Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Medicine

Analysera gynnsamma effekterna av Kosttillskott på intestinala epiteliala barriärfunktioner Under experimentell kolit

doi: 10.3791/55095 Published: January 5, 2017

Summary

Aktuella behandlingar av inflammatoriska tarmsjukdomar (IBD) syftar till att lindra sjukdomssymptom men kan orsaka allvarliga biverkningar. Således är alternativa strategier utreds i djur kolit modeller. Här förklarar vi hur de positiva effekterna av kosttillskott på kliniska IBD tecken analyseras på ett sådant kolit modell.

Abstract

Inflammatoriska tarmsjukdomar (IBD), inklusive Crohns sjukdom och ulcerös kolit, är kronisk recidiverande sjukdomar i tarmarna. De orsakar allvarliga problem, såsom magkramper, blodig diarré och viktminskning, i drabbade individer. Tyvärr finns det inget botemedel ännu, och behandlingar syftar bara för att lindra symtomen. Nuvarande behandlingar inkluderar antiinflammatoriska och immunosuppressiva läkemedel som kan orsaka allvarliga biverkningar. Detta motiverar sökandet efter alternativa behandlingsalternativ, såsom näringstillskott, som inte orsakar biverkningar. Innan deras tillämpning i kliniska studier, måste sådana föreningar noggrant testade för effektivitet och säkerhet i djurmodeller. En pålitlig försöksmodell är dextransulfat natrium (DSS) kolit modell i möss, som återger många av de kliniska tecken på ulcerös kolit hos människor. Vi tillämpade nyligen denna modell för att testa de positiva effekterna av ett näringstillskott innehållandevitamin C och E, L-arginin, och co3-polyomättade fettsyror (PUFA). Vi analyserade olika parametrar sjukdom och funnit att detta tillägg kunde lindra ödembildning, vävnadsskada, leukocytinfiltration, oxidativ stress, och produktionen av pro-inflammatoriska cytokiner, vilket leder till en allmän förbättring av sjukdomsaktivitetsindex. I den här artikeln förklarar vi i detalj korrekt tillämpning av näringstillskott med hjälp av kolit modell DSS i C57BL / 6 möss, samt hur sjukdomsparametrar såsom histologi, oxidativ stress och inflammation bedöms. Analysera de positiva effekterna av olika kosttillskott kan så småningom öppna nya vägar för utveckling av alternativa behandlingsstrategier som lindrar IBD symptom och / eller att förlänga de faser av eftergift utan att orsaka allvarliga biverkningar.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Kolit är ett inflammatoriskt tillstånd i tjocktarmen, som kan orsaka diarré och buksmärta. Kolit kan vara akut, som svar på infektion eller stress, eller det kan utvecklas som en kronisk sjukdom, såsom vid ulcerös kolit (UC), som hör till den grupp av inflammatoriska tarmsjukdomar (IBD). Även om kliniska tecken på UC har väl beskrivits, är patogenesen fortfarande dåligt kända en. Det är accepterat bland experter som UC är en multifaktoriell sjukdom, med genetiska mutationer och avvikande immunsvar spelar en viktig roll 2. Men miljöfaktorer, såsom livsstil och näring, även bidra till utveckling och progression tre sjukdom.

Olyckligtvis är IBD inte botas, men det finns många behandlingsalternativ som syftar till att lindra kliniska symptom. Nuvarande behandlingar inkluderar antiinflammatoriska läkemedel, såsom sulfasalazin och kortikosteroider; immunsuppressiva medel, såsom azathioPrine; monoklonala antikroppar som fångar proinflammatoriska cytokiner, såsom tumörnekrosfaktor-α (TNF-α), eller blockera adhesionsmolekyler, såsom integriner, för att minska överdriven leukocytrekrytering; och hämmare som riktar kinaser som utlöser proinflammatoriska vägar, såsom Janus-kinas (JAK) 4. Inte alla patienter svarar på alla behandlingar, så behandlingsstrategier måste individualiseras 5. Vidare, de flesta av dessa terapeutiska läkemedel störa metabolismen och immunsvar, vilket ofta förorsakar allvarliga biverkningar. Av detta skäl, har alternativa behandlingsmetoder undersökts.

Alternativa behandlingar inkluderar probiotika och näringstillskott, som har tillämpats i djurmodeller och kliniska försök med varierande framgång 6,7. Vi fann nyligen att tillämpningen av olika enskilda näringstillskott, såsom anti-oxidativa vitaminer eller ω3-poly-omättade fettsyror (PUFAs), är sämre än den tillämpning av en kombination av sådana tillskott för att lindra kolit och kardiovaskulära sjukdomssymptom 8,9. Dessa studier utfördes i möss, så kliniska studier måste utföras på människor för att avgöra om dessa fynd också kan tillämpas på människor. Innan kliniska studier initieras, måste effektiviteten och säkerheten av nya behandlingsalternativ utvärderas i djurmodeller.

För IBD, har dextransulfat natrium (DSS) modell använts i stor omfattning för att studera mekanismerna bakom sjukdomsutveckling och de positiva effekterna av läkemedel och näringstillskott 6,10. I de flesta studier endast en akut sjukdom under en tidsperiod på sju dagar induceras; ändå, de kliniska tecken som observerats hos dessa djur liknar de som observerats i IBD-patienter (dvs blodig diarré, viktminskning, epitel dysfunktion, och immuncellinfiltration) 10. DSS framkallar erosioner i slemhinnan,vilket resulterar i barriärfunktion och ökad intestinal epitel permeabilitet 11. Den exakta mekanismen är okänd. Emellertid tyder en studie som DSS interagerar med medium kedjelängd-fettsyror för att bilda nano lipocomplexes som har möjlighet att gå in epitelceller och inducera inflammatoriska signalvägar 12. I den här artikeln beskriver vi i detalj hur kolit kallas och analyseras i möss, hur näringstillskott tillämpas av sondmatning för att säkerställa en konstant dosering i varje djur, och hur effekterna av sådana tillskott på olika kolit symptom undersöks.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Alla djurförsök har godkänts av Institutional Animal Care och användning kommitté Cinvestav.

1. Framställning av DSS dricksvatten och induktion av kolit

  1. Bered en 3,5% vikt / vol dextransulfat natrium (DSS) lösning i autoklaverat dricksvatten. DSS löser sig lätt och det är inte nödvändigt att filtrera den slutliga lösningen.
    OBS: 7 dagar DSS behandling framkallar svår kolit. Om inducera mild kolit, 3 - är 4 dagars behandling rekommenderas. Så länge DSS dricksvatten förblir klar, är det inte nödvändigt att byta vatten. Men om det visar grumlig, måste den bytas ut.
  2. Registrera baslinjen vikt hanmöss. Se till att de är 8 - 12 veckor av ålder och inom ett område av 21 - 25 g kroppsvikt.
    OBS: Den lämpliga DSS Koncentrationen måste optimeras i varje laboratorium. Resultat kan variera kraftigt, beroende på bostadsförhållanden. Koncentrationer mellan 2,5-5% är oftast rapporterats inducera stark colitis i C57Bl / 6J WT möss 10. DSS från olika företag och olika partier bör testas, eftersom resultaten kan också variera med olika källor för DSS.
  3. Tillhandahålla vatten ad libitum och ersätta den med färsk 3,5% DSS vatten om det behövs.

2. Tillämpning av Kosttillskott genom sondmatning

  1. Förbered en "kan matas" lösning av de önskade näringstillskott i ett lämpligt lösningsmedel. För denna studie använde vi en blandning innehållande 200 mg / kg L-arginin, 83 mg / kg C-vitamin, 46 mg / kg vitamin E, 77 mg / kg eikosapentaensyra (EPA), och 115 mg / kg dokosahexaensyra (DHA ) i en 1: 1 lösning av vatten och safflorolja.
  2. Fyll en 1-ml spruta ansluten till en sondmatning nål (15 G x 50 mm) med den näringstillskott blandningen. Torka utsidan av sondmatning nål för att ta bort vilken som helst förening utsidan av nålen och för att säkerställa korrekt dos ansökan.
  3. Hålla tillbaka musen genom att ta tag i basen av svansen meden hand och genom att bestämt gripa ett hudveck på baksidan av halsen med tummen och pekfingret på den andra handen. Placera svansen mellan det tredje fingret och basen av tummen på samma hand som håller halsen.
  4. Under bibehållande av musen i ett upprätt läge, för in nålen i vänstra sidan av djurets mun och noga följa gommen att lokalisera matstrupen. Om inget motstånd påträffas avancera nålen mot magen.
    OBS: Kontrollera att djuret andas ordentligt innan du fortsätter.
  5. Administrera blandningen långsamt bort röret genom att långsamt dra ut sprutan och släpp musen. Applicera kosttillskott dagligen genom sondmatning under loppet av kolit experimentet.

3. Bestämning av sjukdomsaktivitetsindex

OBS: sjukdomsaktivitetsindex är kombinationen av poängen för viktminskning, perianal blödning och avföringskonsistens, som är obhålls dagligen 13.

  1. Mät kroppsvikt dagligen och tilldela en poäng på 0-4 enligt viktminskning procent (0: 0%, 1: 1-5%, 2: 5-10%, 3: 10-20%, och 4:> 20 %).
    OBS: Kroppsvikt förlust bestäms genom att beräkna skillnaden i procent mellan de basala vikt innan induktion av DSS-kolit och den faktiska vikten.
  2. För att bestämma nivån av perianala blödning, samla en ny avföringsprov och använd den medföljande applikatorer att applicera ett tunt smutsfläck på en bild från en guajak fekalt ockult blod testutrustning. Använd en ny applikator för varje prov.
    1. Stäng locket på framsidan och öppna fönstret på baksidan av bilden. Applicera två droppar framkallningslösningen till baksidan på provlokaliseringen.
    2. Läs resultatet efter 30 sekunder. Alla spår av blå färg är positivt för ockult blod. Tilldela en poäng av 0-4 (0: ingen, 0,5-2,5: positiv guaiac fekal ockult blodtest (beroende på signalstyrka), och 3-4: gross blödning).
      OBS: Om blod i avföringen är synlig, inte guajak fekalt ockult blodtest inte måste utföras, och en poäng på 3, 3,5, eller 4 är tilldelad, beroende på den mängd synligt blod.
  3. Bestäm avföringskonsistens genom att observera ett nytt avföringsprov. Tilldela en poäng av 0-4 (0: normal / fast, 0,5-2,5: degig avföring, och 3-4: diarré).

4. Fastställande intestinala epiteliala permeabilitet in vivo genom Evans Blue-analys

  1. Söva djuren genom att injicera dem intraperitonealt med en blandning av ketamin (100 mg / kg kroppsvikt) och xylazin (13 mg / kg kroppsvikt) utspädd i saltlösning (0,9% NaCl), och bedöma djupet av anestesi genom att övervaka nypa tillbakadragande reflex.
  2. Placera de sövda djuren i ryggläge och utför en laparotomi för att exponera tarmen.
  3. Lokalisera blindtarmen och göra ett litet snitt i det proximala segmentet av tjocktarmen enscendens (helst omedelbart intill blindtarmen).
  4. Sätt en matningsnål (G22) och säkra den med en ligatur med hjälp av en gemensam silkestråd. Skölj noga igenom riklig PBS genom röret för att skölja ut all avföring från tjocktarmen. Ingjuta Evans blue-lösning (1,5% vikt / volym i PBS) in i tjocktarmen tills den når anus.
  5. Inkubera Evans-blått i 15 min. Tvätta ur färgen genom att spola röret med riklig PBS tills perianala wash-out är klar.
  6. Avliva djuren genom cervikal dislokation.
  7. Skära tjocktarmen och skölj den igen med rikligt PBS. Skölj en gång med 1 ml 6 mM N -acetylcysteine i PBS för att eliminera varje färgämne fastnar på kolon slem.
  8. Skär kolon i längdled och skölj den en gång med PBS och 1 ml 6 mM N -acetylcysteine.
  9. Registrera vikten och längd. Att extrahera Evans blått färgämne, placera kolon i 2 ml N, N-dimetylformamid under natten vid rumstemperatur med försiktig agitation. Mäta färgämneskoncentrationen spektrofotometriskt vid 610 nm.

5. Tissue Collection

  1. Söva djuren genom att injicera dem intraperitonealt med en blandning av ketamin (100 mg / kg kroppsvikt) och xylazin (13 mg / kg kroppsvikt) utspädd i saltlösning (0,9% NaCl), och bedöma djupet av anestesi genom att övervaka nypa tillbakadragande reflex.
  2. Avliva djuren genom cervikal dislokation.
  3. Placera djuren i ryggläge och utför en laparotomi för att exponera bukhålan.
  4. Med sax, dissekera hela tjocktarmen och spela in sin längd.
  5. Spola kolon noggrant flera gånger med kyld PBS för att ta bort avföring. Anteckna vävnadsvikt och förbereda sig för följande experiment, som beskrivs i steg 5,6 - 5,8.
  6. För RNA-isolering och myeloperoxidas (MPO) analyser, avbröt en lämplig storlek vävnadsprov (100 mg är vanligen tillräckligt), placera den i ett rör, och snap-frysa den i flytande kväve. Lagra vävnader vid -80 ° C för framtida användning.
  7. För immunofluorescensfärgning och oxidativ stress bestämning (se nedan), skär en liten kolon prov (0,5-1 cm) och submerse det i små aluminiumkoppar fyllda med optimal skärtemperatur (oktober) förening. Placera koppar på torris och låta dem frysa långsamt, för att undvika bubbelbildning. Frusna vävnadsproverna kan förvaras vid -80 ° C för framtida användning.
  8. För rulltårta 14 öppnar kolon i längdled och försiktigt bort avföring med hjälp av pincett. Rulla upp, med slemhinnan inåt, med hjälp spetsig pincett eller en tunn, rund träpinne. Försiktigt placera det i en inbäddning kassett och fortsätta med steg 6,1.
    OBS: DSS inducerar skador i kolon. Varierar dock skada distributionen från den proximala till den distala kolon, med mest skada vanligtvis ses i den distala tjocktarmen och ändtarmen. Därför rekommenderar vi att analysera histologi antingen i distala colpå eller i schweiziska roller hela kolon.

6. Analys av Colon Histologi av Hematoxylin-eosin färgning

  1. vävnads~~POS=TRUNC
    1. För histologisk analys, översvämmas antingen de schweiziska rullar eller de små vävnadsbitar från vissa kolon regioner av kontroll och behandlade möss i 5 ml 10% formaldehyd under 48 timmar vid rumstemperatur (RT) för att uppnå en korrekt fixering.
      NOTERA: Alla ytterligare steg i steg 6 utförs vid RT, om inte annat anges.
    2. Tvätta dem med kranvatten under 18 timmar.
    3. Dehydratisera dem med 15 ml 70% etanol under 1 h, 96% under 1 timme, och absolut etanol under 1 timme. Upprepa varje steg med färsk alkohol innan man går vidare till nästa koncentration.
    4. Fortsätta dehydratiseringen i en blandning av 7,5 ml absolut etanol och 7,5 ml absolut xylen under 1 h. Upprepa en gång innan de passerar proverna till 15 ml absolut xylen under 1 timme. Upprepa detta steg en gång med färsk xylen.
    5. Bädda Colon vävnadsprover i Paraffin
      1. Doppa proverna i 50 ml av flytande paraffin under 17 timmar. Upprepa detta steg en gång, men för bara tre timmar.
      2. Doppa proverna i kuber (plast, fyrkantiga mögel, storlek: 22 x 22 x 22 mm) i 810 ml flytande paraffin.
      3. Tillåt paraffinet med kolon vävnadsprover för att stelna under 24 h vid RT.
    6. Skärvävnads Tvärsnitt med hjälp av en Mikrotom
      1. Skära kolon prover med användning av en mikrotom, i enlighet med tillverkarens anvisningar och med en tjocklek av 5 um.
      2. Samla nedskärningar i ett vattenbad (1 L) innehållande 0,3% gelatin. Detta förhindrar vikning av vävnadstvärsnitt. Återställa vävnadssnitt och montera dem på objektglas.
    7. Hematoxylin och eosin färgning av vävnads Tvärsnitt
      1. Avparaffinera proverna under 18 timmar vid 60 ° C i en inkubator. För detta ändamål använder en glas slide rack med ett handtag.
      2. Efter avparaffinering, sänk ned objektglasen i 70 ml absolut xylen under 5 min. Upprepa detta steg en gång med färsk xylen.
      3. Överför proverna i 70 ml absolut alkohol under 1 min. Upprepa detta steg en gång med färsk alkohol.
      4. Inkubera kolonvävnadsprov i 70 ml etanol 96% i 1 min. Upprepa detta steg en gång med färsk alkohol.
      5. Tvätta proverna i kranvatten två gånger i 2 s.
      6. Inkubera vävnaderna i Harris hematoxylin för 7 min.
      7. Tvätta proverna i kranvatten två gånger i 2 s.
      8. Inkubera proverna i surt alkohol (70 ml etanol 70% och 700 mikroliter av 1 M klorvätesyra) under 7 s.
      9. Tvätta proverna i kranvatten två gånger i 2 s.
      10. Inkubera vävnadsproverna i 70 ml litiumkarbonat (1 g litiumkarbonat i 100 ml destillerades vatten) under 7 s.
      11. Tvätta proverna i kranvatten två gånger i 2 s.
      12. Inkubera proverna i 70 ml etanol 80% I 1 min.
      13. Överför proverna i 70 ml Eosin-Y i 15 s.
      14. Inkubera dem i 70 ml 96% etanol under 1 min. Upprepa detta steg en gång med färsk alkohol.
      15. Inkubera vävnadsproverna i 70 ml absolut etanol (etylalkohol absolut vattenfri) under 1 min. Upprepa detta steg en gång med färsk alkohol.
      16. Inkubera proverna i 70 ml av en blandning av 35 ml absolut alkohol och 35 ml absolut xylen under 1 min.
      17. Överför proverna i 70 ml absolut xylen under 1 min. Upprepa detta steg för 5 minuter i 70 ml färsk absolut xylen.
      18. Tillsätt 80 mikroliter av syntetiskt harts till kolon vävnadsprover, täck dem med täckglas, och låt dem torka i 24 h vid RT. Slutligen, analysera prover med ljusfält mikroskopi 8.

    7. Analysera Junction sammansättning genom immunofluorescens

    1. Förbereda vävnaden som beskrivs i steg 5,7 och skär 8 ^ m tjocka tvärsektionermed hjälp av en kryostat.
    2. Fixa och permeabilisera tvärsnitt kolon med 96% etanol vid -20 ° C under 20 min.
      NOTERA: Alla efterföljande inkubationer bör utföras vid RT, om inte annat anges, i en fuktig mörk ruta för att förhindra torkning och fluorokrom fädning.
    3. Lufttorka prover, och sedan skölja dem 3 gånger under 5 min vardera med 1x PBS
    4. Inkubera proverna med blockeringslösning (PBS innehållande 0,01% Tween och 2% BSA) under 2 h.
    5. Avlägsna den blockerande lösningen och skölj den med PBS-0,01% Tween under 10 minuter.
    6. Under denna tid, späd de primära antikroppar till de önskade koncentrationerna i PBS-0,01% Tween.
    7. Ta bort tvättlösningen, applicera antikroppslösningen från föregående steg, och inkubera över natten vid 4 ° C i en fuktad box.
    8. Avlägsna antikropplösningen och tvätta 3 gånger med PBS-0,01% Tween under 5 min vardera och en gång med avjoniserat vatten under 10 min, med mycket mild omröring.
    9. Även tvätt, centrifug fluorochromeconjugated, artspecifika sekundära antikroppar vid 14.000 xg under 20 min vid 4 ° C.
    10. Späd de sekundära antikropparna utan fällningar såsom anges av leverantören i PBS-0,01% Tween, tillämpa dem, och inkubera under 1 h vid RT.
    11. Upprepa steg 7,8 och ta bort tvättlösningen så fullständigt som möjligt.
    12. Pipett 4 mikroliter av anti-fading medel under varje prov på bilden.
    13. Täck proverna med ett täckglas.
    14. Lufttorka under en timme.
    15. Tätning glida med nagellack. Diabilder kan förvaras vid -20 ° C fram till vidare analys.
    16. Analysera på en konfokala lasermikroskop 8.

    8. Fastställande av oxidativ stress genom oxidation av Ethidium

    1. Efter 7 dagars DSS kolit, förbereda vävnad såsom beskrivs i steg 5,7 och skär kolon sektioner i en kryostat med en tjocklek av 5 um. Mount tvärsnitt på objektglas som behandlats med poly-L-lysin-lösning och inkubera proverna with 5 pM av dihydroethidium (DHE) i vatten vid 37 ° C under 30 minuter i mörker.
    2. Tvätta proverna med PBS (pH 7,6) tre gånger i 15 min vardera med försiktig omrörning vid RT. Lufttorka proverna och tillsätt en droppe monteringsmedium för att skydda fluorescens. Observera fluorescens av oxiderat etidium på en laserskanning konfokalmikroskop (40X förstoring, 568 nm våglängd).

    9. Analys av leukocytrekrytering av MPO-analys

    1. Efter 7 dagars DSS kolit, samla kolon vävnad och homogenisera prover (200-400 mg) med 1 ml hexadecyltrimetylammonium (HTAB) buffert (0,5% HTAB i 50 mM fosfatbuffert, pH 6,0) med användning av en homogenisator på is.
    2. Skölj spetsen av homogenisator två gånger med 1 ml HTAB-buffert för att inkludera all vävnad i lysatet och sonikera den fem gånger vid 40% amplitud under 10 s vardera. Frysning-tining i flytande kväve tre gånger.
    3. Centrifugera vid 14000 x g i 15 min och samla in supernatanten.Framställa 2,2'-azino-bis (3-etylbensotiazolin-6-sulfonsyra) (ABTS) lösning genom blandning av ABTS, 5 ml natriumcitrat (1 M i vatten), 0,1 ml väteperoxid och 45 ml bi -destillerat vatten.
    4. Blanda 0,1 ml av varje supernatant med 0,1 ml ABTS-lösning i en 96-brunnars flatbottnad platta. Efter 10 min, mät absorbansen vid 460 nm med användning av en spektrofotometer.

    10. Utvärdering av Expression av proinflammatoriska cytokiner genom PCR

    1. vävnads Homogenisering
      1. Homogenisera 50 till 100 mg av kolonvävnadsprov i 1 ml av en syra guanidiniumtiocyanat-fenol-kloroform-blandning med användning av en effekthomogenisator.
      2. Inkubera i rumstemperatur under 15 minuter.
    2. fasskiljande
      1. Tillsätt 0,2 ml kloroform och skaka kraftigt i 30 sekunder.
      2. Inkubera vid 4 ° C under 30 min.
      3. Centrifugera vid 12.000 xg under 60 min vid 4 ° C.
      4. Överföra upper vattenfasen i ett nytt rör (~ 500 mikroliter).
    3. RNA Utfällning och Resuspension
      1. Tillsätt 0,5 ml isopropylalkohol och inkubera proverna vid 4 ° C under 60 min.
      2. Centrifugera vid 12.000 xg under 30 min vid 4 ° C.
      3. Avlägsna supernatanten fullständigt.
      4. Tillsätt 1 ml etanol 75% och virvel.
      5. Centrifugera vid 12.000 xg under 30 min vid 4 ° C.
      6. Avlägsna supernatanten.
      7. Tillåta den återstående etanol för att lufttorka i 3-5 min.
        OBS: Det är viktigt att inte låta RNA-pelleten torka helt, eftersom detta i hög grad kommer att minska dess löslighet.
      8. Åter upplösa pelleten i 0,3 ml dietylpyrokarbonat (DEPC) -behandlat vatten. Omedelbart transkribera RNA-prover i cDNA (mer stabila, se steg 10,5) eller förvara vid -80 ° C.
    4. RNA Kvantifiering
      1. Späd 1 mikroliter av RNA med 99 mikroliter av DEPC-behandlat vatten.
      2. Läs the OD vid 260 nm och 280 nm med en UV / VIS-spektrofotometer för att fastställa provkoncentrationen och renhet.
    5. cDNA-syntes
      1. Blanda RNA-prover (1-5 | j, g) med en mikroliter av Oligo (dT) 12-18 (0,5 pg / pL) och DEPC-behandlat vatten (total volym av 12 | il) i RNas-fritt sterila rör.
      2. Inkubera vid 70 ° C under 10 min.
      3. Lägg 2 mikroliter av 10x PCR-buffert, 1 | il av 50 mM MgCl2, 1 mikroliter av 10 mM dNTP-blandning, och 2 | il av 0,1 M ditiotreitol (DTT).
      4. Inkubera vid 4 ° C under 5 min.
      5. Tillsätt 1 mikroliter av omvänt transkriptas och inkubera vid 42 ° C under 5 min.
      6. Inkubera vid 70 ° C under 15 min.
      7. Inkubera vid 4 ° C under 15 min. cDNA kan lagras vid -20 ° C tills vidare användning.
    6. PCR
      1. Blanda 2,5 mikroliter av 10x PCR-buffert, 1,5 mikroliter av 25 mM MgCl2, 0,5 mikroliter av 10 mM dNTP-blandning, 0,25 μL från Taq DNA-polymeras, 0,25 mikroliter av varje primer (10 | iM) och cDNA (100 ng), och sterilt vatten till en total volym av 25 mikroliter.
      2. Köra proverna på en 96-brunnars termocykelapparat. För att förhindra förstärkning av genomiskt DNA, framåt och bakåt primers bör placeras i olika exoner: IL1β-FW: GCAACTGTTCCTGAACTCAACT och IL1β-RE: TCTTTTGGGGTCCGTCAACT; IL6-FW: CCTTCCTACCCCAATTTCCAA och IL6-RE: AGATGAATTGGATGGTCTTGGTC; KC-FW: TGTCAGTGCCTGCAGACCAT och KC-RE: CCTGAGGGCAACACCTTCA; och aktin-FW: TATCCACCTTCCAGCAGATGT och aktin-RE: AGCTCAGTAACAGTCCGCCTA. Använda följande PCR-betingelser: 95 ° C under 5 min följt av 30 cykler vid 95 ° C under 15 s, 58 ° C under 30 s, och 72 ° C under 30 s, plus en slutlig förlängning i 10 min vid 72 ° C .

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Kost-tillskott kan skydda från DSS kolit

Anti-inflammatoriska och anti-oxidativa kost-tillskott, såsom vitamin C, vitamin E, kväveoxid (NO) -source L-arginin, och co3-polyomättade fettsyror (co3-PUFA), har använts med varierande framgång i djur modeller för att lindra tecken på inflammatoriska sjukdomar 3,6,15. Undernäring, oxidativ stress, och produktionen av proinflammatoriska cytokiner kan utlösa både akuta och kroniska kolit 3. I en tidigare studie, visade det sig att en kombination av mikronäringsämnen uppvisade skyddande effekter mot DSS-inducerad kolit in vivo. Här ger vi detaljerade protokoll om hur dessa effekter mättes åtta. Först har vi analyserat effekterna av näringstillskott på sjukdomsprogression genom att bestämma sjukdomsaktivitetsindex (DAI), som består av de tre parametrarna för viktminskning,pall konsekvens och perianala blödning. Representativa resultat visade att DSS behandling ledde till en kontinuerligt ökande DAI, som förväntat och nådde ett maximum av 8,2 ± 0,46 på dag sju (Figur 1A). Anti-inflammatorisk diet tillskott fördröjning av kolit, men vid senare tidpunkter, när kolit var mycket stark, den skyddande effekten var marginell och inte längre statistiskt signifikant, vilket tyder på att kosttillskott är endast effektiva när kolit är ännu inte alltför stark. Viktigare, kunde dietary ingripande förhindra DSS-inducerad ökning av intestinal epitelial permeabilitet, vilket är ett viktigt särdrag av kolit (Figur 1B). DSS kolit ledde till minskade kolon längder, och denna förkortning var också förbättras av den antiinflammatoriska och anti-oxidativ kosttillskott (Figur 1C). Således kan kliniska symptom på kolit faktiskt lindras genom förändringar i diet komposition.

För att analysera varför kolit progression var mindre allvarlig i djur som fick ett kosttillskott, var vävnaden morfologi undersöktes efter hematoxylin / eosin (H / E) färgning av paraffininbäddade distal kolon vävnader. Kontrollprover visade en normal morfologi (Figur 2A, övre panel), medan djur som behandlats med 3,5% DSS visade typiska tecken på kolit (dvs leukocytinfiltration, ödembildning, crypt dysplasi, och sår, figur 2A, mellersta panel). Notera parallell behandling med kost tillskott klart lindras kolit-inducerad morfologiska förändringar, med en total morfologi som var mer jämförbar med kontrollgruppen (figur 2A, nedre panelen). Dessa observationer var mycket lika det som har varitrapporterats för co-behandlingar med probiotiska bakterier 13 och visar tydligt att förändringar i kosten kan motverka utvecklingen av kolit.

Vi visste redan att kolit-inducerad intestinal epitel permeabilitet skulle kunna motverkas av kost tillskott. Ökad permeabilitet är ett kännetecken för IBD, och det är till stor del orsakas av demontering av de stabiliserande zonula adhaerens (AJ) och tight junctions (TJ). Destabilisering av epitelceller kontakter genom internalisering av Junktional proteiner induceras av pro-inflammatoriska cytokiner, som rikligt produceras under kolit 16. Vi fann, genom immunofluorescerande färgning av distal kolon vävnad, att TJ molekyl zonula occludens-1 (ZO-1) och AJ molekylen E-cadherin har internaliseras under DSS-inducerad kolit och att samlokalisering av dessa proteiner var delvis förlorad på crypt epitelcellsystem kontakter (Figur 2B). jagmportantly, internalisering av E-cadherin och ZO-1 minskade när DSS-behandlade möss gavs samtidigt behandlas med en anti-inflammatorisk och anti-oxidativ kosttillskott (Figur 2B). Sammantaget krypta och kopplingsstrukturer var mer jämförbara med kontrollerna när kosttillskott tillämpades, vilket tyder på att den observerade skyddande effekten var åtminstone delvis på grund av bevarandet av vävnad arkitektur.

Dietary Intervention kan motverka inflammatorisk neutrofil rekrytering, oxidativ stress, och produktionen av proinflammatoriska cytokiner

Ett annat kännetecken för IBD är okontrollerad neutrofil infiltration. Rekryterade neutrofiler bidrar till vävnadsskador genom att producera och släppa reaktiva syreradikaler (ROS) och proteaser 17. Använda en MPO-aktivitet analys fann vi en stark neutrofila rekrytering i tjocktarmen som svar på DSS, vilket motverkadesav kost tillskott (figur 3A).

Oxidativ stress är en annan viktig egenskap hos kolit, orsakas av utsläpp av ROS från rekryterade neutrofiler. Sålunda analyserade vi produktionen av ROS i tvärsnitt kolon. Figur 3B visar att DSS behandling kraftigt ökad oxidativ stress. Notera förändringar i kost helt förhindras DSS-inducerad oxidativ stress (figur 3B), vilket är sannolikt en följd av minskad neutrofil rekrytering (figur 3A).

Pro-inflammatoriska cytokiner och kemokiner är starkt produceras av olika celltyper under kolit 18. Sådana inflammatoriska mediatorer bidra till neutrofila rekrytering och korsning proteininternalise-funktioner som vi visste redan kan dämpas av förändringar i kosten. Analys av mRNA-expression genom RT-PCR visade att DSSökade uttrycket av IL1β, IL-6, och keratinocyt-härledda kemokin (KC), som förväntat (figur 3C), och att anti-inflammatorisk diet supplemente minskat denna DSS-inducerad ökning (figur 3C). Dessa data tyder på att kost-tillskott faktiskt kan bidra till att motverka kliniska tecken på IBD.

Figur 1
Figur 1. Kosttillskott kan lindra sjukdomsaktivitetsindex, Intestinal Epithelial permeabilitet, och Colon Förkortning. (A) sjukdomsaktivitetsindex (DAI värden från 0-12) består av de tre parametrarna för viktminskning, avföring konsekvens, och perianal blödning och registrerades dagligen i försöksgrupperna kontroll (ctrl), kolit och kolit + näringstillskott (kolit + suppl.). Kontrollgruppen visade inga tecken på kolit, vilket resulterar i en DAI av 0 throughout försöksperioden. n = 5 per grupp. (B) Intestinal epitelial permeabilitet mättes med Evans blue läckage i de ovan nämnda experimentgrupper och uttrycktes som absorptionen vid 620 nm per g vävnad. n = 8 per grupp. Alla data visas som medelvärdet ± standardavvikelsen för medelvärdet (SDM). * P <0,05; ** P <0,01; *** P <0,001. Statistik beräknades genom en envägs ANOVA. (C) Representativa bilder av hela kolon hos respektive experimentgrupper efter 7 dagars behandling. Skalan till vänster är i cm. Klicka här för att se en större version av denna siffra.

figur 2
Figur 2. vävnadsmorfologi och Junction arkitektur bevaras bättre under kolit vid tillämpningen Närings Supplements. (A) 5-um paraffin tvärsnitt av vävnadsbiopsier från den distala kolon för respektive experimentgrupper färgades med hematoxylin / eosin och analyserades för typiska tecken på kolit, såsom ödembildning (pilar), leukocytinfiltration (pilhuvuden), och sår (*). Totalt vävnad morfologi kolit + suppl. grupp mer liknar den för kontroll än kolit gruppen, vilket bevisar en total skyddande effekt mot DSS kolit. Bilder är representativa för 3 oberoende vävnadsberedningar per grupp. Bilder togs med hjälp av en 10X objektiv. Bar = 100 | j, m. (B) 8 pm kolon Cryo-sektioner av respektive grupp färgades med antikroppar mot ZO-1 (grönt) och E-cadherin (röd). Samlokalisering (gul i de sammanslagna bilder, pilar) av E-cadherin och ZO-1 på crypt epitelcellsystem kontakter som går förlorad under kolit, oftast bevarad i kolit + suppl. grupp. Bilder är representativa för treoberoende vävnadsberedningar. Bar = 50 | im. Klicka här för att se en större version av denna siffra.

Figur 3
Figur 3. neutrofila Rekrytering, oxidativ stress, och produktionen av proinflammatoriska cytokiner kan minskas genom Kosttillskott. (A) Myeloperoxidas (MPO) mättes för att analysera mängden leukocytrekrytering i kolonvävnader i experimentgrupperna: kontroll (Ctrl), kolit, och kolit + näringstillskott (kolit + suppl.). n = 5 per grupp; * P <0,05. Data visas som medelvärdet ± SDM. Statistik beräknades genom en envägs ANOVA. (B) fluorescens av oxiderat etidium, som visas i rött som ett mått på oxidativ stress i 8-im Cryo-sektioner av colon vävnader, spelades in av laser konfokalmikroskopi. Bilder är representativa för 3 oberoende vävnadspreparat. Bar = 100 | j, m. (C) Produktionen av de pro-inflammatoriska cytokiner IL1β och IL-6 och kemokin KC bestämdes genom semikvantitativ RT-PCR i en 1,5% agarosgel (svartvitt var åter för tydlighetens skull). β-aktin tjänade som housekeeping-genen. Representativa bilder av tre oberoende cDNA preparat visas. Klicka här för att se en större version av denna siffra.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

För att kunna använda näringstillskott i kliniska studier, måste fördelarna och säkerheten för sådana tillskott noga utvärderas in vivo i djurstudier. I fallet med kolit, har flera lämpliga djurmodeller som liknar de kliniska tecknen på IBD etablerats, inklusive kemiska modeller med hjälp av DSS, TNBS eller ättiksyra; knock-out (KO) modeller såsom IL10-KO; och immun-cellmedierad kolit med användning adoptiv T-cellöverföring 19-21. DSS modell av kolit är en snabb och tillförlitlig metod för att inducera kolit som liknar många sjukdomssymptom av human IBD och har använts i en uppsjö av studier som undersöker de molekylära mekanismerna av kolit 22. Dessutom är DSS kolit reversibel och sålunda gör det också möjligt för studier av vävnadsläkning efter det colitogenic retningen har avlägsnats. Den medföljande protokoll beskrivs i detalj DSS kolit modell som tidigare har optimerats i vårt laboratorium 8.

23 sjukdom. Dessutom måste DSS vara i ett molekylviktsintervall på 40 - 50 kDa för att inducera kolit. För oerfarna forskare, kommer det att vara viktigt att utveckla ett öga för en opartisk bedömning av DAI parametrar avföringskonsistens och perianala blödning. Om bedömningen görs av en oerfaren forskare, är det att rekommendera att ha en kollega bekräftar bedömningen, helst i en blindad sätt.

För att analysera tarm epitel permeabilitet för makromolekyler, har tre stora metoder använts genom litteraturen: Evans blått färgämne analys som beskrivs här; instillation av 4-kDa FITC-dextran i en tarmslinga; och utfodring av 4-kDa FITC-dextran 13,24,25. I det senare analys, är FITC-dextran matas genom sondmatning, Och mängden av FITC-dextran som korsade epitelet och läckte in i blodströmmen mäts fluorometriskt från serumprover. I denna analys är permeabiliteten av hela mag-tarmkanalen mäts, eftersom spårämnet passerar hela vägen från matstrupen till rektum och större delen av spårämnet kommer att passera innan den når tjocktarmen. I slingan modellen permeabilitet mätt i ett begränsat tarm område som används för slingan (vanligtvis tunntarmen) 25. I motsats härtill har de Evans blå-analysen fördelen att endast epitelial permeabilitet i grovtarmen mäts, eftersom spårämnet är direkt instilleras i hela kolon. Således, med hjälp av denna analys kan vi dra slutsatsen att kolon epitel skyddas av kosttillskott.

Det är alltid viktigt att spela kolon vikt och längd efter extraktion och innan de vävnader för andra analyser, eftersom vissa uppgifter (t.ex. läckt Evans blå i permeabilitet assay) uttrycks per g vävnad. Vidare är vikten-till-längdförhållande en oberoende avläsning av vävnadsskada 26. I allmänhet är vävnadsmorfologi analyseras med användning av paraffininbäddade vävnader färgade med hematoxylin och eosin, såsom beskrivs här. Paraffininbäddning har fördelen att den vävnad morfologi är mycket bättre bevarad i förhållande till andra inbäddningsmetoder. Detta gör det möjligt att entydigt identifiera olika celltyper inom slemhinnan (dvs immunceller, epitel, bägarceller, etc.) och analys av vävnadsförändringar under kolit, såsom ödembildning, leukocytinfiltration och epitelceller apikala erosioner. Å andra sidan, har paraffin den nackdelen att immunofluorescerande färgning endast kan utföras efter tidskrävande epitop återhämtning. Därför har vi alltid förbereda olika frysta vävnadsbiopsier inbäddade i OCT-förening. Sådana vävnadsprover kan enkelt sektion med hjälp av en kryostat och visar låga nivåer av autofluorescence. Vi använder etanol för fixering av uttorkning, eftersom inte heller störa aktinfilament (som metanol gör), och inte heller utlösa autofluorescens (som PFA gör). Med hjälp av dessa tekniker, fann vi att en anti-inflammatorisk och anti-oxidativ kosttillskott kan förbättra vävnads morfologi och korsning arkitektur under kolit (jämför figur 2).

Överdriven neutrofila rekrytering är en kritisk händelse under kolit som induceras av produktionen av kemoattraktanter som svar på inflammation 17. Neutrofil rekrytering är en fysiologisk händelse eftersom neutrofiler bidrar till avlägsnandet av den inflammatoriska cue och efterföljande sårläkning. Men om denna inneboende immunsvar inte är ordentligt kontrollerade och avslutat, kan neutrofiler i slemhinnan bidra till vävnadsskada genom att frisätta proteaser och reaktiva syrespecies. Neutrofiler innehåller MPO, som lätt kan mätas och kvantifieras med hjälp av enkolorimetrisk analys, där mängden MPO är direkt proportionell mot antalet neutrofiler. Figur 3A visar att neutrofila rekryteringen under kolit och att dietary ingripande kan förhindra denna överdrivna och okontrollerade immunsvar. I enlighet med den rikliga neutrofil närvaro i slemhinnan, ökar oxidativ stress under kolit (figur 3B).

Vår kost tillskott skyddar klart slemhinnan från oxidativ stress, vilket är sannolikt en följd av minskad neutrofil rekrytering. Såsom nämnts, är neutrofiler attraheras av kemokiner och produktionen av kemokiner induceras av pro-inflammatoriska cytokiner som utsöndras av olika celltyper under kolit. Därför antog vi att minskad neutrofil rekrytering är en följd av minskad cytokin och kemokin produktion. Figur 3C visar att de pro-inflammatoriska cytokinerna IL-1β och IL-6, liksom denkemokin KC, uppregleras under DSS-inducerad kolit. Den kosttillskott återförs nivåerna av IL-6 tillbaka till kontrollnivåer och förbättras den ökade produktionen av IL-1β och KC. Notera, är KC den viktigaste kemoattraherande för neutrofiler hos möss.

Sålunda är det frestande att spekulera att den observerade bevarandet av vävnadsmorfologi beror på minskad neutrofil infiltration, som är, i sin tur, en följd av den minskade produktionen av KC. Analysera RNA-produktion i DSS-behandlade vävnader genom RT-PCR är problematiskt när rest DSS är närvarande i det isolerade RNA. Detta beror på DSS hämmar både omvänt transkriptas och Taq-polymeraser. Om kan uppnås ingen amplifiering, kommer det att vara nödvändigt att ytterligare rena RNA-prover genom LiCl-medierad utfällning, såsom beskrivs på annan plats 27.

Sammanfattningsvis, vi beskriver i detalj olika metoder för analys av vävnadsskada under DSS kolit och hur detta dAmage kan förbättras genom kosttillskott. Kunskap från sådana djurförsök kan motivera inrättandet av patientkohorter att undersöka de skyddande effekterna av de analyserade tillskott i human IBD. Data som erhållits från kliniska studier kan öppna nya vägar för att utveckla alternativa behandlingsstrategier för hantering av IBD.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna har ingenting att lämna ut.

Acknowledgments

Detta arbete har finansierats med bidrag från den mexikanska rådet för vetenskap och teknik (CONACYT, 207.268 och 233.395 till Michael Schnoor). KFCO är en mottagare av en CONACYT stipendium (396.260) för att erhålla en magisterexamen.

Materials

Name Company Catalog Number Comments
0.3% of gelatin  Bioxon 158
10% formaldehyde J.T. Baker 2106-03
96-well plate with flat bottom Corning 3368
Absolute ethanol  J.T. Baker 9000-03
Absolute xylene J.T. Baker 9490-03
ABTS Sigma Aldrich H5882
Bovine Serum Albumin Sigma-Aldrich 9048-46-8
ColoScreen Helena Laboratories 5072
Corabion (Kindly provided by Merck, Naucalpan, Mexico) Merck
Dextran Sulfate Sodium Salt Affymetrix 9011-18-1 (M.W. 40,000-50,000)
Dihydroethidium Life Technology D11347
Eosin-Y  J.T. Baker L087-03
Evans blue Sigma-Aldrich 314-13-6
Feeding  needle Cadence Science Inc. 9921
Glass slide rack with handle Electron Microscopy 70312-16
Glass Slides Corning 2947
Harris hematoxylin  Sigma-Aldrich H3136
Hexadecyltrimethyammonium (HTAB) Sigma Aldrich H6269
Histosette (Embedding cassette) Simport M498.2
Hydrochloric acid 1 M J.T. Baker 9535-62
Hydrogen peroxide Sigma Aldrich H3410
Ketamine PiSA Agropecuaria Q-7833-028
Liquid paraffin  Paraplast 39501-006
Lithium carbonate  Sigma-Aldrich 2362
N,N-dimethylformamide J.T. Baker 68-12-2
N-acetylcysteine Sigma-Aldrich A9165
Plastic cubes Electron Microscopy 70181
Poly-L-Lysine Solution Sigma-Aldrich 25988-63-0
Prism 5 statistical software GraphPad Software Prism 5
Saline Solution 0.9% NaCl CS PiSA Q-7833-009
Sodium citrate Sigma-Aldrich W302600
Synthetic resin  Poly Mont 7987
Taq DNA polymerase Invitrogen 11615-010
Tissue-tek. O.C.T Compound Sakura Finetek 4583
Tuberculine Syringe BD Plastipak 305945
Tween 20 Sigma-Aldrich 9005-64-5
VECTASHIELD Antifade Mounting Medium with DAPI Vector Laboratories H-1200
Xylazine PiSA Agropecuaria Q-7833-099

DOWNLOAD MATERIALS LIST

References

  1. Souza, H. S., Fiocchi, C. Immunopathogenesis of IBD: current state of the art. Nat Rev Gastroenterol Hepatol. 13, 13-27 (2016).
  2. Xavier, R. J., Podolsky, D. K. Unravelling the pathogenesis of inflammatory bowel disease. Nature. 448, 427-434 (2007).
  3. Neuman, M. G., Nanau, R. M. Inflammatory bowel disease: role of diet, microbiota, life style. Transl Res. 160, 29-44 (2011).
  4. Lowenberg, M., D'Haens, G. Next-Generation Therapeutics for IBD. Current Gastroenterol Rep. 17, 21 (2015).
  5. Bernstein, C. N. Does everyone with inflammatory bowel disease need to be treated with combination therapy. Curr Opin Gastroenterol. (2016).
  6. Nanau, R. M., Neuman, M. G. Nutritional and probiotic supplementation in colitis models. Dig Dis Sci. 57, 2786-2810 (2012).
  7. Yamamoto, T. Nutrition and diet in inflammatory bowel disease. Curr Opin Gastroenterol. 29, 216-221 (2013).
  8. Vargas Robles, H., et al. Experimental Colitis Is Attenuated by Cardioprotective Diet Supplementation That Reduces Oxidative Stress, Inflammation, and Mucosal Damage. Ox Med Cell Longev. 8473242 (2016).
  9. Vargas-Robles, H., Rios, A., Arellano-Mendoza, M., Escalante, B. A., Schnoor, M. Antioxidative diet supplementation reverses high-fat diet-induced increases of cardiovascular risk factors in mice. Ox Med Cell Longev. 2015, 467471 (2015).
  10. Perse, M., Cerar, A. Dextran sodium sulphate colitis mouse model: traps and tricks. J Biomed Biotechnol. 2012, 718617 (2012).
  11. Chassaing, B., Aitken, J. D., Malleshappa, M., Vijay-Kumar, M. Dextran sulfate sodium (DSS)-induced colitis in mice. Curr. Protoc. Immunol. 104, Unit 15 25 (2014).
  12. Laroui, H., et al. Dextran sodium sulfate (DSS) induces colitis in mice by forming nano-lipocomplexes with medium-chain-length fatty acids in the colon. PLoS One. 7, 32084 (2009).
  13. Mennigen, R., et al. Probiotic mixture VSL#3 protects the epithelial barrier by maintaining tight junction protein expression and preventing apoptosis in a murine model of colitis. Am J Physiol Gastrointest Liver Physiol. 296, 1140-1149 (2009).
  14. Park, C. M., Reid, P. E., Walker, D. C., MacPherson, B. R. A simple, practical 'swiss roll' method of preparing tissues for paraffin or methacrylate embedding. J Microsc. 145, 115-120 (1987).
  15. Shen, W., Gaskins, H. R., McIntosh, M. K. Influence of dietary fat on intestinal microbes, inflammation, barrier function and metabolic outcomes. J Nutr Biochem. (2013).
  16. Bruewer, M., et al. Interferon-gamma induces internalization of epithelial tight junction proteins via a macropinocytosis-like process. FASEB J. 19, 923-933 (2005).
  17. Fournier, B. M., Parkos, C. A. The role of neutrophils during intestinal inflammation. Muc Immunol. 5, 354-366 (2012).
  18. Yan, Y., et al. Temporal and spatial analysis of clinical and molecular parameters in dextran sodium sulfate induced colitis. PLoS One. 4, 6073 (2009).
  19. Maxwell, J. R., Viney, J. L. Overview of mouse models of inflammatory bowel disease and their use in drug discovery. Curr Prot Pharmacol, S.J. Enna. Chapter 5, Unit 5.57 (2009).
  20. Ostanin, D. V., et al. T cell transfer model of chronic colitis: concepts, considerations, and tricks of the trade. Am J Physiol Gastrointest Liver Physiol. 296, 135-146 (2009).
  21. Randhawa, P. K., Singh, K., Singh, N., Jaggi, A. S. A review on chemical-induced inflammatory bowel disease models in rodents. Kor J Physiol Pharmacol. 18, 279-288 (2014).
  22. Whittem, C. G., Williams, A. D., Williams, C. S. Murine Colitis modeling using Dextran Sulfate Sodium (DSS). JoVE. (2010).
  23. Wirtz, S., Neufert, C., Weigmann, B., Neurath, M. F. Chemically induced mouse models of intestinal inflammation. Nat Prot. 2, 541-546 (2007).
  24. Naydenov, N. G., et al. Nonmuscle Myosin IIA Regulates Intestinal Epithelial Barrier in vivo and Plays a Protective Role During Experimental Colitis. Sci Rep. 6, 24161 (2016).
  25. Sumagin, R., Robin, A. Z., Nusrat, A., Parkos, C. A. Transmigrated neutrophils in the intestinal lumen engage ICAM-1 to regulate the epithelial barrier and neutrophil recruitment. Muc Immunol. 7, 905-915 (2014).
  26. Laukoetter, M. G., et al. JAM-A regulates permeability and inflammation in the intestine in vivo. J Exp Med. 204, 3067-3076 (2007).
  27. Viennois, E., Chen, F., Laroui, H., Baker, M. T., Merlin, D. Dextran sodium sulfate inhibits the activities of both polymerase and reverse transcriptase: lithium chloride purification, a rapid and efficient technique to purify RNA. BMC Res Notes. 6, 360 (2013).
Analysera gynnsamma effekterna av Kosttillskott på intestinala epiteliala barriärfunktioner Under experimentell kolit
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Vargas Robles, H., Castro Ochoa, K. F., Nava, P., Silva Olivares, A., Shibayama, M., Schnoor, M. Analyzing Beneficial Effects of Nutritional Supplements on Intestinal Epithelial Barrier Functions During Experimental Colitis. J. Vis. Exp. (119), e55095, doi:10.3791/55095 (2017).More

Vargas Robles, H., Castro Ochoa, K. F., Nava, P., Silva Olivares, A., Shibayama, M., Schnoor, M. Analyzing Beneficial Effects of Nutritional Supplements on Intestinal Epithelial Barrier Functions During Experimental Colitis. J. Vis. Exp. (119), e55095, doi:10.3791/55095 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter