Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells

Summary

This manuscript describes the efficient, non-viral delivery of miR to endothelial cells by a PEI/MNP vector and their magnetization. Thus, in addition to genetic modification, this approach allows for magnetic cell guidance and MRI detectability. The technique can be used to improve the characteristics of therapeutic cell products.

Abstract

To date, the available surgical and pharmacological treatments for cardiovascular diseases (CVD) are limited and often palliative. At the same time, gene and cell therapies are highly promising alternative approaches for CVD treatment. However, the broad clinical application of gene therapy is greatly limited by the lack of suitable gene delivery systems. The development of appropriate gene delivery vectors can provide a solution to current challenges in cell therapy. In particular, existing drawbacks, such as limited efficiency and low cell retention in the injured organ, could be overcome by appropriate cell engineering (i.e., genetic) prior to transplantation. The presented protocol describes the efficient and safe transient modification of endothelial cells using a polyethyleneimine superparamagnetic magnetic nanoparticle (PEI/MNP)-based delivery vector. Also, the algorithm and methods for cell characterization are defined. The successful intracellular delivery of microRNA (miR) into human umbilical vein endothelial cells (HUVECs) has been achieved without affecting cell viability, functionality, or intercellular communication. Moreover, this approach was proven to cause a strong functional effect in introduced exogenous miR. Importantly, the application of this MNP-based vector ensures cell magnetization, with accompanying possibilities of magnetic targeting and non-invasive MRI tracing. This may provide a basis for magnetically guided, genetically engineered cell therapeutics that can be monitored non-invasively with MRI.

Introduction

Gene and cell therapy are powerful tools that have the potential to solve current challenges in CVD treatment. Despite the fact that both of these approaches are currently being tested in clinical trials, they are not yet ready for wide clinical application¹. Notably, a common approach to tackle the challenges of gene and cell therapy is to develop multifunctional gene delivery vectors suitable for clinical application. The lack of safe and efficient gene delivery systems is the main concern of gene therapy. At the same time, the genetic engineering of cellular products prior to transplantation could overcome the serious challenges of cell ther....

Protocol

Human umbilical cords for cell isolation were obtained postpartum from informed, healthy women who gave their written consent to the use of this material for research according to the Declaration of Helsinki. The ethical committee of the University of Rostock has approved the presented study (reg. No. A 2011 06, prolonged 23 September, 2013).

1. Preparation of Transfection Complexes

1. Biotinylation of polyethyleneimine (PEI).
   1. Dissolve branched PEI in ultrapure water under magnetic stirring at 300 - 400 rpm for 24 h at room temperature (RT) and protected from light to obtain a 0.18-mM solution. Store the soluti....

Results

The main purpose of the proposed protocol is to produce magnetically responsive miR-modified cells and to conduct their accurate characterization (Figure 1). As a result, efficiently transfected cells, responsive to magnetic selection and guidance and detectable with MRI, should be obtained.

First, the identities of isolated HUVECs were confirmed by typical staining with the endothelial marker CD31 (PECAM) (

Discussion

The production of genetically engineered cells loaded with superparamagnetic nanoparticles for their further magnetically controlled guidance is presented in the current protocol. The successful application of this strategy allows for the resolution of some difficulties of cell therapy, such as low retention and poor engraftment in the injured area^2,3,4, by providing a targetable cell product for transplantation. Moreover, the s.......

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
PEI 25 kDa	Sigma Aldrich	408727
EZ-Link Sulfo-NHS-LC-Biotin	Thermo Scientific	21335
PD-10 Desalting Columns	GE Healthcare	17085101	Containing Sephadex G-25 Medium
Ninhydrin Reagent solution 2%	Sigma Aldrich	7285
Glycine	Sigma Aldrich	410225
Pierce Biotin Quantitation Kit	Thermo Scientific	28005
Microplate reader Model 680	Bio-Rad
Streptavidin MagneSphere Paramagnetic Particles	Promega	Z5481
Millex-HV PVDF Filter	Merck	SLHV013SL	0.45 µm
Libra 120 transmission electron microscope	Zeiss		Acceleration Voltage 120 kV
Sapphire X-ray detector	EDAX-Amatek
Cell culture plastic	TPP
NHS-Esther Atto 565	ATTO-TEC GmbH	AD 565-31
NHS-Esther Atto 488	ATTO-TEC GmbH	AD 488-31
Cy5 miRNA Label IT kit	Mirus Bio	MIR 9650
Biotin Atto 565	ATTO-TEC GmbH	AD 565-71
Collagense Type IV Gibco	Thermo Scientific	17104019
Endothelial growth medium, EGM-2	Lonza	CC-3156 & CC-4176
Penicillin/Streptomycin	Thermo Scientific	15140122	100 U/mL, 100 µg/mL
Matrigel	BD Biosciences	356234
anti-PECAM-1 antibody	Santa Cruz	sc-1506
MS MACS columns	Miltenyi Biotec	130-042-201
Near-IR Live/Dead Cell Stain Kit	Thermo Scientific	L10119
Cy3 Dye-Labeled Pre-miR Negative Control	Thermo Scientific	AM17120	"Cy3-miR" or "Cyanine-miR3" in the manuscript
Pre-miR miRNA Precursor Molecules - Negative Control	Thermo Scientific	AM17110	"scr-miR" in the manuscript
Anti-hsa-miR92a-3p synthetic Inhibitor	Thermo Scientific	AM10916
LSM 780 ELYRA PS.1 system	Zeiss
Paraformaldehyde	Sigma Aldrich	158127	4% solution in PBS
DAPI nuclear stain	Thermo Scientific	D1306
NucleoSpin RNA isolation Kit	Machery-Nagel	740955
mirVana miRNA Isolation Kit	Thermo Scientific	AM1560
TaqMan MicroRNA Reverse Transcription Kit	Thermo Scientific	4366596
StepOnePlus Real-Time PCR System	Applied Biosystems
High-Capacity cDNA Reverse Transcription Kit	Thermo Scientific	4368814
hsa-miR-92a TaqMan assay	Thermo Scientific	000431	Mature miRNA Sequence: UAUUGCACUUGUCCCGGCCUGU
FastGene Taq Ready Mix	Nippon Genetics	LS27
ITGA5 TaqMan assay	Thermo Scientific	Hs01547673_m1
RNU6B TaqMan assay	Thermo Scientific	001093
18S rRNA Endogenous Control	Thermo Scientific	4333760F
Gelatin	Sigma Aldrich	G7041
CellTrace Calcein Red-Orange	Thermo Scientific	C34851
PBS	Pan Biotech	P04-53500
BSA	Sigma Aldrich
MACS buffer	Miltenyi Biotec	130-091-221
Agarose	Sigma Aldrich	A9539
7.1 Tesla animal MRI system	Bruker Corporation	A7906
ImageJ software	National Institutes of Health		upgraded with an AngiogenesisAnalyzer (NIH)
MPS device	Bruker Biospin
Matlab software	Mathworks
Ring Neodym Magnet	magnets4you GmbH	RM-10x04x05-G	ø 10 mm; remanescence is ~ 1.3 T, coercivity ≥ 955 kA/m
Click-iT EdU Alexa Fluor 647 Imaging Kit	Thermo Scientific	C10340
FluorSave Reagent	Merck	345789
Ultrasonic bath	Bandelin electronic	Type: RK 100 SH