Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biochemistry

Recombinant Proteïne Expressie, Kristallisatie en Biofysische Studies van a doi: 10.3791/55576 Published: May 16, 2017

Summary

Bacillus anthracis is het verplichte pathogeen van dodelijke inhalatie miltbrand, zodat studies van zijn genen en eiwitten strikt gereguleerd zijn. Een alternatieve benadering is het bestuderen van orthologische genen. We beschrijven biofysicochemische studies van een B. anthracis ortholog in B. cereus , bc1531, die minimale experimentele apparatuur vereisen en ernstige veiligheidsproblemen ontbreken.

Abstract

Om veiligheidsbeperkingen en -regulaties te overwinnen bij het bestuderen van genen en eiwitten van echte pathogenen, kunnen hun homologen worden bestudeerd. Bacillus anthracis is een verplicht pathogeen dat dodelijke inhalatie miltbrand veroorzaakt. Bacillus cereus wordt beschouwd als een bruikbaar model voor het bestuderen van B. anthracis door zijn nauwe evolutionaire relatie. De gencluster ba1554 - ba1558 van B. anthracis wordt sterk bewaard met het bc1531 - bc1535 cluster in B. cereus , evenals met het bt1364-bt1368 cluster in Bacillus thuringiensis, wat de kritische rol van de geassocieerde genen in het Bacillus genus aangeeft. Dit manuscript beschrijft methoden voor het bereiden en karakteriseren van een eiwitproduct van het eerste gen ( ba1554 ) van het gencluster in B. anthracis met behulp van een recombinant eiwit van zijn ortholoog in B. cereus , bc1531.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Recombinant eiwit expressie wordt veel gebruikt om problemen die verband houden met natuurlijke eiwitbronnen, zoals beperkte eiwithoeveelheden en schadelijke verontreiniging te overwinnen. Bovendien kan bij studies van pathogene genen en eiwitten een alternatieve laboratoriumstam die geen aanvullende veiligheidsmaatregelen vereist, worden gebruikt. Bacillus cereus is bijvoorbeeld een bruikbaar model voor het bestuderen van Bacillus anthracis door hun nauwe evolutionaire relatie 1 .

B. anthracis is een verplicht pathogeen dat dodelijke inademende miltvuur veroorzaakt bij mensen en vee en kan potentieel als bioweapon worden gebruikt 2 . Zo worden laboratoriumstudies op B. anthracis strikt gereguleerd door de Amerikaanse Centers for Disease Control, waarbij biosafety niveau 3 (BSL-3) praktijken vereist worden, waarbij wordt bepaald dat het laboratoriumgebied gescheiden wordt met negatieve kamerdruk. In tegenstelling tot B. anthracis B. cereus is gecategoriseerd als een BSL-1-agent en heeft derhalve minimale veiligheidskwesties. B. cereus is een opportunistisch pathogeen dat bij infectie voedselvergiftiging veroorzaakt die zonder medische hulp kan worden behandeld. Aangezien B. cereus veel kritische genen deelt met B. anthracis , kunnen de functies van B. anthracis eiwitten worden bestudeerd onder toepassing van de bijbehorende homologen van B. cereus 1 .

De ba1554 - ba1558 gencluster van B. anthracis is sterk bewaard met het bc1531 - bc1535 cluster Van B. cereus , evenals met het bt1364-bt1368 cluster van Bacillus thuringiensis , in termen van genorganisatie en sequentie. Bovendien zijn de eerste genen ( ba1554 , bc1531 en bt1364 ) van de respectieve clusters absoluut behouden ( dwz 100% nucleotide sequentie identiteit), implicietNg een kritische rol van het genproduct in de Bacillus- soort. Vanwege de ligging in deze genclusters was ba1554 verkeerd geïdentificeerd als een vermoedelijke transcriptie regelaar 3 . Echter, aminozuursequentie analyse van het ba1554 product geeft aan dat het behoort tot de MazG familie, die nucleotide pyrofoshydrolase activiteit heeft en niet geassocieerd wordt met transcriptiefactor activiteit 4 , 5 . Hoewel eiwitten die behoren tot de MazG-familie verschillend zijn met betrekking tot de totale sequentie en lengte, delen ze een gemeenschappelijk MazG-domein van 100 resten, gekenmerkt door een EXXE 12-28 EXXD-motief ("X" staat voor elk aminozuurresidu en het getal Geeft het aantal X residuen aan).

Het MazG domein vertoont niet altijd direct een bepaalde katalytische activiteit. Een MazG lid van Escherichia coli (EcMazG) bezit twee MazG domeinen, maar opHet C-terminale MazG-domein is enzymatisch actief 6 . Bovendien varieert de substraat specificiteit van MazG enzymen van niet-specifieke nucleoside trifosfaten (voor EcMazG) naar specifieke dCTP / dATP (voor integrin-geassocieerde MazG) en dUTP (voor dUTPases) 6 , 7 , 8 , 9 . Daarom zijn biofysicochemische analyses van het BA1554-eiwit nodig om zijn NTPase-activiteit te bevestigen en zijn substraatspecificiteit te ontcijferen.

Hier geven we een stap-voor-stap protocol dat de meeste laboratoria zonder een BSL-3-faciliteit kunnen volgen om het eiwitproduct van het B. cereus bc1531- gen te karakteriseren , dat is een ortholoog van B. anthracis ba1554 , op het moleculaire niveau. In het kort werd recombinant BC1531 (rBC1531) uitgedrukt in E. coli en gezuiverd met behulp van een affiniteitstabel. Voor röntgenkristallografische experimenten, de kristallijZation voorwaarden van het rBC1531 eiwit werden gescreend en geoptimaliseerd. Om de enzymatische activiteit van rBC1531 te beoordelen, werd de NTPase-activiteit kleurimetrisch gecontroleerd om radioactief gemerkte nucleotiden die conventioneel zijn gebruikt te vermijden. Tenslotte maakten analyses van de verkregen biofysicochemische gegevens ons de oligomerisatietoestand en de katalytische parameters van rBC1531 mogelijk, evenals om röntgendiffractiedata van het rBC1531 kristal te verkrijgen.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Recombinant eiwitproductie en zuivering van rBC1531

  1. Bereiding van een recombinant BC1531 eiwit (rBC1531) -expressie plasmide
    1. Bereid het genomisch DNA van B. cereus 10 op .
    2. Versterk het bc1531- gen uit een sjabloon van B. cereus genomisch DNA door polymerase kettingreactie (PCR), met behulp van voorwaartse en omgekeerde primers (zie de Materials List) om respectievelijk 10 Bam HI- en Sal I-restrictie-enzymplaatsen te creëren.
    3. Digest het PCR-product en een gemodificeerde pET49b-vector (pET49bm) onder gebruikmaking van Bam HI en Sal I, zoals beschreven 11 .
    4. Meng het verteerde PCR-product en vector (3: 1 verhouding) van stap 1.1.3 met behulp van T4 DNA ligase in een 10 μl reactie, zoals beschreven 11 . Incubeer bij 30 ° C bij 18 ° C.
    5. Pipetteer 3 μL van de ligeringsreactie in 50 μl chemicaLly bevoegde E. coli DH5a cellen in een buis. Meng zachtjes door pipettering omhoog en omlaag en plaats 30 minuten op ijs. Warmte schok gedurende 45 s bij 42 ° C. Voeg 1 ml Luria-Bertani (LB) medium toe en groei de cellen terwijl u krachtig schudt (250 rpm, 37 ° C, 45 min).
    6. Neem 100 μL van de getransformeerde cellen uit stap 1.1.6 en verspreid ze op de LB-agarplaten met 100 μg / ml kanamycine (Kan). Incubeer gedurende ~ 18 uur bij 37 ° C.
    7. Kies kolonies met behulp van een steriele punt en groei de cellen in 3 ml LB medium met 100 μg / ml Kan; Schud krachtig (250 rpm, 37 ° C, 18 uur).
    8. Bereid plasmide-DNA op met behulp van een alkalische-SDS lysis methode, zoals beschreven 10 .
    9. Bevestig de nucleotidesequentie van het rBC1531-expressieconstruct met behulp van DNA sequentiebepaling 12 .
  2. Overexpressie van het rBC1531 eiwit
    1. Re-transformeer de E. coli BL21 (DE3) stam met rBC1531-expRonde plasmide, zoals beschreven in stappen 1.1.5-1.1.6, voor overexpressie.
    2. Selecteer een kolonie en groei het in 10 ml LB-medium dat 50 μg / ml Kan (LB + Kan) bevat; Schud krachtig gedurende 18 uur bij 37 ° C.
    3. Inoculeer 10 ml nachtcultuur in 1 L LB + Kan-medium en groei bij 37 ° C tot de OD 600 (optische dichtheid bij 600 nm) bereikt ~ 0,7.
    4. Onderdompel de cultuur in ijskoud water gedurende ~ 15 min om de temperatuur af te koelen tot 18 ° C en voeg isopropyl β-D-1-thiogalactopyranoside (IPTG) toe aan de kweek bij een uiteindelijke concentratie van 1 mM voor recombinant eiwituitdrukking. Vergroot de cultuur bij 18 ° C gedurende een extra ~ 16-18 uur.
  3. Zuivering van rBC1531
    1. Oog de cellen door centrifugeren (5.000 xg, 4 ° C, 30 min). Gooi de supernatant voorzichtig weg om de cellen niet te storen. De cellen opnieuw opschorten in 50 ml fosfaatgebufferde zoutoplossing (PBS) oplossing die 10 mM imidazool bevat.
    2. Lyse de cellen twee keer door sonicatie op ijs om de oververhitting van de cellysaten te voorkomen (tijd: 2 min 30 s; cyclus op: 5 s; fiets uit: 10 s; amplitude: 38%).
    3. Verwijder het cellysaat door centrifugeren (~ 25.000 xg, 4 ° C, 30 min).
    4. Meng 3 ml nikkelkralen en 60 ml PBS die 10 mM imidazool bevatten en zwaartekrachtstroom de extra buffer om de geëquilibreerde nikkelkralen in een 2,5 x 10 cm glazen chromatografie kolom af te lossen.
    5. Pipet om de supernatant van stap 1.3.3 naar de kolom over te brengen met voorgeëquilibreerde nikkelkralen en gedurende 2 uur bij 4 ° C bij een spoedwiel bij een lage snelheid (~ 20 rpm) incuberen.
    6. Laat het supernatant door de zwaartekracht afvoeren en de nikkelkrullen in de kolom drie keer wassen met 100 ml PBS die 10 mM imidazool bevat.
    7. Verwijder rBC1531 eiwit door 4 x 5 ml PBS te gebruiken die 250 mM imidazool bevat.
    8. Neem 15 μl van de elutie uit stap 1.3.7 en laat het op 15% SDS-PAGE lopen. Visualiseer de eiwitbanden opDe gel met behulp van Coomassie blue staining 10 .
  4. Verwijdering van de affiniteits tags van het rBC1531 eiwit door trombine proteolyse
    1. Pipetteer de fracties in de dialysebuis (molecuulgewicht afgesneden: 3 kDa) en plaats de buis in een beker die 4 L trombine-splitsings-compatibele buffer bevat (20 mM HEPES, pH 7,4, 150 mM NaCl en 1,5 mM P-mercaptoethanol) Bij 4 ° C overnacht.
    2. Pipetteer de fracties en breng ze over naar een conische buis.
    3. Meet de absorptie bij 280 nm en schat de rBC1531 eiwitconcentratie, zoals beschreven 13 .
    4. Neem 50 μg rBC1531 in een 0,5 ml buis en voeg verschillende hoeveelheden trombine toe ( dwz 2, 1, 0,6 en 0,3 eenheden). Incubeer de rBC1531 en trombine reacties bij 20 ° C gedurende ~ 3 uur om de minste hoeveelheid trombine te bepalen die nodig is om de N-terminale affiniteitstik te splitsen.
    5. Voer de rBC1531 en trombine reacties op een 15%SDS-PAGE en bepaal de laagste hoeveelheid trombine ( bijv. 0,3 eenheden trombine per 50 μg rBC1531) die de N-terminale affiniteitstabel volledig verteert en een tag-free rBC1531 produceren.
    6. Voeg 10 mg rBC1531 eiwit en 60 eenheden trombine toe aan een 15 ml buis en incubeer bij ~ 3 uur bij 20 ° C voor de trombine-proteolyse reactie.
    7. Breng gel-filtratienormen aan op een kolom met grootte-uitsluiting chromatografie (SEC) om een ​​standaardkromme van molecuulgewichten en elueringsvolumes te bereiden, zoals beschreven 13 .
    8. Plaats het trombine verteerde rBC1531 eiwit uit stap 1.4.6 in een centrifugale filterbuis (molecuulgewicht afgesneden: 3 kDa) en centrifuge bij 3.000 g bij 4 ° C om te reduceren tot een volume van minder dan 5 ml.
    9. Breng het geconcentreerde rBC1531-eiwit aan op de SEC-kolom en geef 60 geëlueerde fracties in 0,5 ml per buis 13 .
    10. Neem 15 μL van elke fractie, voer ze op een 15% SDS-PAGE en staiN de gel met behulp van Coomassie-kleuroplossing (0,15% (w / v) Coomassie brilliant blue, 40% (v / v) methanol en 10% (v / v ijsazijn) zoals beschreven 10 .
    11. Pipetteer de fracties die rBC1531 bevatten en verzamelen ze in een buis.

2. Kristallisatie Screening en Optimalisatie van rBC1531

  1. Screeningsomstandigheden voor rBC1531 proteïne kristallisatie
    1. Concentreer de rBC1531 van stap 1.4.11 tot ~ 18.5 mg / ml met behulp van een centrifugaalfilterbuis, zoals beschreven in stap 1.4.8.
    2. Voeg 50 μl van elke kristallisatie-screeningsoplossing (zie sectie 2.2) 14 toe aan de putten van kristallisatieplaten met 96 putjes. Plaats 0,5 μl van de 18,5 mg / ml rBC1531 eiwitoplossing op een zitbank. Meng de eiwitoplossing met 0,5 μl van de putoplossing en herhaal het proces voor de gehele plaat.
    3. Bedek de plaat met een heldere lijmfolie.Plaats de 96-putjesplaten bij 18 ° C en laat dampdiffusie toe.
    4. Scan de druppels bij 20-40X vergroting met een lichtmicroscoop om de kristalvorming dagelijks gedurende 2-3 weken te controleren.
    5. Verzamel röntgendiffractiedata 12 met behulp van de verkregen rBC1531 proteïne kristallen.
  2. Optimalisatie van rBC1531 kristallisatie condities
    1. Bereid 500 μL van de geselecteerde initiële kristallisatie conditie oplossing ( bijv. 0,1 M natriumcacodylaat, pH 6,5 en 1,0 M natriumcitraat) en vul een 24-putjes kristallisatieplaat voor de zittingdruppel.
    2. Voeg 0,5 μl van de 18,5 mg / mL rBC1531 eiwitoplossing toe aan een zitbank, meng met 0,5 μL van de putoplossing en bedek de plaat onmiddellijk met een heldere lijmfolie. Leg de plaat bij 18 ° C.
    3. Volg de kristalgroei gedurende een week onder een lichtmicroscoop.
    4. Optimaliseer verschillende kristallisatieomstandigheden door de pH te variëren ( dwz., PH 5,5-6,8) van 0,1 M cacodylaat en door het veranderen van de zoutconcentratie ( dat wil zeggen 0,9-1,2 M) natriumcitraat om enkelvoudige kristallen te verkrijgen. Monitor kristalgroei gedurende ~ 1 week en verzamel röntgendiffractiedata 12 .

3. Karakterisering van de nucleoside triphosphatase (NTPase) Activiteit van rBC1531

  1. Validatie van het anorganische fosfaatafhankelijke colorimetrische onderzoek
    1. Bereid een voorraad pyrofosfaat (100 mM) op en verdun deze tot de uiteindelijke concentraties van 0,1, 0,25, 0,5, 1,0, 5,0, 10, 50, 100 en 250 μM in 200 μl reactiebuffer (20 mM HEPES, pH 7,4; 150 MM NaCl en 2 mM MgCl2) in duplicaatplaten met 96 putjes. Gebruik de eerste plaat als controle (dit bevat geen pyrofosfatase). Zorg ervoor dat de tweede plaat pyrofosfatase bevat als werkplaat, zoals aangegeven in stap 3.1.2.
    2. Voeg 0,01 eenheid Saccharomyces cerevisiae anorganische pYrofosfatase (1 μl) aan de putten van de werkplaat en incubeer bij 20 ° C gedurende 30-60 minuten.
    3. Bereid de molybdaatzuuroplossing door mengsels van ammoniummolybdaat (0,86% v / v) en ascorbinezuur (14% v / v) oplossingen in een 7: 3-verhouding. Voeg 16 μL molybdaatzuuroplossing toe aan zowel de werk- en controlebronnen en wacht gedurende 15 minuten.
    4. Lees de optische dichtheid bij 690 nm (OD 690nm ).
  2. Colorimetrische NTPase-analyse
    1. Bereid een voorraad van 100 mM nucleoside trifosfaat (NTP) substraat op en verdun tot de gewenste concentratie ( bijv. 0, 0,2, 4,4, 11,22,44,88 of 132 μM) in 180 μl assaybuffer (20 mM HEPES, PH 7,4, 150 mM NaCl en 2 mM MgCl2).
    2. Voeg 20 μg rBC1531 (1,5 mM) toe en de NTP substrates van stap 3.2.1 tot 200 μl per reactie in een 96-putjesplaat en pipette omhoog en omlaag om goed te mengen. Bedek de plaat met deksel en plaats deze in een 37 ° C incubator gedurende 30 minutenOm de substraathydrolyse reactie uit te voeren.
    3. Breng de plaat over op een waterbad van 70 ° C en laat het gedurende 15 minuten staan ​​om rBC1531-gemedieerde katalytische reacties te stoppen.
    4. Voeg 0,01 eenheid S. cerevisiae anorganische pyrofosfatase (1 μL) toe aan elke bron van de reactieplaat (uit stap 3.2.3) en incubeer bij 20 ° C gedurende 30 minuten. Voeg 16 μL molybdaatzuuroplossing toe aan de reactieplaat om de kleur te ontwikkelen (~ 15 min). Lees bij OD 690nm .
    5. Analyseer met behulp van de Michaelis-Menten vergelijking, zoals beschreven 12 .

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Karakterisering van het eiwit van belang in deze studie begon door het bereiden van een voldoende hoeveelheid recombinant B. cereus bc1531 (rBC1531) eiwit, bij voorkeur meer dan meerdere milligram. Het DNA fragment dat codeert voor het BC1531 eiwit werd bereid door PCR met behulp van het genomische DNA van B. cereus als een sjabloon, omdat het orthologische genen identiek aan ba1554 bevat . RBC1531 werd overexpresseerd als een oplosbaar eiwit in E. coli cellen. Het rBC1531 eiwit werd uitgedrukt met een 6x-Histidine tag en een trombine splitsingsplaats bij zijn N-terminus 12 . Als een eerste stap van zuivering werd rBC1531 gezuiverd door nikkel-affiniteitschromatografie ( Figuur 1A ). Vervolgens werd een trombine digestie trial uitgevoerd om de laagste hoeveelheid trombine te bepalen die nodig is voor de volledige vertering van de affiniteitstabel van rBC1531 ( Figuur 1A ). In onze handen was 0,3 eenheden trombine sufHet is ficient om de affiniteitstabel van rBC1531 volledig te verwijderen. Bij het schalen werd 10 mg rBC1531 dus behandeld met 60 eenheden trombine voor het verwijderen van de tag. Na trombine digestie werd de tag-free rBC1531 aangebracht op een SEC kolom om eventuele oplosbare aggregaten en verontreinigingen met een hoger of minder molecuulgewicht te verwijderen. De rBC1531 fracties werden geanalyseerd door SDS-PAGE, waarvan de resultaten suggereerden dat rBC1531 ~ 99% zuiver was ( Figuur 1A ). In totaal leverde 1 liter cultuur ~ 8 mg rBC1531 eiwit.

Om de oligomere status van rBC1531 te schatten, werd SEC uitgevoerd. Een standaard lineaire curve die de logwaarde van de molecuulgewichten van de monsters met hun bijbehorende elutievolumes correleren werd geplot met gebruikmaking van de pieken van de eiwitstandaarden ( Figuur 1B ). RBC1531 werd geëlueerd bij een elutie volume van ~ 84 ml en het schijnbare molecuulgewicht werd geschat als ~ 55 kDa. Gezien de berekende moleculaire weIght van het rBC1531 monomeer is ~ 13 kDa, deze resultaten geven aan dat rBC1531 als tetramer assembleert.

Gezuiverd rBC1531 werd gescreend voor kristallisatie onder gebruikmaking van ~ 400 omstandigheden in een zithoudende dampdiffusie werkwijze. De rBC1531 kristallen verschijnen in 2 dagen bij twee omstandigheden: conditie A, 0,1 M natriumcitraat (pH 5,5) en 20% PEG 3000 ( Figuur 2A ) en conditie B, 0,1 M natriumcacodylaat (pH 6,5) en 1,0 M natrium Citraat ( Figuur 2B ). De kristallisatieomstandigheden werden geoptimaliseerd door de pH (0,1 M natriumcitraat, pH 5,0-6,0) te variëren en de concentratie van PEG 3000 (18-21% PEG 3000) van conditie A en door de pH (0,1 M natriumcacodylaat, pH te wijzigen 5,5-6,8) en zoutconcentratie (0,9-1,2 M natriumcitraat) uit conditie-B. Diffractie-geschikte kristallen werden alleen verkregen voor conditie-B, terwijl de kristallen uit conditie-A geneigd waren te worden gekweekt in plaats van enkelvoudig. Condition-B kristallenDiffractaire röntgenstralen tot een resolutie van 2,74 Å ( Figuur 2C ) en werden gebruikt voor de bepaling van rBC1531 structuur.

De observatie van een geconserveerd MazG domein in de BA1554 eiwit sequentie gaf de aanwezigheid van NTPase activiteit aan die in staat was NTP's te hydrolyseren. NTP hydrolyse levert in het algemeen nucleoside difosfaat (NDP) en anorganisch fosfaat (Pi), of nucleoside monofosfaat (NMP) en pyrofosfaat (PPi). PPi vereist extra pyrofosfatase activiteit om Pi te geven. Niveaus van Pi kunnen direct gemeten worden met behulp van molybdaat, dat een blauwgekleurd complex vormt met Pi (molybdaat-Pi) die kan worden gecontroleerd met behulp van de optische dichtheid bij een golflengte van 690 nm (OD 690 nm) ( Figuur 3A ). In onze studie, na NTP hydrolyse door rBC1531, werd geen zichtbare blauwe kleur geproduceerd na het toevoegen van molybdaat ( Figuur 3B ). Echter, wanneer pyrofosfatase werd toegevoegd aan de rBC1531-gemedieerde NTP hydrolyse rEactie, de kleur veranderde naar diepblauw ( Figuur 3B ), wat aangeeft dat rBC1531 NTP pyrofoshydrolase activiteit heeft. Een grafiek van de OD 690nm en NTP concentratie werd geanalyseerd met behulp van een niet-lineaire regressie methode om de kinetische parameters (V max van 0,75 en K m van 10 μM) voor het rBC1531 enzym te bepalen ( Figuur 3C ).

Figuur 1
Figuur 1: SDS-PAGE en size-exclusion chromatography (SEC) analyse. ( A ) SDS-PAGE analyse van rBC1531. (Links) De rBC1531-elutietoppen uit nikkelaffiniteitschromatografie (laan 2, Ni) en SEC (laan 3) werden geanalyseerd samen met eiwitstandaarden (laan 1, gemerkt in kDa). (Rechts) Analyse van de trombine digestie van rBC1531 voor de verwijdering van de affiniteitstag. De hoeveelheden trombine toegevoegd aan 50 μg rBC1531 in verschillende reacties zijn indIjzeren in eenheden boven de gel. ( B ) Analyse van de grootte-uitsluiting chromatografie (SEC) van rBC1531 en de eiwitstandaarden. (Links) Elutieprofielen van rBC1531 (blauw) en normen (rood). Moleculaire gewichten van de standaard eiwitten worden boven elke piek in kDa getoond. De verticale (y) en horizontale (x) assen tonen de milliabsorptie-eenheden (mAU bij 280 nm) en retentievolumes (mL) respectievelijk. (Rechts) De schijnbare moleculaire grootte van rBC1531 werd geschat aan de hand van een lineair plot voor de molecuulgewichten, in de logschaal en elutievolumes van eiwitstandaarden (R2 = 0,9934). Klik hier om een ​​grotere versie van deze figuur te bekijken.

Figuur 2
Figuur 2: Kristallisatie en röntgendiffractie. ( A ) rBC1531 kristallen in conditie0,1 M natriumcitraat (pH 5,5) en 20% PEG 3000. ( B ) rBC1531 kristallen in conditie B, 0,1 M natriumcacodylaat (pH 6,5) en 1,0 M natriumcitraat. Initiële (links) en geoptimaliseerde (midden en rechts) kristallen worden getoond. Het geoptimaliseerde rBC1531 kristal (rechts, ~ 0,35 mm x ~ 0,35 mm x ~ 0,20 mm) werd gebruikt voor röntgendiffractie. Schaalstaven = 100 μm. ( C ) röntgendiffractiebeeld van het rBC1531-kristal verkregen bij de PAL-straallijn BL-7A12. De pijl geeft een hoge resolutie plek aan. Klik hier om een ​​grotere versie van deze figuur te bekijken.

Figuur 3
Figuur 3: NTPase activiteit. ( A ) De vorming van het molybdeen-Pi complex is afhankelijk van Pi concentratie. Optische dichtheid bij 690 nm is diRechtstreeks geassocieerd met toename in Pi-niveaus. De Y-as en X-as vertegenwoordigen respectievelijk de OD 690nm en de concentratie (μM) van Pi. ( B ) Kleur verandert bij toevoeging van pyrofosfatase. In de eerste rij van putten werd pyrofosfatase niet toegevoegd en vormde het blauwkleurige Pi-complex niet. De tweede rij bestaat echter uit putten waarin de rBC1531-NTP reacties werden behandeld met pyrofosfatase en een blauwe kleur ontwikkeld. OD 690nm waarden namen toe met toename in NTP concentraties. ( C ) Michaelis-Menten plot van de rBC1531-NTP reacties. De Y-as en de X-as vertegenwoordigen de OD 690nm en concentratie (0-120 μM) respectievelijk NTP-substraten. De foutbalken staan ​​voor de standaardafwijking voor drie afzonderlijke experimenten. Klik hier om een ​​grotere versie van deze figuur te bekijken.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgments

De röntgendiffractie-datasets werden verzameld bij beamline 7A van het Pohang Accelerator Laboratory (Korea). Deze studie werd ondersteund door het Basic Science Research Programma dat wordt beheerd door de National Research Foundation of Korea (NRF), gefinancierd door het ministerie van wetenschap, ICT & toekomstige planning (2015R1A1A01057574 naar MH).

Materials

Name Company Catalog Number Comments
Bacillus cereus ATCC14579 Korean Collection for Tissue Culture 3624
Genomic DNA prep kit GeneAll 106-101 Genomic DNA preparation
Forward primer Macrogen GAAGGATCCGGAAGCAAAAA
CGATGAAAGATATGCA
BamHI site is underlined
Reverse primer Macrogen CTTGTCGACTTATTCTTTCTCT
CCCTCATCAATACGTG
SalI site is underlined
nPfu-Forte Enzynomics P410 PCR polymerase
BamHI Enzynomics R003S
SalI Enzynomics R009S
pET49b expression vector Novagen 71463 Expression vector was modified to add affinity tags and BamHI/SalI sites10
T4 DNA ligase Enzynomics M001S
Dialysis memebrane Thermofisher 18265017
Dry block heater JSR JSBL-02T
LB broth (Luria-Bertani) LPS solution LB-05
LB Agar, Miller (Luria-Bertani) Becton, Dickinson and Company
Kanamycin LPS solution KAN025
Mini-prep kit Favorgen FAPDE300 Plasmid DNA preparation
BL21(DE3) Competent cell Novagen 69450-3CN
Isopropyl β-D-1-thiogalactopyranoside (IPTG) Fisher BioReagents 50-213-378
Sodium chloride Daejung 7548-4100 PBS material
Potassium chloride Daejung 6566-4405 PBS material
Potassium phosphate Bio Basic Inc PB0445 PBS material
Sodium phosphate Bio Basic Inc S0404 PBS material
Imidazole Bio Basic Inc IB0277
Sonicator Sonics VCX 130
Ni-NTA agaros Qiagen 30210 Nickel bead
Rotator Finepcr AG
Precision Plus Protein Dual Color Standards Bio-rad 1610374 SDS-PAGE protein standard
Coonmassie Brilliant Blue R-250 Fisher BioReagents BP101-25 Coomassie staining solution
Methyl alcohol Samchun chemical M0585 Coomassie staining solution
Acetic acid Daejung 1002-4105 Coomassie staining solution
Dialysis memebrane Thermofisher 68035
2-Mercaptoethanol Sigma-aldrich M6250
Thrombin Merckmillipore 605157-1KUCN Prepare aliquots of 20 μL (1 Unit per μL) and store at 70 °C and thaw before use
Superdex 200 16/600 General Electric 28989335 Size exclusion chromatography
Gel filtration standard Bio-rad 151-1901
Centrifugal filter Amicon UFC800396
Crystralization plates Hampton research HR3-083 96-well sitting drop plate
The JCSG core suite I-IV Qiagen 130924-130927 Crystallization secreening solution
Microscope Nikon SMZ745T
Cryschem plates Hampton research HR3-158 24-well sitting drop plate
Inorganic pyrophosphatase Sigma 10108987001
Ammonium molybdate solution Sigma 13106-76-8
L-ascorbic acid Sigma 50-81-7
NTP substrate Startagene 200415-51
Spectrophotometer Biotek SynergyH1 microplate reader
GraphPad Prism 5 GraphPad Prism 5 for Window

DOWNLOAD MATERIALS LIST

References

  1. Ivanova, N., et al. Genome sequence of Bacillus cereus and comparative analysis with Bacillus anthracis. Nature. 423, 87-91 (2003).
  2. Spencer, R. C. Bacillus anthracis. J Clin Pathol. 56, 182-187 (2003).
  3. Deli, A., et al. LmbE proteins from Bacillus cereus are de-N-acetylases with broad substrate specificity and are highly similar to proteins in Bacillus anthracis. FEBS J. 277, 2740-2753 (2010).
  4. Gross, M., Marianovsky, I., Glaser, G. MazG -- a regulator of programmed cell death in Escherichia coli. Mol Microbiol. 59, 590-601 (2006).
  5. Galperin, M. Y., Moroz, O. V., Wilson, K. S., Murzin, A. G. House cleaning, a part of good housekeeping. Mol Microbiol. 59, 5-19 (2006).
  6. Lee, S., et al. Crystal structure of Escherichia coli MazG, the regulator of nutritional stress response. J Biol Chem. 283, 15232-15240 (2008).
  7. Moroz, O. V., et al. Dimeric dUTPases, HisE, and MazG belong to a new superfamily of all-alpha NTP pyrophosphohydrolases with potential "house-cleaning" functions. J Mol Biol. 347, 243-255 (2005).
  8. Robinson, A., et al. A putative house-cleaning enzyme encoded within an integron array: 1.8 A crystal structure defines a new MazG subtype. Mol Microbiol. 66, 610-621 (2007).
  9. Moroz, O. V., et al. The crystal structure of a complex of Campylobacter jejuni dUTPase with substrate analogue sheds light on the mechanism and suggests the "basic module" for dimeric d(C/U)TPases. J Mol Biol. 342, 1583-1597 (2004).
  10. Green, M., Sambrook, J. Molecular cloning: A laboratory Manual. 1, John Inglis. (2012).
  11. Brown, T. A. Gene cloning an introduction. Chapman & Hall. (1986).
  12. Kim, M. I., Hong, M. Crystal structure of the Bacillus-conserved MazG protein, a nucleotide pyrophosphohydrolase. Biochem Biophys Res Commun. 472, 237-242 (2016).
  13. Sheehan, D. Physical biochemistry: Principles and applications. A John Wiley & Sons. (2009).
  14. Lesley, S. A., Wilson, I. A. Protein production and crystallization at the joint center for structural genomics. J Struct Funct Genomics. 6, 71-79 (2005).
  15. Jeon, Y. J., et al. Structural and biochemical characterization of bacterial YpgQ protein reveals a metal-dependent nucleotide pyrophosphohydrolase. J Struct Biol. 195, 113-122 (2016).
Recombinant Proteïne Expressie, Kristallisatie en Biofysische Studies van a<em&gt; Bacillus</em&gt; -conserveerd nucleotide pyrophosphorylase, BcMazG
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Kim, M. I., Lee, C., Hong, M. Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG. J. Vis. Exp. (123), e55576, doi:10.3791/55576 (2017).More

Kim, M. I., Lee, C., Hong, M. Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG. J. Vis. Exp. (123), e55576, doi:10.3791/55576 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter