Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biochemistry

ביטוי חלבון רקומביננטי, התגבשות, מחקרים ביופיסיקליים של א doi: 10.3791/55576 Published: May 16, 2017

Summary

Bacillus anthracis הוא הפתוגן המחייב של אנתרקס משאיפת קטלני, ולכן מחקרים על הגנים והחלבונים שלהם מוסדרים בקפידה. גישה חלופית היא ללמוד גנים אורתולוגיים. אנו מתארים מחקרים biophysicochemical של B. אנתרקיס אורת'ולוג ב B. cereus , bc1531, הדורש ציוד ניסיוני מינימלי וחסרים בעיות בטיחות חמורות.

Abstract

כדי להתגבר על הגבלות בטיחות ותקנות בעת לימוד גנים וחלבונים מפני פתוגנים אמיתיים, הומולוגים שלהם ניתן ללמוד. Bacillus anthracis הוא פתוגן מחייב שגורם לאנתרקס שאיפה קטלני. Bacillus cereus נחשב מודל שימושי ללימוד ב 'אנתרקיס בשל הקשר האבולוציוני הקרוב שלה. אשכול הגנים ba1554 - ba1558 של B. anthracis נשמר מאוד עם אשכול bc1531 - bc1535 ב- B. cereus , וכן עם bt1364-bt1368 באשכול ב- Bacillus thuringiensis, המציין את התפקיד הקריטי של הגנים המשויכים לסוג Bacillus . כתב היד מתאר שיטות להכנת ואפיון של מוצר חלבון של הגן הראשון ( ba1554 ) מקבוצת גנים ב B. anthracis באמצעות חלבון רקומביננטי של אורתולוג ב B. cereus , bc1531.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

ביטוי חלבון רקומביננטי נעשה שימוש נרחב כדי להתגבר על בעיות הקשורות מקורות חלבון טבעי, כגון כמויות חלבון מוגבל זיהום מזיק. יתר על כן, במחקרים על גנים וחלבונים פתוגניים, ניתן לנצל זן מעבדה חלופי שאינו דורש אמצעי בטיחות נוספים. לדוגמה, Bacillus cereus הוא מודל שימושי לחקר Bacillus anthracis בשל הקשר האבולוציוני הקרוב שלהם 1 .

B. anthracis הוא פתוגן מחייב שגורם לאנתרקס משאיפה קטלנית בבני אדם ובעלי חיים, והוא עשוי לשמש כ bioweapon 2 . לפיכך, מחקרים מעבדה על B. anthracis מוסדרים בקפדנות על ידי המרכזים האמריקאים לבקרת מחלות, המחייבים פרקטיקות של רמה 3 (BSL-3) של בטיחות ביולוגית, אשר קובעות כי אזור המעבדה יופרד עם לחץ שלילי בחדר. בניגוד ל- B. anthracis B. cereus מסווג כסוכן BSL-1 ולכן יש חששות בטיחות מינימליים. B. cereus הוא פתוגן אופורטוניסטי אשר, עם זיהום, גורם הרעלת מזון שניתן לטפל ללא סיוע רפואי. עם זאת, מכיוון שב 'cereus חולק גנים קריטיים רבים עם B. anthracis , ניתן לבדוק את הפונקציות של חלבונים אנתראקיס באמצעות ההומולוגים המתאימים של B. cereus 1 .

Ba1554 - ba1558 אשכול גנים של B. anthracis הוא שמר מאוד עם bc1531 - bc1535 אשכול של B. cereus , וכן עם bt1364-bt1368 אשכול של Bacillus thuringiensis , במונחים של ארגון גנים ורצף. יתר על כן, הגנים הראשונים ( ba1554 , bc1531 , bt1364 ) של אשכולות בהתאמה משומרים לחלוטין ( כלומר, 100% רצף נוקלאוטיד זהות), implyiNg תפקיד קריטי של המוצר הגן במינים Bacillus . בשל מיקומה של אשכולות גנים אלה, ba1554 זוהה בטעות כווסת שעתוק משוער 3 . עם זאת, רצף חומצות אמינו ניתוח של המוצר ba1554 מציין כי היא שייכת למשפחת MazG, אשר יש פעילות pyrophosphohydrolase נוקלאוטיד אינו קשור עם גורם שעתוק פעילות 4 , 5 . למרות חלבונים השייכים למשפחת MazG הם מגוונים ביחס לרצף הכולל אורך, הם חולקים משותף ~ 100-שאריות MazG תחום מאופיין EXXE 12-28 EXXD מוטיב ("X" מייצג שאריות חומצות אמינו, ומספר מציין את מספר שאריות X).

תחום ה- MazG לא תמיד מייצג באופן ישיר פעילות קטליטית מסוימת. חבר MazG מ Escherichia coli (EcMazG) בעל שני תחומים MazG, אבל בLy מסוף C- תחום MazG הוא פעיל enzymatically 6 . יתר על כן, הספציפי המצע של אנזימים MazG משתנה מ nonphoside nucleoside שאינם ספציפיים (עבור EcMazG) ספציפיים dCTP / dATP (עבור integrin הקשורים מזג) ו DUTP (עבור dUTPases) 6 , 7 , 8 , 9 . לכן, מנתח biophysicochemical של החלב BA1554 יש צורך לאשר פעילות NTPase שלה לפענח את הספציפיות המצע שלה.

כאן, אנו מספקים פרוטוקול צעד אחר צעד כי מעבדות ביותר ללא מתקן BSL-3 יכול לעקוב כדי לאפיין את המוצר חלבון של הגן bc1531 B. cereus , שהוא אורתולוג של B. anthracis ba1554 , ברמה המולקולרית. בקצרה, רקומביננטי BC1531 (rBC1531) התבטא ב coli ו מטוהרים באמצעות תג זיקה. עבור ניסויים קריסטלוגרפיים רנטגן, קריסטליZation התנאים של חלבון rBC1531 הוקרנו אופטימיזציה. כדי להעריך את הפעילות האנזימטית של rBC1531, פעילות NTPase היה פיקוח colorimetrically כדי למנוע רדיואקטיבי שכותרתו נוקליאוטידים כי כבר בשימוש מקובל. לבסוף, ניתוחים של הנתונים biophysicochemical שהושגו אפשרה לנו לקבוע את המדינה oligomerization ופרמטרים קטליטי של rBC1531, כמו גם להשיג נתונים עקיפה רנטגן מן גביש rBC1531.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Recombinant חלבון ייצור וטיהור של rBC1531

  1. הכנת חלבון BC1531 רקומביננטי (rBC1531) - ביטוי פלסמיד
    1. הכינו DNA גנומי של B. cereus 10 .
    2. להגביר את הגן bc1531 מתבנית של ד chenus גנומי על ידי תגובת שרשרת פולימראז (PCR), באמצעות פריימרים קדימה ויופעת (ראה את רשימת החומרים) כדי ליצור BAM HI ו סאל אני הגבלת אתרי אנזים, בהתאמה 10 .
    3. לעכל את המוצר PCR ו שונה וקטור pET49b (pET49bm) באמצעות BAM HI ו Sal I, כמתואר 11 .
    4. מערבבים את המוצר PCR מעוכל וקטור (יחס 3: 1) משלב 1.1.3 באמצעות ליגז T4 DNA בתגובה 10 μL, כמתואר 11 . לדגור על 18 מעלות צלזיוס למשך 30 דקות.
    5. פיפטה 3 μL של התגובה קשירת לתוך 50 μL של chemicaLly המוסמכת E. coli DH5α תאים בצינור. מערבבים בעדינות על ידי pipetting מעלה ומטה ומניחים על קרח במשך 30 דקות. הלם חום עבור 45 s ב 42 ° C. הוסף 1 מ"ל של Luria-Bertani (LB) בינוני לגדל את התאים תוך רועד במרץ (250 סל"ד, 37 מעלות צלזיוס, 45 דקות).
    6. קח 100 μL של תאים שהשתנו משלב 1.1.6 ולהפיץ אותם על צלחות LB אגר עם 100 מיקרוגרם / קנמיצין מ"ל (קאן). לדגור על ~ 18 שעות ב 37 ° C.
    7. בחר מושבות באמצעות טיפ סטרילי לגדול התאים 3 מ"ל של מדיום LB עם 100 מיקרוגרם / מ"ל ​​קן; לנער במרץ (250 סל"ד, 37 מעלות צלזיוס, 18 שעות).
    8. הכן DNA פלסמיד באמצעות שיטה ליקוי SDS אלקליין, כמתואר 10 .
    9. אישור רצף נוקליאוטידים של ביטוי rBC1531-ביטוי באמצעות רצף DNA 12 .
  2. Overexpression של חלבון rBC1531
    1. Re- להפוך את coli BL21 (DE3) זן עם rBC1531-expRession פלסמיד, כמתואר צעדים 1.1.5-1.1.6, עבור overexpression.
    2. בחר מושבה לגדל אותו 10 מ"ל של LB בינוני המכיל 50 מיקרוגרם / מ"ל ​​קן (LB + קאן); לנער במרץ 18 שעות על 37 מעלות צלזיוס.
    3. לחסן 10 מ"ל של תרבות לילה ב 1 L של LB + קאן בינוני לגדול ב 37 ° C עד OD 600 (צפיפות אופטית ב 600 ננומטר) מגיע ~ 0.7.
    4. לצלול את התרבות במים קרים כקרח במשך 15 דקות ~ כדי לקרר את הטמפרטורה ל 18 מעלות צלזיוס ולהוסיף isopropyl β-D-1-thiogalactopyranoside (IPTG) לתרבות בריכוז סופי של 1 מ"מ על ביטוי חלבון רקומביננטי. לגדל את התרבות ב 18 מעלות צלזיוס עבור ~ ~ 18-18 נוספים.
  3. טיהור של rBC1531
    1. קציר התאים על ידי צנטריפוגה (5,000 xg, 4 ° C, 30 דקות). מחק את supernatant בזהירות כדי לא להפריע לתאים. Re- להשעות את התאים 50 מ"ל של פוספט שנאגרו מלוחים (PBS) פתרון המכיל 10 imidazole מ"מ.
    2. Lyse התאים פעמיים על ידי sonication על הקרח כדי למנוע את חימום יתר של lysates התא (זמן: 2 דקות 30 S, מחזור על: 5 S, מחזור הנחה: 10 S, משרעת: 38%).
    3. נקה לייסט התא על ידי צנטריפוגה (~ 25,000 XG, 4 ° C, 30 דקות).
    4. מערבבים 3 מ"ל של חרוזים ניקל 60 מ"ל של PBS המכיל 10 מ"מ imidazole וכוח הכבידה חיץ נוסף ליישב את חרוזי ניקל equilibrated ב 2.5 x 10 ס"מ טור כרומטוגרפיה זכוכית.
    5. פיפטה כדי להעביר את supernatant מ צעד 1.3.3 לעמוד עם חרוזי ניקל מראש equilibrated ו דגירה על 4 מעלות צלזיוס למשך 2 שעות על גלגל מסתובב במהירות נמוכה (~ 20 סל"ד).
    6. אפשר supernatant לניקוז על ידי כוח הכבידה ולשטוף את חרוזי ניקל בעמודה שלוש פעמים עם 100 מ"ל של PBS המכיל 10 imidazole מ"מ.
    7. חלבון RBC1531 Elute על ידי החלת 4 x 5 מ"ל של PBS המכיל 250 מ"מ imidazole.
    8. קח 15 μL של elution מ צעד 1.3.7 ולהפעיל אותו על 15% SDS-PAGE. לדמיין את להקות חלבון בהג'ל באמצעות מכתים כחול קומסי 10 .
  4. הסרת תגי הזיקה של חלבון rBC1531 על ידי פרוטאוליזה thrombin
    1. פיפטה שברים צינור דיאליזה (משקל מולקולרי לחתוך: 3 kDa) ומניחים את הצינור בכוס המכיל 4 L של חיץ תואמת thrombin cleavage (20 מ"מ HEPES, pH 7.4, 150 מ"מ NaCl, ו 1.5 מ"מ β-mercaptoethanol) ב 4 ° C במשך הלילה.
    2. פיפטה את השברים ולהעביר אותם צינור חרוטי.
    3. למדוד את ספיגת ב 280 ננומטר ולהעריך את ריכוז החלבון rBC1531, כמתואר 13 .
    4. קח 50 מיקרוגרם של rBC1531 בצינור 0.5 מ"ל ולהוסיף כמויות שונות של thrombin ( כלומר, 2, 1, 0.6, ו 0.3 יחידות). דגירה של תגובות rBC1531 ו thrombin ב 20 מעלות צלזיוס במשך 3 שעות כדי לקבוע את הכמות המינימלית של thrombin נדרש לדבוק תג זיקה N- מסוף.
    5. הפעל את rBC1531 ותגובות טרומבין על 15%SDS-PAGE ולקבוע את הכמות הנמוכה ביותר של thrombin ( למשל, 0.3 יחידות של תרומבין לכל 50 מיקרוגרם של rBC1531) כי מעכל לחלוטין את תג זיקה N- מסוף לייצר RBC1531 ללא תג.
    6. הוסף 10 מ"ג של חלבון rBC1531 ו 60 יחידות של טרומבין לצינור 15 מ"ל ו דגירה על 20 מעלות צלזיוס למשך 3 ~ שעה לתגובה thrombin- proteolysis.
    7. החלת תקני סינון ג'ל על עמודה בגודל כרומטוגרפיה (SEC) כדי להכין עקומה סטנדרטית של משקולות מולקולריות וכרכים elution, כמתואר 13 .
    8. מניחים את החלבון rBC1531 מתעכל thrombin משלב 1.4.6 בצינור צנטריפוגלי מסנן (משקל מולקולרי לחתוך: 3 kDa) ו צנטריפוגות ב 3000 גרם ב 4 ° C כדי לצמצם נפח של פחות מ 5 מ"ל.
    9. החל את חלבון rBC1531 מרוכזים בעמודה SEC ולאסוף 60 שברים eluted ב 0.5 מ"ל לכל צינור 13 .
    10. קח 15 μL של כל חלק, להפעיל אותם על SDS-PAGE 15%, ו staiN ג 'ל באמצעות תמיסת מכתים קומאסי (0.15% (w / v) קומאסי כחול מבריק, 40% (v / v) מתנול, ו 10% (v / v) חומצה אצטית קרחוני) כמתואר 10 .
    11. פיפטה שברים המכילים rBC1531 ולאסוף אותם בצינור אחד.

2. התגבשות הקרנה ואופטימיזציה של rBC1531

  1. תנאי הקרנה עבור התגבשות חלבון rBC1531
    1. לרכז את rBC1531 משלב 1.4.11 עד ~ 18.5 מ"ג / מ"ל ​​באמצעות צינור מסנן צנטריפוגלי, כמתואר בשלב 1.4.8.
    2. הוסף 50 μL של פתרון התגבשות כל התגבשות (ראה סעיף 2.2) 14 בארות של 96-היטב יושב טיפות התגבשות. מקום 0.5 μL של 18.5 מ"ג / מ"ל ​​פתרון חלבון rBC1531 על מיטת ישיבה. מערבבים את פתרון החלבון עם 0.5 μL של פתרון טוב, חוזר על התהליך עבור הצלחת כולה.
    3. מכסים את הצלחת עם סרט דבק ברור.מניחים את צלחות 96 גם על 18 מעלות צלזיוס ולאפשר דיפוזיה אדי.
    4. סרוק את הטיפות בהגדלה 20-40X באמצעות מיקרוסקופ אור כדי לפקח על היווצרות קריסטל מדי יום במשך 2-3 שבועות.
    5. איסוף נתונים עקיפה רנטגן 12 באמצעות גבישים חלבון rBC1531 שהתקבלו.
  2. אופטימיזציה של התנאים rBC1531 התגבשות
    1. הכן 500 μL של הפתרון התגבשות הראשונית שנבחרה במצב ( למשל, 0.1 C נתרן Cacodylate, pH 6.5 ו 1.0 M ציטרט ציטראט) ולמלא צלחת התגבשות 24 גם לירידה טיפה.
    2. הוסף 0.5 μL של 18.5 מ"ג / מ"ל ​​פתרון חלבון rBC1531 למיטה יושבת, לערבב עם 0.5 μL של פתרון טוב, לכסות את הצלחת מיד עם סרט דבק ברור. מניחים את הצלחת על 18 מעלות צלזיוס.
    3. לצפות צמיחה גביש תחת מיקרוסקופ אור במשך שבוע.
    4. לייעל את התנאים התגבשות שונים על ידי שינוי ה- pH ( כלומר., PH 5.5-6.8) של 0.1 m cacodylate ו על ידי שינוי ריכוז המלח ( כלומר, 0.9-1.2 M) של ציטרט נתרן כדי להשיג גבישים בודדים. צג הצמיחה גביש ~ 1 בשבוע ולאסוף נתונים עקיפה X- רנטגן 12 .

3. אפיון של Triphosphatase Nucleoside (NTPase) פעילות של rBC1531

  1. ואלידציה של מחקר קולורימטרי המבוסס על פוספט אי-אורגני
    1. הכן מלאי של pyrophosphate (100 מ"מ) ו לדלל אותו לריכוז הסופי של 0.1, 0.25, 0.5, 1.0, 5.0, 10, 50, 100, ו 250 מיקרומטר μL 200 של חיץ התגובה (20 מ"מ HEPES, pH 7.4; 150 MM NaCl, ו 2 מ"מ MgCl 2 ) לשכפל 96 צלחות היטב. השתמש בצלחת הראשונה כביקורת (זה אינו מכיל pyrophosphatase). ודא כי הצלחת השנייה מכילה pyrophosphatase כצלחת עובד, בהתאם להוראות בשלב 3.1.2.
    2. הוסף 0.01 יחידה של Saccharomyces cerevisiae p אורגנייםYrophosphatase (1 μL) על הבארות של צלחת עובד ו דגירה על 20 מעלות צלזיוס למשך 30-60 דקות.
    3. הכן תמיסת חומצה molybdate על ידי ערבוב molybdate אמוניום (0.86% v / v) ו חומצה אסקורבית (14% v / v) פתרונות ביחס של 7: 3. הוסף 16 μL של תמיסת חומצה מוליבדט לשני בארות עבודה ובקרה לחכות 15 דקות.
    4. קרא את הצפיפות האופטית ב 690 ננומטר (OD 690nm ).
  2. Assay NTPase
    1. הכנת מלאי של 100 מ"מ nucleoside triphosphate (NTP) המצע לדלל את הריכוז הרצוי ( למשל, 0, 0.2, 4.4, 11, 22, 44, 88, או 132 מיקרומטר) ב μL 180 של חיץ assay (20 מ"מ HEPES, PH 7.4, 150 מ"מ NaCl, ו 2 מ"מ MgCl 2 ).
    2. הוסף 20 מיקרוגרם של rBC1531 (1.5 מ"מ) ואת מצעים NTP מ 3.2.1 עד 200 μL לכל תגובה צלחת 96-היטב פיפטה למעלה ולמטה כדי לערבב היטב. מכסים את הצלחת עם המכסה ומניחים אותו 37 ° C חממה למשך 30 דקותכדי לבצע את התגובה המצע הידרוליזה.
    3. מעבירים את הצלחת לאמבט מים 70 מעלות צלזיוס ומאפשרים לעמוד במשך 15 דקות כדי לעצור את תגובות rBC1531 בתיווך קטליטי.
    4. הוסף 0.01 יחידה של S. cerevisiae pyrophosphatase אנאורגני (1 μL) היטב כל צלחת התגובה (מ 3.2.3 צעד) ו דגירה על 20 מעלות צלזיוס למשך 30 דקות. הוסף 16 μL של תמיסת חומצה מוליבדט לצלחת תגובה לפתח את הצבע (~ 15 דקות). קרא ב OD 690nm .
    5. ניתוח באמצעות משוואת Michaelis-Menten, כמתואר 12 .

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

אפיון של חלבון העניין במחקר זה החל על ידי הכנת כמות מספקת של רקומביננטי B. B. creus bc1531 (rBC1531) חלבון, רצוי יותר ממספר מיליגרם. קטע ה- DNA המקודד את החלבון BC1531 הוכן על ידי PCR באמצעות הדנ"א הגנומי של B. cereus כתבנית, שכן הוא מכיל גנים אורתולוגים זהים ba1554 . RBC1531 היה overexpressed כמו חלבון מסיס בתאי E. coli . חלבון rBC1531 באה לידי ביטוי עם תג 6x-Histidine ואת אתר thrombin מחשוף ב N- מסוף 12 שלה . כצעד ראשון של טיהור, rBC1531 היה מטוהרים על ידי כרומטוגרפיה זיקה ניקל ( איור 1 א ). לאחר מכן, ניסוי עיכול thrombin בוצע כדי לקבוע את הכמות הנמוכה ביותר של thrombin נדרש לעיכול המלא של תג זיקה מ rBC1531 ( איור 1 א ). בידיים שלנו, 0.3 יחידות של טרומבין היה sufכדי להסיר לחלוטין את תג הזיקה מ rBC1531. לכן, כאשר קנה המידה, 10 מ"ג של rBC1531 טופל עם 60 יחידות של thrombin להסרת תג. לאחר עיכול thrombin, RBC1531 ללא תגים הוחל על עמודה SEC כדי להסיר כל אגרגטים מסיסים ומזהמים במשקל נמוך או נמוך יותר מולקולרי. שברי rBC1531 נותחו על ידי SDS-PAGE, תוצאות אשר הציע כי rBC1531 היה ~ 99% טהור ( איור 1 א ). בסך הכל, 1 L של התרבות הניב ~ 8 מ"ג של חלבון rBC1531.

כדי להעריך את מצב אוליגומרי של rBC1531, SEC בוצעה. עקומת ליניארית סטנדרטי כי בקורלציה ערך היומן של המשקולות המולקולריים של דגימות עם כרכים elution המקביל שלהם זממו באמצעות פסגות של תקנים חלבון ( איור 1 ב ). RBC1531 היה eluted בנפח elution של 84 מ"ל ~, ואת המשקל המולקולרי לכאורה שלה נאמד כ ~ 55 kDa. בהתחשב בכך מולקולרית מחושב לנוIght של מונומר rBC1531 הוא ~ 13 kDa, תוצאות אלה מצביעים על כך rBC1531 הרכבה כמו tetramer.

מטוהרים rBC1531 הוקרן עבור התגבשות באמצעות ~ 400 תנאים בשיטת ירידה דיפוזיה קיטור. הגבישים rBC1531 הופיעו ב ~ 2 ימים בשני תנאים: תנאי A, 0.1 M ציטרט ציטרט (pH 5.5) ו 20% PEG 3000 ( איור 2 א ) ומצב- B, 0.1 M סודיום cacodylate (pH 6.5) ו 1.0 M נתרן ציטראט ( איור 2 ב ). תנאי הגיבוש היו אופטימליים על ידי שינוי ה- pH (0.1 M ציטרט ציטרט, pH 5.0-6.0) ואת הריכוז של PEG 3000 (18-21% PEG 3000) ממצב A ו על ידי שינוי ה- pH (0.1 M סודיום cacodylate, pH 5.5-6.8) וריכוז מלח (0.9-1.2 מ 'ציטראט ציטראט) ממצב B. פיזור גבישים מתאימים רק עבור מצב B, ואילו הגבישים ממצב - נוטים להיות מבוגר ולא יחיד. תנאי גביש BDiffracted צילומי רנט כדי ברזולוציה של 2.74 Å ( איור 2 ג ) ו שימשו קביעת מבנה rBC1531.

תצפית של תחום MazG משומר בסידרה רצף BA1554 הציע נוכחות של פעילות NTPase מסוגל hydrolyzing NTPs. NTP hydrolysis בדרך כלל מניב diphosphate nucleoside (NDP) ו פוספט אנאורגני (Pi), או nucleoside monophosphate (NMP) ו pyrophosphate (PPI). PPi דורש פעילות pyrophosphatase נוספת להניב Pi. רמות של פי ניתן למדוד ישירות באמצעות מוליבדאט, אשר יוצר מורכבים בצבע כחול עם פי (מוליבדט-פי), כי ניתן לפקח באמצעות צפיפות אופטית באורך גל של 690 ננומטר (OD 690nm ) ( איור 3 א ). במחקר שלנו, לאחר NTP הידרוליזה ידי rBC1531, לא נראה צבע כחול נראה לאחר הוספת מוליבדט ( איור 3 ב ). עם זאת, כאשר pyrophosphatase נוספה RBC1531 בתיווך NTP הידרוליזה rEaction, צבע השתנה כחול עמוק ( איור 3 ב ), המציין כי rBC1531 יש פעילות pyrophosphohydrolase NTP. חלקת של 690nm OD ו ריכוז NTP נותח באמצעות שיטה רגרסיה לא ליניארית כדי לקבוע את הפרמטרים הקינטית ( מקסימום V של 0.75 ו - מ ' של 10 מיקרומטר) עבור האנזים rBC1531 ( איור 3 ג ).

איור 1
איור 1: ניתוח ה- SDS-PAGE וה- chromatography (SEC). ( A ) SDS-PAGE ניתוח של rBC1531. (שמאל) פסגות elution rBC1531 מ chromatography זיקה ניקל (נתיב 2, Ni) ו- SEC (נתיב 3) נותחו יחד עם סטנדרטים חלבון (נתיב 1, שכותרתו kDa). (מימין) ניתוח של עיכול thrombin של rBC1531 להסרת תג זיקה. כמויות של תרומבין הוסיף 50 מיקרוגרם של rBC1531 בתגובות שונות הם indמקושט ביחידות מעל הג'ל. ( ב ) גודל-הדרה כרומטוגרפיה (SEC) ניתוח של rBC1531 ואת הסטנדרטים חלבונים. (שמאל) פרופילים אלוטיון של rBC1531 (כחול) וסטנדרטים (אדום). משקולות מולקולרית של חלבונים סטנדרטיים מוצגים מעל לכל שיא, ב kDa. הצירים האנכיים (y) והאופקי (x) מראים את יחידות הקליטה מילי (mAU ב 280 ננומטר) ואת נפח השמירה (מ"ל), בהתאמה. (מימין) הגודל המולקולרי לכאורה של rBC1531 נאמד באמצעות העלילה ליניארי עבור משקולות מולקולריות, בקנה מידה יומן, ואת כרכים elution של תקני חלבון (R 2 = 0.9934). אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.

איור 2
איור 2: התגבשות ורנטגן עקיפה. ( A ) גבישים rBC1531 ב conditiעל 0.1- M ציטרט ציטרט (pH 5.5) ו 20% PEG 3000. ( B ) גבישים rBC1531 במצב- B, 0.1 מ 'Cacodylate נתרן (pH 6.5) ו 1.0 M ציטרט ציטרט. ראשוני (משמאל) ממוטב (באמצע וימין) גבישים מוצגים. קריסטל rBC1531 מותאם (מימין, 0.35 מ"מ x ~ 0.35 מ"מ x ~ 0.20 מ"מ) שימש עבור עקיפה X- קרן. סולם ברים = 100 מיקרומטר. ( ג ) תמונה רנטגן עקיפה של קריסטל rBC1531 שהושג על קרן PAL BL-7A 12 . החץ מציין נקודה ברזולוציה גבוהה. אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.

איור 3
איור 3: פעילות NTPase. ( א ) היווצרות של מוליבדן- Pi מורכבים תלוי ריכוז פי. צפיפות אופטית ב 690 ננומטר הוא diביציבות קשורה לעלייה ברמות ה- Pi. ציר Y ו- X ציר מייצגים את 690nm OD וריכוז (מיקרומטר) של Pi, בהתאמה. ( ב ) שינויים בצבע על תוספת של pyrophosphatase. בשורה הראשונה של בארות, pyrophosphatase לא נוספה ולא ליצור את פי בצבע כחול קומפלקס. עם זאת, השורה השנייה מורכבת בארות שבו התגובות rBC1531-NTP טופלו עם pyrophosphatase ופיתח צבע כחול. OD 690nm ערכים גדל עם עלייה בריכוזי NTP. ( ג ) מיכאליס- Menten העלילה של תגובות rBC1531-NTP. ציר Y ו- X ציר מייצגים את 690nm OD ריכוז (0-120 מיקרומטר) של מצעים NTP, בהתאמה. סורגי השגיאה מייצגים את סטיית התקן עבור שלושה ניסויים נפרדים. אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

למחברים אין מה לחשוף.

Acknowledgments

מערכי האפקט של קרני הרנטגן נאספו ב- beamline 7A של מעבדת ה- Pohang Accelerator (קוריאה). מחקר זה נתמך על ידי תוכנית המחקר הבסיסי למדע, אשר ניתנה באמצעות הקרן הלאומית למחקר של קוריאה (NRF), הממומנת על ידי משרד המדע, ICT & תכנון עתידי (2015R1A1A01057574 ל- MH).

Materials

Name Company Catalog Number Comments
Bacillus cereus ATCC14579 Korean Collection for Tissue Culture 3624
Genomic DNA prep kit GeneAll 106-101 Genomic DNA preparation
Forward primer Macrogen GAAGGATCCGGAAGCAAAAA
CGATGAAAGATATGCA
BamHI site is underlined
Reverse primer Macrogen CTTGTCGACTTATTCTTTCTCT
CCCTCATCAATACGTG
SalI site is underlined
nPfu-Forte Enzynomics P410 PCR polymerase
BamHI Enzynomics R003S
SalI Enzynomics R009S
pET49b expression vector Novagen 71463 Expression vector was modified to add affinity tags and BamHI/SalI sites10
T4 DNA ligase Enzynomics M001S
Dialysis memebrane Thermofisher 18265017
Dry block heater JSR JSBL-02T
LB broth (Luria-Bertani) LPS solution LB-05
LB Agar, Miller (Luria-Bertani) Becton, Dickinson and Company
Kanamycin LPS solution KAN025
Mini-prep kit Favorgen FAPDE300 Plasmid DNA preparation
BL21(DE3) Competent cell Novagen 69450-3CN
Isopropyl β-D-1-thiogalactopyranoside (IPTG) Fisher BioReagents 50-213-378
Sodium chloride Daejung 7548-4100 PBS material
Potassium chloride Daejung 6566-4405 PBS material
Potassium phosphate Bio Basic Inc PB0445 PBS material
Sodium phosphate Bio Basic Inc S0404 PBS material
Imidazole Bio Basic Inc IB0277
Sonicator Sonics VCX 130
Ni-NTA agaros Qiagen 30210 Nickel bead
Rotator Finepcr AG
Precision Plus Protein Dual Color Standards Bio-rad 1610374 SDS-PAGE protein standard
Coonmassie Brilliant Blue R-250 Fisher BioReagents BP101-25 Coomassie staining solution
Methyl alcohol Samchun chemical M0585 Coomassie staining solution
Acetic acid Daejung 1002-4105 Coomassie staining solution
Dialysis memebrane Thermofisher 68035
2-Mercaptoethanol Sigma-aldrich M6250
Thrombin Merckmillipore 605157-1KUCN Prepare aliquots of 20 μL (1 Unit per μL) and store at 70 °C and thaw before use
Superdex 200 16/600 General Electric 28989335 Size exclusion chromatography
Gel filtration standard Bio-rad 151-1901
Centrifugal filter Amicon UFC800396
Crystralization plates Hampton research HR3-083 96-well sitting drop plate
The JCSG core suite I-IV Qiagen 130924-130927 Crystallization secreening solution
Microscope Nikon SMZ745T
Cryschem plates Hampton research HR3-158 24-well sitting drop plate
Inorganic pyrophosphatase Sigma 10108987001
Ammonium molybdate solution Sigma 13106-76-8
L-ascorbic acid Sigma 50-81-7
NTP substrate Startagene 200415-51
Spectrophotometer Biotek SynergyH1 microplate reader
GraphPad Prism 5 GraphPad Prism 5 for Window

DOWNLOAD MATERIALS LIST

References

  1. Ivanova, N., et al. Genome sequence of Bacillus cereus and comparative analysis with Bacillus anthracis. Nature. 423, 87-91 (2003).
  2. Spencer, R. C. Bacillus anthracis. J Clin Pathol. 56, 182-187 (2003).
  3. Deli, A., et al. LmbE proteins from Bacillus cereus are de-N-acetylases with broad substrate specificity and are highly similar to proteins in Bacillus anthracis. FEBS J. 277, 2740-2753 (2010).
  4. Gross, M., Marianovsky, I., Glaser, G. MazG -- a regulator of programmed cell death in Escherichia coli. Mol Microbiol. 59, 590-601 (2006).
  5. Galperin, M. Y., Moroz, O. V., Wilson, K. S., Murzin, A. G. House cleaning, a part of good housekeeping. Mol Microbiol. 59, 5-19 (2006).
  6. Lee, S., et al. Crystal structure of Escherichia coli MazG, the regulator of nutritional stress response. J Biol Chem. 283, 15232-15240 (2008).
  7. Moroz, O. V., et al. Dimeric dUTPases, HisE, and MazG belong to a new superfamily of all-alpha NTP pyrophosphohydrolases with potential "house-cleaning" functions. J Mol Biol. 347, 243-255 (2005).
  8. Robinson, A., et al. A putative house-cleaning enzyme encoded within an integron array: 1.8 A crystal structure defines a new MazG subtype. Mol Microbiol. 66, 610-621 (2007).
  9. Moroz, O. V., et al. The crystal structure of a complex of Campylobacter jejuni dUTPase with substrate analogue sheds light on the mechanism and suggests the "basic module" for dimeric d(C/U)TPases. J Mol Biol. 342, 1583-1597 (2004).
  10. Green, M., Sambrook, J. Molecular cloning: A laboratory Manual. 1, John Inglis. (2012).
  11. Brown, T. A. Gene cloning an introduction. Chapman & Hall. (1986).
  12. Kim, M. I., Hong, M. Crystal structure of the Bacillus-conserved MazG protein, a nucleotide pyrophosphohydrolase. Biochem Biophys Res Commun. 472, 237-242 (2016).
  13. Sheehan, D. Physical biochemistry: Principles and applications. A John Wiley & Sons. (2009).
  14. Lesley, S. A., Wilson, I. A. Protein production and crystallization at the joint center for structural genomics. J Struct Funct Genomics. 6, 71-79 (2005).
  15. Jeon, Y. J., et al. Structural and biochemical characterization of bacterial YpgQ protein reveals a metal-dependent nucleotide pyrophosphohydrolase. J Struct Biol. 195, 113-122 (2016).
ביטוי חלבון רקומביננטי, התגבשות, מחקרים ביופיסיקליים של א<em&gt; Bacillus</em&gt; -שמר Nucleotide Pyrophosphorylase, BcMazG
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Kim, M. I., Lee, C., Hong, M. Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG. J. Vis. Exp. (123), e55576, doi:10.3791/55576 (2017).More

Kim, M. I., Lee, C., Hong, M. Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG. J. Vis. Exp. (123), e55576, doi:10.3791/55576 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter