания является сочетание баллов для потери веса, перианальной кровотечения и консистенции стула, которые О.Б.тойчивое ежедневно 13.

  1. Измеряют вес тела в день и назначить счет от 0 до 4 в соответствии с процентом потери веса (0: 0%, 1: 1 - 5%, 2: 5 - 10%, 3: 10 - 20%, и 4:> 20 %).
    Примечание: Bodyweight потерь определяется путем вычисления разности в процентах между базального веса до индукции DSS-колита и фактического веса.
  2. Для того, чтобы определить уровень перианальной кровотечения, собирать свежий образец стула и использовать предоставленные аппликаторы для нанесения тонкого мазка на слайде из гваяковой фекально тест-набора оккультная крови. Используйте свежий аппликатор для каждого образца.
    1. Закройте крышку на передней панели и открыть окно на задней стороне слайда. Применяют две капли раствора проявителя на задней в месте расположения образца.
    2. Считайте результаты через 30 с. Любой след синего цвета положительно на скрытую кровь. Присвоить балл от 0 до 4 (0: нет, 0,5 - 2,5: положительная гваяковой фекального теста на скрытую кровь (в зависимости от силы сигнала) и 3 - 4: Groсс кровотечение).
      Примечание: Если кровь в стуле видима, гваяковый фекально скрытую кровь не должна быть выполнена, и балл 3, 3,5 или 4 назначается, в зависимости от количества видимой крови.
  3. Определение консистенции стула, наблюдая свежий образец стула. Присвоить балл от 0 до 4 (0: нормальный / твердое вещество, 0,5 - 2,5: пастообразные стул, и 3 - 4: понос).

4. Определение эпителия кишечника Проницаемость виво Evans Blue Пробирной

  1. Обезболить животных путем введения им внутрибрюшинно смесью кетамин (100 мг / кг веса тела) и ксилазина (13 мг / кг веса тела), разведенного в физиологическом растворе (0,9% NaCl), и оценить глубину анестезии путем мониторинга пинча снятие рефлекс.
  2. Поместите наркозом животных в положении лежа на спине и выполнить лапаротомию подвергать кишечник.
  3. Найдите слепая кишка и сделайте небольшой надрез в проксимальном сегменте толстой кишки аscendens ( в идеале, непосредственно примыкающей к слепой кишке).
  4. Вставьте иглу подачи (G22) и закрепите его с помощью лигатуры с использованием общего шелковой нити. Тщательно промойте обильным PBS через трубку, чтобы промыть все фекалии из толстой кишки. Закапывание раствор голубого цвета Эванс (1,5% вес / об в PBS) в толстую кишку до тех пор, пока не достигнет заднего прохода.
  5. Выдержите синего Эванса в течение 15 мин. Промыть красителя путем промывки трубки с обильным PBS до перианальной вымывания не ясна.
  6. Эвтаназии животных путем смещени шейных позвонков.
  7. Акцизный толстую кишку и промойте его снова с обильным PBS. Полоскание один раз с помощью 1 мл 6 мМ N -acetylcysteine в PBS , чтобы устранить любой краситель , прилипая к ободочной слизи.
  8. Вырезать толстую кишку в продольном направлении и промойте его еще раз с PBS и 1 мл 6 мМ N -acetylcysteine.
  9. Регистрируют вес и длину. Для того, чтобы извлечь синий краситель Evans, поместите двоеточие в 2 мл N, N - диметилформамида в течение ночи при комнатной температуре при осторожном agitatioп. Измерьте концентрацию красителя спектрофотометрически при длине волны 610 нм.

5. Ткань Коллекция

  1. Обезболить животных путем введения им внутрибрюшинно смесью кетамин (100 мг / кг веса тела) и ксилазина (13 мг / кг веса тела), разведенного в физиологическом растворе (0,9% NaCl), и оценить глубину анестезии путем мониторинга пинча снятие рефлекс.
  2. Эвтаназии животных путем смещени шейных позвонков.
  3. Поместите животных в положении лежа на спине и выполнить лапаротомию, чтобы обнажить брюшную полость.
  4. С помощью ножниц, рассекают всю толстую кишку и записать его длину.
  5. Промойте толстую кишку тщательно несколько раз охлажденным PBS, чтобы удалить фекалии. Запишите вес ткани и подготовить для следующих экспериментов, как описано в пунктах 5.6 - 5.8.
  6. Для выделения РНК и миелопероксидазы (МРО) анализы, отрезать образец соответствующего размера ткани (100 мг, как правило, достаточно), поместите его внутри трубы, и SNAп-замораживанием в жидком азоте. Хранить ткани при температуре -80 ° С для последующего использования.
  7. Для иммунофлуоресцентного окрашивания и определения окислительного стресса (см ниже), вырезать небольшой образец толстой кишки (0,5 - 1 см) и погрузите его в небольших алюминиевых чашек, наполненных оптимальная температура резания (ОКТ) соединения. Поместите чашки на сухой лед, и пусть они медленно заморозить, чтобы избежать образования пузырьков. Образцы замороженной ткани можно хранить при температуре -80 ° С для последующего использования.
  8. Для рулетов 14, откройте толстую кишку в продольном направлении и осторожно удалить фекалии с помощью щипцов. Раскатать его, со слизистой оболочкой обращена внутрь, используя остроконечный пинцет или тонкий, круглый деревянной палкой. Аккуратно поместите его внутри вложения кассеты и перейдите к шагу 6.1.
    Примечание: ДСС вызывает повреждение в толстой кишке. Тем не менее, распределение убытков варьируется в зависимости от проксимального к дистальному толстой кишки, при этом большинство повреждений обычно наблюдаются в дистальном отделе толстой кишки и прямой кишки. Таким образом, мы рекомендуем проанализировать гистологию либо в дистальной седловинеили в швейцарских ролях всей толстой кишки.

6. Анализ Colon гистологии гематоксилином-эозином

  1. Подготовка ткани
    1. Для гистологического анализа, погрузить либо рулетов или небольшие кусочки ткани из определенных областей ободочной кишки контрольных и обработанных мышей в 5 мл 10% формальдегида в течение 48 ч при комнатной температуре (RT) для достижения надлежащего фиксации.
      Примечание: Все дальнейшие шаги, на этапе 6 осуществляют при комнатной температуре, если не указано иное.
    2. Промыть их проточной водой в течение 18 часов.
    3. Высушить их с 15 мл 70% -ного этанола в течение 1 ч, 96% в течение 1 ч и абсолютного этанола в течение 1 ч. Повторите каждый шаг со свежим спиртом, прежде чем перейти к следующей концентрации.
    4. Продолжить обезвоживание в смеси 7,5 мл абсолютного этанола и 7,5 мл абсолютного ксилола в течение 1 ч. Повторить один раз, прежде чем передать образцы в 15 мл абсолютного ксилола в течение 1 ч. Повторите этот шаг один раз со свежим ксилола.
    5. Вложение Colon образцов тканей в парафине
      1. Погружают образцы в 50 мл жидкого парафина в течение 17 часов. Повторите этот шаг один раз, но только 3 ч.
      2. Погрузите образцы в кубики (пластиковые, квадратные прессформы, размер: 22 х 22 х 22 мм) в 810 мл жидкого парафина.
      3. Дайте парафин с образцами тканей толстой кишки, чтобы затвердеть в течение 24 ч при комнатной температуре.
    6. Режущий Tissue поперечных сечений с использованием микротома
      1. Вырезать образцы ободочной кишки с помощью микротома, в соответствии с инструкциями производителя, при толщине 5 мкм.
      2. Сбор сокращений на водяной бане (1 л), содержащие 0,3% желатина. Это предотвращает складывание ткани поперечных сечений. Восстановление срезах тканей и смонтировать их на стеклах.
    7. Гематоксилином и эозином тканевых поперечных сечений
      1. Deparaffinize образцов в течение 18 ч при 60 ° С в термостате. Для этого используется стеклянная SLiDE стойку с ручкой.
      2. После депарафинизации, погружают слайды в 70 мл абсолютного ксилола в течение 5 мин. Повторите этот шаг один раз со свежим ксилола.
      3. Передача образцов в 70 мл абсолютного спирта в течение 1 мин. Повторите этот шаг один раз со свежим спиртом.
      4. Инкубируйте образцы ткани толстой кишки в 70 мл этанола, 96% в течение 1 мин. Повторите этот шаг один раз со свежим спиртом.
      5. Вымойте образцы в водопроводной воде в два раза в течение 2 секунд.
      6. Инкубируйте ткани в Harris гематоксилином в течение 7 минут.
      7. Вымойте образцы в водопроводной воде в два раза в течение 2 секунд.
      8. Инкубируйте образцы в кислых спирте (70 мл этанола, 70% и 700 мкл 1 М соляной кислоты) в течение 7 с.
      9. Вымойте образцы в водопроводной воде в два раза в течение 2 секунд.
      10. Инкубируйте образцы ткани в 70 мл карбоната лития (1 г карбоната лития в 100 мл дистиллированной воды) в течение 7 с.
      11. Вымойте образцы в водопроводной воде в два раза в течение 2 секунд.
      12. Инкубируйте образцы в 70 мл этанола, 80% В течение 1 мин.
      13. Передача образцов в 70 мл эозина Y в течение 15 сек.
      14. Выдержите их в 70 мл 96% этанола в течение 1 мин. Повторите этот шаг один раз со свежим спиртом.
      15. Инкубируйте образцы ткани в 70 мл абсолютного этанола (этиловый спирт абсолютный безводного) в течение 1 мин. Повторите этот шаг один раз со свежим спиртом.
      16. Инкубируйте образцы в 70 мл смеси 35 мл абсолютного спирта и 35 мл абсолютного ксилола в течение 1 мин.
      17. Передача образцов в 70 мл абсолютного ксилола в течение 1 мин. Повторите этот шаг, в течение 5 минут в 70 мл свежего абсолютного ксилола.
      18. Добавляют 80 мкл синтетической смолы для образцов ткани толстой кишки, покрывают их покровные, и дайте им высохнуть в течение 24 ч при комнатной температуре. Наконец, анализ образцов с использованием ярко-полевой микроскопии 8.

    7. Анализ Junction Состав иммунофлюоресценции

    1. Подготовка ткани, как описано на стадии 5.7, и вырезать 8 мкм толщиной поперечные сеченияс помощью криостата.
    2. Фикс и проницаемыми двоеточие сечения с 96% -ным этанолом при -20 ° С в течение 20 мин.
      Примечание: Все последующие инкубации следует проводить при комнатной температуре, если не указано иное, во влажной темной коробке, чтобы предотвратить высыхание и Флуорохром выцветанию.
    3. Воздушно-сухих образцов, а затем промыть их 3 раза в течение 5 минут каждая с 1x PBS
    4. Инкубируйте образцы с блокирующим раствором (PBS, содержащий 0,01% Tween и 2% бычьего сывороточного альбумина) в течение 2 ч.
    5. Удалить блокирующий раствор и промыть его с PBS-0,01% Твина в течение 10 мин.
    6. В это время, разбавленные первичные антитела к требуемой концентрации в PBS, 0,01% Tween.
    7. Удалите моющий раствор, нанесите раствор антитела из предыдущей стадии, и инкубировать в течение ночи при 4 ° С в увлажненной коробке.
    8. Удалите раствор антитела и промыть 3 раза PBS-0,01% Твина в течение 5 мин каждый и один раз деионизированной водой в течение 10 мин, при очень осторожном перемешивании.
    9. В то время как мойка, центрифуга плавиковогоochromeconjugated, видоспецифичная вторичные антитела при 14000 х г в течение 20 мин при 4 ° C.
    10. Разведите вторичные антитела без преципитатов, как указано поставщиком в PBS-0,01% Твина, применять их, и инкубируют в течение 1 ч при КТ.
    11. Повторите шаг 7.8 и удалить моющий раствор как можно более полно.
    12. Пипетка 4 мкл анти-выцветания агента по каждому образцу на слайде.
    13. Накройте образцы с покровным.
    14. Воздух сухой в течение 1 ч.
    15. Печать слайдов с лаком для ногтей. Слайды можно хранить при температуре от -20 ° C до дальнейшего анализа.
    16. Анализ на конфокальной лазерной микроскопии 8.

    8. Определение оксидативного стресса путем окисления этидия

    1. Через 7 дней ДСС колита, готовят ткани, как описано в шаге 5.7 и разрезают срезов ободочной кишки в криостат при толщине 5 мкм. Крепление сечения на стеклянные слайды обрабатывали лизина поли-L-раствора и инкубировать образцов остроумиеч 5 мкМ dihydroethidium (DHE) в воде при температуре 37 ° С в течение 30 мин в темноте.
    2. Вымойте образцы с PBS (рН 7,6) три раза в течение 15 мин каждый раз при осторожном перемешивании при комнатной температуре. Воздух сухой пробы, и добавить каплю монтажа среды для защиты флуоресценции. Обратите внимание на флуоресценцию окисленного этидия на лазерной сканирующей конфокальной микроскопии (40х увеличение, 568 нм).

    9. Анализ лейкоцита вербовке MPO Пробирной

    1. Через 7 дней ДСС колита, собирать ткани толстой кишки и гомогенизировать образцы (200 - 400 мг) с 1 мл гексадецилтриметиламмония (HTAB) буфера (0,5% HTAB в 50 мМ фосфатном буфере, рН 6,0) с использованием гомогенизатора на льду.
    2. Промыть кончик гомогенизатор дважды 1 мл буфера HTAB включить все ткани в лизате и разрушать ультразвуком его пять раз при амплитуде 40% в течение 10 с каждый. Замораживании-оттаивании в жидком азоте в три раза.
    3. Центрифуга при 14000 х г в течение 15 мин и собирают супернатант.Готовят 2,2'-Азино-бис (3-этилбензотиазолин-6-сульфоновой кислоты) (ABTS) путем смешивания ABTS, 5 мл раствора цитрата натрия (1 М в воде), 0,1 мл перекиси водорода, и 45 мл Bi -дистиллированная вода.
    4. Смешать 0,1 мл каждого супернатанта с 0,1 мл раствора ABTS в 96-луночных плоскодонных дном пластины. Через 10 мин измеряют оптическую плотность при 460 нм с использованием спектрофотометра.

    10. Оценка экспрессии провоспалительных цитокинов ПЦР

    1. Ткань Гомогенизация
      1. Однородный 50 до 100 мг образцов ткани толстой кишки в 1 мл кислотного гуанидин тиоцианат-фенол-хлороформ с использованием гомогенизатора мощности.
      2. Инкубируют при комнатной температуре в течение 15 мин.
    2. Разделение фаз
      1. Добавить 0,2 мл хлороформа и энергично встряхивают в течение 30 с.
      2. Инкубируют при температуре 4 ° С в течение 30 мин.
      3. Центрифуга при 12000 х г в течение 60 мин при температуре 4 ° С.
      4. Передача UPPER водной фазы в новую пробирку (~ 500 мкл).
    3. РНК осадков и Ресуспендирование
      1. Добавьте 0,5 мл изопропилового спирта и инкубировать образцов при температуре 4 ° С в течение 60 мин.
      2. Центрифуга при 12000 х г в течение 30 мин при температуре 4 ° С.
      3. Удалить супернатант полностью.
      4. Добавить 1 мл этанола и 75% вихря.
      5. Центрифуга при 12000 х г в течение 30 мин при температуре 4 ° С.
      6. Удалить супернатант.
      7. Разрешить оставшийся этанол высохнуть на воздухе в течение 3-5 мин.
        Примечание: Важно не допустить, чтобы осадок РНК полностью высохнуть, так как это позволит значительно уменьшить его растворимость.
      8. Повторно растворить осадок в 0,3 мл диэтилпирокарбонатом (DEPC) -обработанной воды. Сразу транскрибировать образцы РНК в кДНК (более стабильные, см шаг 10.5) или хранить при температуре -80 ° С.
    4. РНК Количественное
      1. Развести 1 мкл РНК с 99 мкл DEPC-обработанной воды.
      2. Читать йе оптическую плотность при 260 нм и 280 нм с использованием UV / VIS спектрофотометр для определения концентрации пробы и чистоты.
    5. Синтез кДНК
      1. Смешайте образцы РНК (1-5 мкг) с 1 мкл олиго (дТ) 12-18 (0,5 мкг / мкл) и ДЭФЦ обработанной воды (общий объем 12 мкл) в РНКазы стерильные пробирки.
      2. Инкубируют при 70 ° С в течение 10 мин.
      3. Добавить 2 мкл 10 - кратного ПЦР - буфера, 1 мкл 50 мМ MgCl 2, 1 мкл 10 мМ дНТФ смеси, и 2 мкл 0,1 М дитиотреитола (DTT).
      4. Инкубируют при температуре 4 ° С в течение 5 мин.
      5. Добавить 1 мкл обратной транскриптазы и инкубировать при 42 ° С в течение 5 мин.
      6. Инкубируют при 70 ° С в течение 15 мин.
      7. Инкубируют при температуре 4 ° С в течение 15 мин. кДНК можно хранить при температуре от -20 ° С до дальнейшего использования.
    6. ПЦР
      1. Смешайте 2,5 мкл 10 - кратного ПЦР - буфера, 1,5 мкл 25 мМ MgCl 2, 0,5 мкл 10 мМ дНТФ перемешать, 0,25 μЛ Taq-ДНК-полимеразы, 0,25 мкл каждого праймера (10 мкМ) и кДНК (100 нг) и стерильной водой до общего объема 25 мкл.
      2. Запуск образцов на 96-луночный термоциклеру. Для предотвращения амплификации геномной ДНК, прямого и обратного праймеров, должны быть расположены в разных экзонов: IL1β-FW: GCAACTGTTCCTGAACTCAACT и IL1β-RE: TCTTTTGGGGTCCGTCAACT; IL6-FW: CCTTCCTACCCCAATTTCCAA и IL6-RE: AGATGAATTGGATGGTCTTGGTC; KC-FW: TGTCAGTGCCTGCAGACCAT и KC-RE: CCTGAGGGCAACACCTTCA; и актин-FW: TATCCACCTTCCAGCAGATGT и актин-RE: AGCTCAGTAACAGTCCGCCTA. Используйте следующие условия ПЦР: 95 ° С в течение 5 мин, затем 30 циклов при 95 ° С в течение 15 с, 58 ° С в течение 30 с, и 72 ° С в течение 30 с, а также конечным удлинением в течение 10 мин при 72 ° C ,

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Диета добавки могут защитить от DSS колита

Противовоспалительные и антиоксидантные пищевые добавки, такие как витамин С, витамин Е, оксид азота (NO) -source L-аргинин, и & omega; 3-полиненасыщенных жирных кислот (& omega; 3-ПНЖК), которые были использованы с переменным успехом животного модели , чтобы облегчить симптомы воспалительных заболеваний 3,6,15. Недоедание, окислительный стресс, и производство провоспалительных цитокинов может вызвать как острый , так и хронический колит 3. В предыдущем исследовании мы показали , что сочетание питательных микроэлементов показали защитное действие против DSS-индуцированным колитом , в естественных условиях. Здесь мы предоставляем подробные протоколы о том , как эти эффекты были измерены 8. Во-первых, мы проанализировали влияние пищевых добавок на прогрессирование заболевания путем определения индекса активности заболевания (DAI), состоящий из трех параметров потери веса,консистенции стула, и анальное кровотечение. Представитель результаты показали , что лечение DSS привело к постоянно возрастающему DAI, как и ожидалось, достигая максимума 8,2 ± 0,46 на седьмой день (рис 1А). Противовоспалительные добавки диета задерживает начало колита, но в более поздние моменты времени, когда колиты был очень сильным, защитный эффект был незначительным и больше не статистически значимыми, предполагая, что пищевые добавки эффективны только при колитах еще не слишком сильным. Важно отметить, что диетическое вмешательство может предотвратить увеличение DSS-индуцированной кишечной эпителиальной проницаемости, что является важной особенностью колита (рис 1B). DSS колит привело к уменьшению длины толстой кишки, и это укорочение также смягчены с помощью противовоспалительной и антиоксидантной диеты добавки (рис 1C). Таким образом, клинические симптомы колита действительно могут быть решены путем изменения в составе рациона.

Для того, чтобы проанализировать, почему колита прогрессии была менее тяжелой у животных, получавших диету добавки, морфологии ткани исследовали после того, как гематоксилин / эозином (H / E) окрашиванием залитых парафином тканей дистальной ободочной кишки. Контрольные образцы показали нормальную морфологию (рис 2А, верхняя панель), в то время как у животных , обработанных 3,5% DSS показал типичные признаки колита (то есть, лейкоцитарной инфильтрацией, образованием отека, крипт дисплазии и изъязвления; Фигура 2А, средняя панель). Следует отметить, что параллельное лечение с диетической добавки явно облегченном колитом индуцированных морфологических изменений, с общей морфологии , которая была более сравнима с контрольной группой (рис 2А, нижняя панель). Эти наблюдения были очень похожи на то, что былосообщили для совместных обработок пробиотических бактерий 13 и ясно показывают , что изменения в рационе питания может противодействовать развитию колита.

Мы уже знали, что колита-индуцированной кишечной эпителиальной проницаемости может быть уравновешен диетической добавки. Повышение проницаемости является отличительной чертой IBD, и это во многом вызванное разборкой стабилизирующих слипчивых соединений (AJ) и плотных соединений (TJ). Дестабилизация эпителиальных клеточных контактов интернализации белков соединительных индуцируется провоспалительных цитокинов, которые в изобилии , образующихся при колите 16. Мы нашли, через иммунофлуоресцентного окрашивания дистальной ткани толстой кишки, которые были усвоены Т. Д. молекула блокатора малой зоны-1 (ZO-1), и молекула AJ Е-кадгерин во время DSS-индуцированным колитом, и что совместная локализация этих белков была частично потерянным при крипт эпителиальные контактов клеток (Фигура 2В). яmportantly, интернализации Е-кадгерина и ZO-1 была снижена при DSS-обработанных мышей совместно обрабатывали противовоспалительным и антиоксидантным пищевая добавка (Фигура 2В). В целом, крипт и ответвительные структуры были более сравнимы с контрольной группой, когда была применена пищевая добавка, предполагая, что наблюдаемый защитный эффект был по крайней мере частично из-за сохранения тканевой архитектуры.

Диетотерапии может противодействовать воспалительное рекрутирование, нейтрофилов окислительный стресс, и производство провоспалительных цитокинов

Другой отличительной чертой IBD является неконтролируемым нейтрофильной инфильтрации. Нанятые нейтрофилы способствуют повреждению тканей, производя и выпуская активные формы кислорода (АФК) и протеаз 17. Использование MPO активности анализа, мы обнаружили сильную вербовку нейтрофилов в толстой кишке в ответ на DSS, который противодействовалпутем диетической добавки (Фиг.3А).

Окислительный стресс является еще одной важной особенностью колита, вызванного выходом ROS из завербованных нейтрофилов. Таким образом, мы проанализировали продукцию ROS в толстой кишке сечениях. Рисунок 3B показывает , что лечение DSS сильно увеличилось окислительный стресс. Следует отметить, что изменения в диете полностью предотвращено ДСС-индуцированного окислительного стресса (фигура 3В), который , скорее всего , является следствием пониженной набора нейтрофилов (фиг.3А).

Провоспалительных цитокинов и хемокинов сильно продуцируются различными типами клеток во время колита 18. Такие медиаторы воспаления способствуют нейтрофильных набора и перехода белковых интернализации-функций, которые мы уже знали, может быть ослаблена изменениями в диете. Анализ экспрессии мРНК с помощью ОТ-ПЦР показал, что DSSповышал экспрессию IL1β, IL-6, и кератиноцитов , полученных хемокин (КЦ), как и ожидалось (3С), и что противовоспалительный добавки диета уменьшилась этот DSS-индуцированное увеличение (фиг.3С). Эти данные свидетельствуют о том, что пищевые добавки могут действительно служить для противодействия клинические признаки IBD.

Рисунок 1
Рисунок 1. Пищевые добавки могут облегчить заболевания Индекс активности, кишечная Эпителиальный Проницаемость и ободочной кишки Укорачивание. (A) Индекс активности заболевания (DAI, значения от 0 - 12) состоит из трех параметров потери веса, консистенции стула и перианальной кровотечения и ежедневно регистрировали в экспериментальных группах контроля (CTRL), колит и колит + пищевая добавка (колиты + полняющему.). Контрольная группа не показала никаких признаков колита, что приводит к DAI от 0 throughouт экспериментальный период. п = 5 на группу. (Б) Кишечные эпителиальные проницаемость измеряли Эванса синего утечки в вышеуказанных экспериментальных группах и выражали как поглощение при 620 нм на грамм ткани. п = 8 на группу. Все данные представлены в виде среднего значения ± стандартное отклонение от среднего (SDM). * Р <0,05; ** Р <0,01; *** Р <0,001. Статистика были рассчитаны с помощью одностороннего ANOVA. (С) Типичные изображения целых двоеточием соответствующих экспериментальных групп после 7 дней лечения. Шкала слева в сантиметрах. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

фигура 2
Рисунок 2. Ткань Морфология и Junction Архитектура лучше сохраняются во время колита при применении Пищевой Суpplements. (А) 5-мкм парафиновый сечение биоптатов от дистального двоеточием соответствующих экспериментальных групп , окрашивали гематоксилином / эозином и анализируют на типичные признаки колита, такие как образование отека (стрелки), лейкоцитарной инфильтрацией (головки стрелок), и изъязвление (*). Общая морфология ткани колита + Suppl. Группа более напоминает контроля, чем в группе колита, доказывающие общее защитное действие против DSS колита. Изображения представляют из 3 независимых тканевых препаратов в каждой группе. Изображения были сделаны с использованием объектива 10X. Бар = 100 мкм. (B) 8 мкм ободочной крио сечения соответствующих групп окрашивали антителами против ZO-1 (зеленый) и Е-кадгерин (красный). Co-локализация (желтый присоединяемых изображений; стрелки) Е-кадгерина и ZO-1 при крипт эпителиальных клеток контактов, которая теряется при колитах, в основном сохраняется в колита + Suppl. группа. Изображения являются репрезентативными 3независимые тканевые препараты. Бар = 50 мкм. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

Рисунок 3
Рисунок 3. Нейтрофильная Вербовка, окислительный стресс, и производство провоспалительных цитокинов может быть снижено на пищевые добавки. (A) миелопероксидазы (МРО) измеряли для анализа количества лейкоцитов в ткани толстой кишки в экспериментальных группах: Control (Ctrl), колита и колита + пищевая добавка (колиты + полняющему.). п = 5 на группу; * Р <0,05. Данные представлены как среднее ± SDM. Статистика были рассчитаны с помощью одностороннего ANOVA. (B) флуоресценции окисленного этидия, изображен в красном цвете как меру окислительного стресса в 8 мкм крио-секций соткани долгота, регистрировали с помощью лазерной конфокальной микроскопии. Изображения представляют из 3 независимых тканевых препаратов. Бар = 100 мкм. (С) продуцирование провоспалительных цитокинов IL1β и IL-6 и хемокинов KC определяли с помощью полуколичественного ОТ -ПЦР в агарозном геле 1,5% (черные и белые были возвращены для ясности). β-актина служил в качестве гена домашнего хозяйства. Типичные изображения трех независимых препаратов кДНК показаны. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Для того чтобы использовать пищевые добавки , в клинических исследованиях, преимущества и безопасность таких добавок должны быть тщательно оценены в естественных условиях в исследованиях на животных. В случае колита, несколько соответствующих животных моделей, которые напоминают клинические признаки IBD были созданы, в том числе химические модели DSS, TNBS или уксусную кислоту; выбиваемые (KO) модели, такие как IL10-KO; и иммуно-опосредованный клетками колита с использованием передачи усыновитель Т-клеток 19-21. Модель DSS колита является быстрым и надежным методом индукции колита , который напоминает многие симптомы заболевания человеческого IBD и был использован в многочисленных исследованиях , посвященных молекулярных механизмов колита 22. Кроме того, ДСС колита является обратимым и, таким образом, позволяет также для изучения заживления тканей после того, как colitogenic стимул был удален. Прилагаемый протокол подробно описывает колита модель DSS , которая была ранее оптимизированную в нашей лаборатории 8.

23. Кроме того, DSS должна быть в диапазоне молекулярных масс 40 - 50 кДа для индукции колита. Для неопытный исследователя, это будет важно, чтобы развить глаз для объективной оценки параметров DAI консистенции стула и перианальной кровотечения. Если оценка осуществляется неопытный исследователь, рекомендуется иметь коллега подтвердить оценку, в идеале слепым методом.

Для анализа кишечной эпителиальной проницаемости для макромолекул, три основных метода были использованы на протяжении литературы: анализа Эванса синего красителя, как описано здесь; закапывания 4 кДа FITC-декстрана в кишечной петле; и подача 4-кД FITC-декстрана 13,24,25. В последнем тесте, FITC-декстран подается через желудочный зонд, А количество ФИТЦ декстрана, который пересек эпителий и просочилась в кровоток измеряется флуорометрически из образцов сыворотки. В этом анализе, проницаемость всего желудочно-кишечного тракта измеряется, так как трассировщик проходит весь путь от пищевода до прямой кишки и большую часть трассера будет проходить до достижения толстой кишки. В модели петли, проницаемость измеряется в области кишечника , используемой для ограниченного цикла ( как правило , тонкая кишка) 25. В противоположность этому, голубой Эванса анализ имеет то преимущество, что только эпителиальной проницаемости в толстой кишке измеряется, так как трассировщик непосредственно воплощено в целой ободочной кишке. Таким образом, с помощью этого анализа можно сделать вывод о том, что ободочной эпителий защищена диеты добавки.

Всегда важно , чтобы записать вес толстой кишки и длину после экстракции и перед использованием тканей для других анализов, так как некоторые данные (например, утечка синего Эванса в проницаемости Ассау) выражены в г ткани. Кроме того, отношение веса к длине является независимым считывающее повреждения 26 ткани. В общем случае, морфология ткани анализируется с помощью погруженных в парафин тканей окрашивали гематоксилином и эозином, как описано здесь. Парафин вложение имеет то преимущество, что морфология ткань намного лучше консервативными по сравнению с другими методами вложения. Это дает возможность однозначной идентификации различных типов клеток в слизистой оболочке (то есть, иммунные клетки, эпителий, бокаловидных клеток и т.д.) , а также анализ изменений ткани при колите, такие как образование отека, лейкоцитарной инфильтрацией и эпителиальных апикальных эрозий. С другой стороны, парафин имеет тот недостаток, что специфического окрашивания могут быть выполнены только после того, как трудоемкого восстановления эпитоп. Поэтому мы всегда готовить различные биопсий замороженной ткани, внедренных в ОКТ соединения. Такие образцы тканей могут быть легко секционного с помощью криостата и показывают низкие уровни Autofluorescence. Мы используем этанол для фиксации путем дегидратации, так как при этом это не мешает актиновых филаментов (как метанол делает), а также не вызывает никакого аутофлуоресценцию (как ПФА). С помощью этих методов, мы обнаружили , что противовоспалительный и антиоксидантный пищевая добавка может улучшить морфологию тканей и распределительную архитектуру во время колита (сравните рисунок 2).

Чрезмерное набора нейтрофилов является критическим событием в колита, индуцированный производства хемоаттрактанты в ответ на воспаление 17. набор Нейтрофильная является физиологическим событием, так как нейтрофилы способствуют выведению воспалительного реплике и последующего заживления раны. Тем не менее, если это врожденный иммунный ответ не должным образом контролируется и прекращается, нейтрофилы в слизистой оболочке может способствовать повреждению тканей, освободив протеаз и активных форм кислорода. Нейтрофилы содержат MPO, который можно легко измерить и количественно, используяколориметрический анализ, в котором количество МРО прямо пропорционально количеству нейтрофилов. Рисунок 3A показывает , что увеличение нейтрофилов набора персонала во время колита и что диетотерапии может предотвратить эту чрезмерного и неконтролируемого иммунного ответа. В соответствии с обильным присутствием нейтрофилов в слизистой оболочке, окислительный стресс возрастает при колите (фиг.3В).

Наша диета добавки хорошо защищает слизистую оболочку от окислительного стресса, который, скорее всего, является следствием сокращения набора нейтрофилов. Как уже упоминалось, нейтрофилы привлекает хемокинов и производство хемокинов индуцируется провоспалительных цитокинов, которые секретируются различными типами клеток во время колита. Таким образом, мы предположили, что сокращение набора нейтрофилов является следствием снижения производства цитокина и хемокина. Фигура 3С показывает , что провоспалительные цитокины IL-1β и IL-6, а такжехемокин KC, которые активируются во время DSS-индуцированной колит. Диета дополнение вспять уровни IL-6 назад для контроля уровня и улучшило увеличение производства IL-1 и КС. Следует отметить, что KC является наиболее важным хемоаттрактантной для нейтрофилов у мышей.

Таким образом, заманчиво предположить, что наблюдаемое сохранение морфологии тканей происходит из-за сниженной инфильтрацией нейтрофилов, что, в свою очередь, является следствием сокращения производства КЦ. Анализ производства РНК в ДСС-обработанных тканей с помощью ОТ-ПЦР, является проблематичным, когда остаточный ДСС присутствует в выделенной РНК. Это происходит потому, что DSS ингибирует как обратные транскриптазы и Taq-полимераз. Если реакция амплификации не может быть достигнута, то это будет необходимо для дальнейшей очистки образцов РНК с помощью LiCl-опосредованной осаждения, как описано в другом месте 27.

В заключение, мы опишем подробно различные методы для анализа повреждения тканей во время DSS колит и как это dAmage могут быть облегчены с помощью биологически активных добавок. Знания, полученные из таких экспериментов на животных можно обосновать создание когорт пациентов, чтобы исследовать защитные эффекты анализируемых добавок в человеческом IBD. Данные, полученные в результате клинических исследований, могут затем открыть новые пути для разработки альтернативных стратегий лечения для управления IBD.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторы не имеют ничего раскрывать.

Acknowledgments

Эта работа была поддержана грантами Мексиканским советом по науке и технике (КОНАСИТ, 207268 и 233395 Михаилу Шнура). KFCO является получателем стипендии КОНАСИТ (396260), чтобы получить степень магистра.

Materials

Name Company Catalog Number Comments
0.3% of gelatin  Bioxon 158
10% formaldehyde J.T. Baker 2106-03
96-well plate with flat bottom Corning 3368
Absolute ethanol  J.T. Baker 9000-03
Absolute xylene J.T. Baker 9490-03
ABTS Sigma Aldrich H5882
Bovine Serum Albumin Sigma-Aldrich 9048-46-8
ColoScreen Helena Laboratories 5072
Corabion (Kindly provided by Merck, Naucalpan, Mexico) Merck
Dextran Sulfate Sodium Salt Affymetrix 9011-18-1 (M.W. 40,000-50,000)
Dihydroethidium Life Technology D11347
Eosin-Y  J.T. Baker L087-03
Evans blue Sigma-Aldrich 314-13-6
Feeding  needle Cadence Science Inc. 9921
Glass slide rack with handle Electron Microscopy 70312-16
Glass Slides Corning 2947
Harris hematoxylin  Sigma-Aldrich H3136
Hexadecyltrimethyammonium (HTAB) Sigma Aldrich H6269
Histosette (Embedding cassette) Simport M498.2
Hydrochloric acid 1 M J.T. Baker 9535-62
Hydrogen peroxide Sigma Aldrich H3410
Ketamine PiSA Agropecuaria Q-7833-028
Liquid paraffin  Paraplast 39501-006
Lithium carbonate  Sigma-Aldrich 2362
N,N-dimethylformamide J.T. Baker 68-12-2
N-acetylcysteine Sigma-Aldrich A9165
Plastic cubes Electron Microscopy 70181
Poly-L-Lysine Solution Sigma-Aldrich 25988-63-0
Prism 5 statistical software GraphPad Software Prism 5
Saline Solution 0.9% NaCl CS PiSA Q-7833-009
Sodium citrate Sigma-Aldrich W302600
Synthetic resin  Poly Mont 7987
Taq DNA polymerase Invitrogen 11615-010
Tissue-tek. O.C.T Compound Sakura Finetek 4583
Tuberculine Syringe BD Plastipak 305945
Tween 20 Sigma-Aldrich 9005-64-5
VECTASHIELD Antifade Mounting Medium with DAPI Vector Laboratories H-1200
Xylazine PiSA Agropecuaria Q-7833-099

DOWNLOAD MATERIALS LIST

References

  1. Souza, H. S., Fiocchi, C. Immunopathogenesis of IBD: current state of the art. Nat Rev Gastroenterol Hepatol. 13, 13-27 (2016).
  2. Xavier, R. J., Podolsky, D. K. Unravelling the pathogenesis of inflammatory bowel disease. Nature. 448, 427-434 (2007).
  3. Neuman, M. G., Nanau, R. M. Inflammatory bowel disease: role of diet, microbiota, life style. Transl Res. 160, 29-44 (2011).
  4. Lowenberg, M., D'Haens, G. Next-Generation Therapeutics for IBD. Current Gastroenterol Rep. 17, 21 (2015).
  5. Bernstein, C. N. Does everyone with inflammatory bowel disease need to be treated with combination therapy. Curr Opin Gastroenterol. (2016).
  6. Nanau, R. M., Neuman, M. G. Nutritional and probiotic supplementation in colitis models. Dig Dis Sci. 57, 2786-2810 (2012).
  7. Yamamoto, T. Nutrition and diet in inflammatory bowel disease. Curr Opin Gastroenterol. 29, 216-221 (2013).
  8. Vargas Robles, H., et al. Experimental Colitis Is Attenuated by Cardioprotective Diet Supplementation That Reduces Oxidative Stress, Inflammation, and Mucosal Damage. Ox Med Cell Longev. 8473242 (2016).
  9. Vargas-Robles, H., Rios, A., Arellano-Mendoza, M., Escalante, B. A., Schnoor, M. Antioxidative diet supplementation reverses high-fat diet-induced increases of cardiovascular risk factors in mice. Ox Med Cell Longev. 2015, 467471 (2015).
  10. Perse, M., Cerar, A. Dextran sodium sulphate colitis mouse model: traps and tricks. J Biomed Biotechnol. 2012, 718617 (2012).
  11. Chassaing, B., Aitken, J. D., Malleshappa, M., Vijay-Kumar, M. Dextran sulfate sodium (DSS)-induced colitis in mice. Curr. Protoc. Immunol. 104, Unit 15 25 (2014).
  12. Laroui, H., et al. Dextran sodium sulfate (DSS) induces colitis in mice by forming nano-lipocomplexes with medium-chain-length fatty acids in the colon. PLoS One. 7, 32084 (2009).
  13. Mennigen, R., et al. Probiotic mixture VSL#3 protects the epithelial barrier by maintaining tight junction protein expression and preventing apoptosis in a murine model of colitis. Am J Physiol Gastrointest Liver Physiol. 296, 1140-1149 (2009).
  14. Park, C. M., Reid, P. E., Walker, D. C., MacPherson, B. R. A simple, practical 'swiss roll' method of preparing tissues for paraffin or methacrylate embedding. J Microsc. 145, 115-120 (1987).
  15. Shen, W., Gaskins, H. R., McIntosh, M. K. Influence of dietary fat on intestinal microbes, inflammation, barrier function and metabolic outcomes. J Nutr Biochem. (2013).
  16. Bruewer, M., et al. Interferon-gamma induces internalization of epithelial tight junction proteins via a macropinocytosis-like process. FASEB J. 19, 923-933 (2005).
  17. Fournier, B. M., Parkos, C. A. The role of neutrophils during intestinal inflammation. Muc Immunol. 5, 354-366 (2012).
  18. Yan, Y., et al. Temporal and spatial analysis of clinical and molecular parameters in dextran sodium sulfate induced colitis. PLoS One. 4, 6073 (2009).
  19. Maxwell, J. R., Viney, J. L. Overview of mouse models of inflammatory bowel disease and their use in drug discovery. Curr Prot Pharmacol, S.J. Enna. Chapter 5, Unit 5.57 (2009).
  20. Ostanin, D. V., et al. T cell transfer model of chronic colitis: concepts, considerations, and tricks of the trade. Am J Physiol Gastrointest Liver Physiol. 296, 135-146 (2009).
  21. Randhawa, P. K., Singh, K., Singh, N., Jaggi, A. S. A review on chemical-induced inflammatory bowel disease models in rodents. Kor J Physiol Pharmacol. 18, 279-288 (2014).
  22. Whittem, C. G., Williams, A. D., Williams, C. S. Murine Colitis modeling using Dextran Sulfate Sodium (DSS). JoVE. (2010).
  23. Wirtz, S., Neufert, C., Weigmann, B., Neurath, M. F. Chemically induced mouse models of intestinal inflammation. Nat Prot. 2, 541-546 (2007).
  24. Naydenov, N. G., et al. Nonmuscle Myosin IIA Regulates Intestinal Epithelial Barrier in vivo and Plays a Protective Role During Experimental Colitis. Sci Rep. 6, 24161 (2016).
  25. Sumagin, R., Robin, A. Z., Nusrat, A., Parkos, C. A. Transmigrated neutrophils in the intestinal lumen engage ICAM-1 to regulate the epithelial barrier and neutrophil recruitment. Muc Immunol. 7, 905-915 (2014).
  26. Laukoetter, M. G., et al. JAM-A regulates permeability and inflammation in the intestine in vivo. J Exp Med. 204, 3067-3076 (2007).
  27. Viennois, E., Chen, F., Laroui, H., Baker, M. T., Merlin, D. Dextran sodium sulfate inhibits the activities of both polymerase and reverse transcriptase: lithium chloride purification, a rapid and efficient technique to purify RNA. BMC Res Notes. 6, 360 (2013).
Анализируя Благотворное влияние пищевых добавок на Кишечный Эпителиальное барьерные функции Во время экспериментального колита
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Vargas Robles, H., Castro Ochoa, K. F., Nava, P., Silva Olivares, A., Shibayama, M., Schnoor, M. Analyzing Beneficial Effects of Nutritional Supplements on Intestinal Epithelial Barrier Functions During Experimental Colitis. J. Vis. Exp. (119), e55095, doi:10.3791/55095 (2017).More

Vargas Robles, H., Castro Ochoa, K. F., Nava, P., Silva Olivares, A., Shibayama, M., Schnoor, M. Analyzing Beneficial Effects of Nutritional Supplements on Intestinal Epithelial Barrier Functions During Experimental Colitis. J. Vis. Exp. (119), e55095, doi:10.3791/55095 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter