Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biochemistry

Expression de protéines recombinantes, cristallisation et études biophysiques d'une doi: 10.3791/55576 Published: May 16, 2017

Summary

Bacillus anthracis est l'agent pathogène obligatoire du charbon inhalatoire fatal, de sorte que les études de ses gènes et de leurs protéines sont strictement réglementées. Une autre approche consiste à étudier les gènes orthologues. Nous décrivons des études biophysicochimiques d'un orthologue de B. anthracis dans B. cereus , bc1531, nécessitant un matériel expérimental minimal et sans problèmes sérieux de sécurité.

Abstract

Pour surmonter les restrictions et les réglementations de sécurité lors de l'étude des gènes et des protéines à partir de pathogènes vrais, leurs homologues peuvent être étudiés. Bacillus anthracis est un agent pathogène obligatoire qui provoque un inhalation d'anthrax mortel. Bacillus cereus est considéré comme un modèle utile pour étudier B. anthracis en raison de sa relation évolutionniste étroite. Le groupe génétique ba1554 - ba1558 de B. anthracis est fortement conservé avec le groupe bc1531 - bc1535 dans B. cereus , ainsi qu'avec le groupe bt1364-bt1368 de Bacillus thuringiensis, indiquant le rôle critique des gènes associés dans le genre Bacillus . Ce manuscrit décrit des méthodes pour préparer et caractériser un produit protéique du premier gène ( ba1554 ) du groupe de gènes de B. anthracis en utilisant une protéine recombinante de son ortholog dans B. cereus , bc1531.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

L'expression de protéines recombinantes est largement utilisée pour surmonter les problèmes associés aux sources de protéines naturelles, telles que des quantités limitées de protéines et une contamination nocive. De plus, dans les études sur les gènes et les protéines pathogènes, une souche de laboratoire alternative qui ne nécessite pas de précautions de sécurité supplémentaires peut être utilisée. Par exemple, Bacillus cereus est un modèle utile pour étudier Bacillus anthracis en raison de leur relation évolutive 1 .

B. anthracis est un agent pathogène obligatoire qui provoque un inhalation d'anthraxs mortels chez l'homme et le bétail et peut potentiellement être utilisé comme bioweapon 2 . Ainsi, les études de laboratoire sur B. anthracis sont strictement réglementées par les Centers for Disease Control des États-Unis, nécessitant des pratiques de biosécurité de niveau 3 (BSL-3), qui exigent que la zone de laboratoire soit séparée par une pression ambiante négative. Contrairement à B. anthracis B. cereus est classé comme un agent BSL-1 et a donc des problèmes de sécurité minimes. B. cereus est un agent pathogène opportuniste qui, lors d'une infection, provoque des intoxications alimentaires qui peuvent être traitées sans assistance médicale. Cependant , parce que B. cereus partage de nombreux gènes critiques avec B. anthracis , les fonctions des protéines de B. anthracis peuvent être étudiées en utilisant les homologues correspondants de B. cereus 1 .

Le groupe de gènes ba1554 - ba1558 de B. anthracis est fortement conservé avec le cluster bc1531 - bc1535 De B. cereus , ainsi qu'avec le groupe bt1364-bt1368 de Bacillus thuringiensis , en termes d'organisation et de séquence de gènes. En outre, les premiers gènes ( ba1554 , bc1531 et bt1364 ) des grappes respectives sont absolument conservés ( c.-à-d., Identité de séquence à 100% de nucleotide), impieUn rôle critique du produit génique dans les espèces de Bacillus . En raison de son emplacement dans ces grappes de gènes, ba1554 a été mal identifié comme un régulateur de transcription putatif 3 . Cependant, l'analyse de la séquence d'acides aminés du produit ba1554 indique qu'il appartient à la famille MazG, qui a une activité nucléotidique pyrophosphohydrolase et n'est pas associée à l'activité 4 , 5 du facteur de transcription. Bien que les protéines appartenant à la famille MazG soient diverses en ce qui concerne la séquence et la longueur globales, elles partagent un domaine MazG ~ 100 résidus commun caractérisé par un motif EXXE 12-28 EXXD ("X" représente tout résidu d'acide aminé et le nombre Indique le nombre de résidus X).

Le domaine MazG ne reflète pas toujours directement une certaine activité catalytique. Un membre MazG d' Escherichia coli (EcMazG) possède deux domaines MazG, mais surLe domaine C-terminal MazG est enzymatiquement actif 6 . De plus, la spécificité du substrat des enzymes MazG varie en fonction des nucléosides triphosphates non spécifiques (pour EcMazG) vers dCTP / dATP spécifique (pour MazG associée à l'intégrine) et dUTP (pour dUTPases) 6 , 7 , 8 , 9 . Par conséquent, des analyses bio-physicochimiques de la protéine BA1554 sont nécessaires pour confirmer son activité NTPase et déchiffrer sa spécificité de substrat.

Ici, nous fournissons un protocole étape par étape que la plupart des laboratoires sans installation de BSL-3 peuvent suivre pour caractériser le produit protéique du gène B. cereus bc1531 , qui est un orthologue de B. anthracis ba1554 , au niveau moléculaire. En bref, BC1531 recombinant (rBC1531) a été exprimé dans E. coli et purifié en utilisant une étiquette d'affinité. Pour les expériences cristallographiques aux rayons X, le cristallisLes conditions de zation de la protéine rBC1531 ont été criblées et optimisées. Pour évaluer l'activité enzymatique du rBC1531, l'activité NTPase a été surveillée colorimétriquement pour éviter les nucléotides marqués par radioactivité qui ont été utilisés classiquement. Enfin, les analyses des données bio-physicochimiques obtenues nous ont permis de déterminer l'état d'oligomérisation et les paramètres catalytiques de RBC1531, ainsi que d'obtenir des données de diffraction des rayons X du cristal RBC1531.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Production de protéines recombinantes et purification de rBC1531

  1. Préparation d'un plasmide d'expression recombinant BC1531 (rBC1531)
    1. Préparer l'ADN génomique de B. cereus 10 .
    2. Amplifier le gène bc1531 à partir d'un modèle d'ADN génomique de B. cereus par réaction en chaîne par polymérase (PCR), en utilisant des amorces avant et inverses (voir la liste des matériaux) pour créer des sites d'enzymes de restriction Bam HI et Sal I, respectivement 10 .
    3. Digérer le produit de PCR et un vecteur pET49b modifié (pET49bm) en utilisant Bam HI et Sal I, comme décrit 11 .
    4. Mélanger le produit de PCR et le vecteur digéré (rapport 3: 1) de l'étape 1.1.3 en utilisant de l'ADN ligase T4 dans une réaction de 10 μL, comme décrit 11 . Incuber à 18 ° C pendant 30 min.
    5. Pipeter 3 μL de la réaction de ligature dans 50 μL de chimieLly compétent E. coli DH5α cellules dans un tube. Mélanger doucement en pipetant vers le haut et vers le bas et placer sur de la glace pendant 30 min. Choc thermique de 45 s à 42 ° C. Ajouter 1 ml de milieu Luria-Bertani (LB) et faire pousser les cellules en agitant vigoureusement (250 tr / min, 37 ° C, 45 minutes).
    6. Prendre 100 μL des cellules transformées à partir de l'étape 1.1.6 et les étaler sur les plaques LB-agar avec 100 μg / ml de kanamycine (Kan). Incuber pendant ~ 18 h à 37 ° C.
    7. Choisissez des colonies à l'aide d'un bout stérile et développez les cellules dans 3 mL de milieu LB avec 100 μg / mL de Kan; Secouer vigoureusement (250 tr / min, 37 ° C, 18 h).
    8. Préparer l'ADN plasmidique en utilisant un procédé de lyse alcalin-SDS, tel que décrit 10 .
    9. Confirmer la séquence nucléotidique de la construction d'expression rBC1531 en utilisant le séquençage d'ADN 12 .
  2. La surexpression de la protéine rBC1531
    1. Transformer de nouveau la souche E. coli BL21 (DE3) avec rBC1531-expPlasmide de ressaison, comme décrit dans les étapes 1.1.5-1.1.6, pour une surexpression.
    2. Sélectionnez une colonie et faites-la pousser dans 10 mL de milieu LB contenant 50 μg / mL Kan (LB + Kan); Secouez vigoureusement pendant 18 h à 37 ° C.
    3. Inoculer 10 ml de culture de nuit dans 1 L de milieu LB + Kan et pousser à 37 ° C jusqu'à ce que la DO 600 (densité optique à 600 nm) atteigne ~ 0,7.
    4. Immerger la culture dans de l'eau glacée pendant environ 15 min pour refroidir la température à 18 ° C et ajouter le β-D-1-thiogalactopyranoside d'isopropyle (IPTG) à la culture à une concentration finale de 1 mM pour l'expression protéique recombinante. Cultivez la culture à 18 ° C pendant environ 16-18 h.
  3. Purification de rBC1531
    1. Récolter les cellules par centrifugation (5 000 xg, 4 ° C, 30 min). Jeter le surnageant soigneusement afin de ne pas déranger les cellules. Ré-suspendre les cellules dans 50 ml d'une solution saline tamponnée au phosphate (PBS) contenant 10 mM d'imidazole.
    2. Lyse les cellules deux fois par sonication sur glace pour éviter le surchauffe des lysats cellulaires (temps: 2 min 30 s, cycle sur: 5 s, cycle hors tension: 10 s, amplitude: 38%).
    3. Effacer le lysat cellulaire par centrifugation (~ 25 000 xg, 4 ° C, 30 min).
    4. Mélanger 3 ml de billes de nickel et 60 ml de PBS contenant 10 mM d'imidazole et entraîner par gravité le tampon supplémentaire pour régler les grains de nickel équilibrés dans une colonne de Chromatographie sur verre de 2,5 x 10 cm.
    5. Pipeter pour transférer le surnageant de l'étape 1.3.3 à la colonne avec des perles de nickel pré-équilibrées et incuber à 4 ° C pendant 2 h sur une roue à une vitesse faible (~ 20 tours par minute).
    6. Laisser le surnageant s'écouler par gravité et laver les billes de nickel dans la colonne trois fois avec 100 ml de PBS contenant 10 mM d'imidazole.
    7. Elute rBC1531 protéine en appliquant 4 x 5 mL de PBS contenant 250 mM d'imidazole.
    8. Prendre 15 μL de l'élution à partir de l'étape 1.3.7 et l'exécuter sur 15% de SDS-PAGE. Visualisez les bandes de protéines surLe gel en utilisant la coloration au bleu de Coomassie 10 .
  4. Suppression des étiquettes d'affinité de la protéine rBC1531 par la protéolyse de la thrombine
    1. Pipetter les fractions dans le tube de dialyse (poids moléculaire coupé: 3 kDa) et placer le tube dans un bécher contenant 4 L de tampon compatible avec le clivage de la thrombine (HEPES 20 mM, pH 7,4, NaCl 150 mM et β-mercaptoéthanol 1,5 mM) À 4 ° C pendant la nuit.
    2. Pipettez les fractions et transférez-les dans un tube conique.
    3. Mesurer l'absorbance à 280 nm et estimer la concentration de la protéine rBC1531, comme décrit 13 .
    4. Prendre 50 μg de rBC1531 dans un tube de 0,5 mL et ajouter diverses quantités de thrombine ( c.-à-d., 2, 1, 0,6 et 0,3 unités). Incuber les réactions de rBC1531 et de thrombine à 20 ° C pendant ~ 3 h pour déterminer la moindre quantité de thrombine nécessaire pour cliver l'étiquette d'affinité N-terminal.
    5. Exécutez le rBC1531 et les réactions de thrombine sur un 15%SDS-PAGE et déterminer la quantité la plus faible de thrombine ( p. Ex., 0,3 unité de thrombine pour 50 μg de rBC1531) qui digère complètement l'étiquette d'affinité N-terminal et produit un rBC1531 sans étiquette.
    6. Ajouter 10 mg de protéine rBC1531 et 60 unités de thrombine à un tube de 15 ml et incuber à 20 ° C pendant environ 3 h pour la réaction de protéine de thrombine.
    7. Appliquer des normes de filtration sur gel à une colonne de Chromatographie d'exclusion de taille (SEC) pour préparer une courbe standard de poids moléculaires et des volumes d'élution, comme décrit 13 .
    8. Placer la protéine rBC1531 digérée par la thrombine à partir de l'étape 1.4.6 dans un tube de filtre centrifuge (poids moléculaire coupé: 3 kDa) et centrifuger à 3.000 g à 4 ° C pour réduire à un volume inférieur à 5 mL.
    9. Appliquer la protéine rBC1531 concentrée sur la colonne SEC et collecter 60 fractions éluées dans 0,5 mL par tube 13 .
    10. Prenez 15 μL de chaque fraction, exécutez-les sur une SDS-PAGE de 15% et staiDans le gel en utilisant une solution de coloration Coomassie (0,15% (p / v) de bleu brillant Coomassie, 40% (v / v) de méthanol et 10% (v / v) d'acide acétique glacial) comme décrit 10 .
    11. Pipettez les fractions contenant rBC1531 et collectez-les dans un tube.

2. Criblage et optimisation de la cristallisation de rBC1531

  1. Conditions de criblage pour la cristallisation de la protéine rBC1531
    1. Concentrez le rBC1531 de l'étape 1.4.11 jusqu'à ~ 18.5 mg / mL en utilisant un tube de filtre centrifuge, comme décrit à l'étape 1.4.8.
    2. Ajouter 50 μL de chaque solution de tamisage de cristallisation (voir section 2.2) 14 dans les puits de plaques de cristallisation à jet de 96 puits. Placez 0,5 μL de la solution de protéine RBC1531 de 18,5 mg / mL sur un lit de repos. Mélanger la solution de protéines avec 0,5 μL de solution de puits, répétant le processus pour la totalité de la plaque.
    3. Couvrir la plaque avec un film adhésif transparent.Placez les plaques à 96 puits à 18 ° C et autorisez la diffusion de la vapeur.
    4. Numérisez les gouttes à un grossissement de 20 à 40 X à l'aide d'un microscope optique pour surveiller la formation de cristaux quotidiennement pendant 2 à 3 semaines.
    5. Recueillir des données de diffraction des rayons X 12 en utilisant les cristaux de protéines rBC1531 obtenus.
  2. Optimisation des conditions de cristallisation rBC1531
    1. Préparer 500 μL de la solution d'état de cristallisation initiale sélectionnée ( p. Ex. Cacodylate de sodium 0,1 M, pH 6,5 et citrate de sodium 1,0 M) et remplir une plaque de cristallisation à 24 puits pour la goutte assise.
    2. Ajouter 0,5 μL de la solution de protéine RBC1531 de 18,5 mg / mL à un lit de repos, mélanger avec 0,5 μL de solution de puits et recouvrir immédiatement la plaque avec un film adhésif transparent. Placez la plaque à 18 ° C.
    3. Observez la croissance des cristaux sous un microscope optique pendant une semaine.
    4. Optimiser diverses conditions de cristallisation en faisant varier le pH ( c.-à-d.. PH 5,5-6,8) de cacodylate 0,1 M et en modifiant la concentration en sel ( c.-à-d. 0,9-1,2 M) de citrate de sodium pour obtenir des cristaux singuliers. Surveiller la croissance des cristaux pendant ~ 1 semaine et collecter les données de diffraction des rayons X 12 .

3. Caractérisation de l'activité Nucleoside Triphosphatase (NTPase) de rBC1531

  1. Validation de l'étude colorimétrique inorganique à base de phosphate
    1. Préparer un stock de pyrophosphate (100 mM) et le diluer à des concentrations finales de 0,1, 0,25, 0,5, 1,0, 5,0, 10, 50, 100 et 250 uM dans 200 μL de tampon de réaction (HEPES 20 mM, pH 7,4; 150 MM de NaCl et 2 mM de MgCl 2 ) en double des plaques à 96 puits. Utilisez la première plaque comme témoin (cela ne contient pas de pyrophosphatase). Assurez-vous que la deuxième plaque contient de la pyrophosphatase comme plaque de travail, comme indiqué à l'étape 3.1.2.
    2. Ajouter 0,01 unité de saccharomyces cerevisiae p inorganiqueYrophosphatase (1 μL) aux puits de la plaque de travail et incuber à 20 ° C pendant 30-60 minutes.
    3. Préparer la solution d'acide molybdate en mélangeant des solutions de molybdate d'ammonium (0,86% v / v) et d'acide ascorbique (14% v / v) dans un rapport de 7: 3. Ajouter 16 μL de solution d'acide molybdate aux puits de travail et de contrôle et attendre 15 minutes.
    4. Lisez la densité optique à 690 nm (OD 690nm ).
  2. Étude de la NTPase colorimétrique
    1. Préparer un stock de substrat de nucléoside triphosphate (NTP) 100 mM et diluer jusqu'à la concentration souhaitée ( par exemple 0, 0,2, 4,4, 11, 22, 44, 88 ou 132 uM) dans 180 μl de tampon de dosage (HEPES 20 mM, PH 7,4, NaCl 150 mM et MgCl 2 2 mM).
    2. Ajouter 20 μg de substrats rBC1531 (1,5 mM) et NTP de l'étape 3.2.1 jusqu'à 200 μL par réaction dans une plaque à 96 puits et des pipettes haut et bas pour bien mélanger. Couvrez la plaque avec son couvercle et placez-la dans un incubateur de 37 ° C pendant 30 min.Pour effectuer la réaction d'hydrolyse du substrat.
    3. Transférer la plaque dans un bain-marie à 70 ° C et laisser reposer pendant 15 minutes pour arrêter les réactions catalytiques médiées par le rBC1531.
    4. Ajouter 0,01 unité de pyrophosphatase inorganique de S. cerevisiae (1 μL) à chaque puits de la plaque de réaction (à partir de l'étape 3.2.3) et incuber à 20 ° C pendant 30 minutes. Ajouter 16 μL de solution d'acide molybdate à la plaque de réaction pour développer la couleur (~ 15 min). Lire à OD 690nm .
    5. Analyser l'utilisation de l'équation de Michaelis-Menten, comme décrit 12 .

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

La caractérisation de la protéine d'intérêt dans cette étude a commencé par la préparation d'une quantité suffisante de protéine recombinante B. cereus bc1531 (rBC1531), de préférence plus de plusieurs milligrammes. Le fragment d'ADN codant pour la protéine BC1531 a été préparé par PCR en utilisant l'ADN génomique de B. cereus comme modèle, car il contient des gènes orthologues identiques à ba1554 . Le rBC1531 a été surexprimé sous la forme d'une protéine soluble dans les cellules E. coli . La protéine rBC1531 a été exprimée avec un marqueur 6x-Histidine et un site de clivage de la thrombine à son extrémité N-terminale 12 . Comme première étape de purification, le RBC1531 a été purifié par Chromatographie d'affinité au nickel ( Figure 1A ). Ensuite, un essai de digestion à la thrombine a été effectué pour déterminer la plus faible quantité de thrombine requise pour la digestion complète de l'étiquette d'affinité de rBC1531 ( figure 1A ). Dans nos mains, 0,3 unité de thrombine était suffisantePour supprimer complètement l'étiquette d'affinité de rBC1531. Ainsi, lors de la mise à l'échelle, 10 mg de rBC1531 ont été traités avec 60 unités de thrombine pour l'élimination des étiquettes. Après la digestion par la thrombine, le rBC1531 sans étiquette a été appliqué à une colonne SEC pour éliminer tous les agrégats solubles et les contaminants à poids moléculaire supérieur ou inférieur. Les fractions rBC1531 ont été analysées par SDS-PAGE, dont les résultats suggèrent que RBC1531 était ~ 99% pur ( Figure 1A ). Dans l'ensemble, 1 L de culture a produit ~ 8 mg de protéine rBC1531.

Pour estimer l'état oligomère de rBC1531, la SEC a été réalisée. Une courbe linéaire standard qui corrèle la valeur logarithmique des poids moléculaires des échantillons avec leurs volumes d'élution correspondants a été tracée en utilisant les pics des protéines ( figure 1B ). Le rBC1531 a été élué à un volume d'élution de ~ 84 ml, et son poids moléculaire apparent a été estimé à ~ 55 kDa. Étant donné que le moléculaire calculé nousLe monomère rBC1531 est de ~ 13 kDa, ces résultats indiquent que le rBC1531 s'associe comme un tétramère.

Le rBC1531 purifié a été criblé pour la cristallisation en utilisant des conditions de ~ 400 dans une méthode de diffusion de vapeur à suspension assise. Les cristaux de rBC1531 sont apparus en ~ 2 jours à deux conditions: condition-A, citrate de sodium 0,1 M (pH 5,5) et 20% PEG 3000 ( Figure 2A ) et condition-B, cacodylate de sodium 0,1 M (pH 6,5) et 1,0 M de sodium Citrate ( figure 2B ). Les conditions de cristallisation ont été optimisées en faisant varier le pH (citrate de sodium 0,1 M, pH 5,0-6,0) et la concentration de PEG 3000 (18-21% de PEG 3000) à partir de la condition A et en modifiant le pH (cacodylate de sodium 0,1 M, pH 5.5-6.8) et la concentration en sel (citrate de sodium 0,9-1,2 M) de la condition B. Les cristaux appropriés de diffraction ont été obtenus uniquement pour la condition B, alors que les cristaux de la condition A ont tendance à être inter-cultivés plutôt que singuliers. Cristaux Condition-BLes rayons X diffractés à une résolution de 2,74 Å ( Figure 2C ) et ont été utilisés pour la détermination de structure rBC1531.

L'observation d'un domaine MazG conservé dans la séquence de la protéine BA1554 a suggéré la présence d'une activité NTPase capable d'hydrolyser les NTP. L'hydrolyse du NTP donne généralement du diphosphate de nucléoside (NPD) et du phosphate inorganique (Pi), ou du nucléoside monophosphate (NMP) et du pyrophosphate (PPi). PPi nécessite une activité pyrophosphatase supplémentaire pour produire Pi. Les niveaux de Pi peuvent être mesurés directement à l'aide de molybdate, qui forme un complexe de couleur bleue avec Pi (molybdate-Pi) qui peut être surveillé en utilisant la densité optique à une longueur d'onde de 690 nm (OD 690nm ) ( Figure 3A ). Dans notre étude, après l'hydrolyse du NTP par rBC1531, aucune couleur bleue visible n'a été produite après l'ajout de molybdate ( Figure 3B ). Cependant, lorsque la pyrophosphatase a été ajoutée à l'hydrolyse NTP médiée par le rBC1531 rEaction, la couleur a changé en bleu foncé ( figure 3B ), ce qui indique que rBC1531 a une activité de pyrophosphohydrolase NTP. Un graphique de la DO 690nm et de la concentration de NTP a été analysé à l'aide d'une méthode de régression non linéaire pour déterminer les paramètres cinétiques (V max de 0,75 et K m de 10 μM) pour l'enzyme rBC1531 ( Figure 3C ).

Figure 1
Figure 1: SDS-PAGE et analyse de la chromatographie d'exclusion de taille (SEC). ( A ) analyse SDS-PAGE de rBC1531. (À gauche) Les pics d'élution rBC1531 provenant de la Chromatographie d'affinité au nickel (voie 2, Ni) et SEC (voie 3) ont été analysés avec des protéines (voie 1, marquées dans kDa). (Droite) Analyse de la digestion par la thrombine de rBC1531 pour l'élimination de l'étiquette d'affinité. Les quantités de thrombine ajoutées à 50 μg de rBC1531 dans différentes réactions sont indGlacé dans des unités au-dessus du gel. ( B ) Analyse par chromatographie d'exclusion de taille (SEC) du rBC1531 et des standards de protéines. (Gauche) Profils d'élution de rBC1531 (bleu) et standards (rouge). Les poids moléculaires des protéines standard sont indiqués au-dessus de chaque pic, dans kDa. Les axes verticaux (y) et horizontaux (x) montrent respectivement les unités d'absorption milli (MW à 280 nm) et les volumes de rétention (mL). (Droite) La taille moléculaire apparente de rBC1531 a été estimée en utilisant un diagramme linéaire pour les poids moléculaires, en échelle logarithmique et les volumes d'élution des protéines (R 2 = 0,9934). Cliquez ici pour voir une version plus grande de ce chiffre.

Figure 2
Figure 2: cristallisation et diffraction des rayons X. ( A ) cristaux rBC1531 en conditiOn-A, citrate de sodium 0,1 M (pH 5,5) et 20% de PEG 3000. ( B ) cristaux de rBC1531 dans la condition-B, cacodylate de sodium 0,1 M (pH 6,5) et citrate de sodium 1,0 M. Des cristaux initiaux (gauche) et optimisés (moyen et droit) sont affichés. Le cristal rBC1531 optimisé (droite, ~ 0,35 mm x ~ 0,35 mm x ~ 0,20 mm) a été utilisé pour la diffraction des rayons X. Barres d'échelle = 100 μm. ( C ) Image de diffraction des rayons X du cristal rBC1531 obtenu à la ligne PAL PAL BL-7A 12 . La flèche indique un point haute résolution. Cliquez ici pour voir une version plus grande de ce chiffre.

figure 3
Figure 3: activité NTPase. ( A ) La formation du complexe molybdène-Pi dépend de la concentration de Pi. La densité optique à 690 nm est diDirectement associé à l'augmentation des niveaux de Pi. L'axe Y et l'axe des X représentent respectivement la DO 690nm et la concentration (μM) de Pi. ( B ) La couleur change après addition de pyrophosphatase. Dans la première rangée de puits, la pyrophosphatase n'a pas été ajoutée et n'a pas formé le complexe Pi de couleur bleue. Cependant, la deuxième rangée comprend des puits dans lesquels les réactions rBC1531-NTP ont été traitées avec de la pyrophosphatase et ont développé une couleur bleue. Les valeurs de OD 690nm ont augmenté avec l'augmentation des concentrations de NTP. ( C ) Michaelis-Menten parcelle des réactions rBC1531-NTP. L'axe Y et l'axe X représentent respectivement la DO 690nm et la concentration (0-120 μM) de substrats NTP. Les barres d'erreur représentent l'écart type pour trois expériences distinctes. Cliquez ici pour voir une version plus grande de ce chiffre.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs n'ont rien à dévoiler.

Acknowledgments

Les jeux de données de diffraction des rayons X ont été collectés à la ligne de faisceau 7A du Pohang Accelerator Laboratory (Corée). Cette étude a été soutenue par le programme de recherche scientifique de base administré par la Fondation nationale de recherche de Corée (NRF), financé par le ministère des Sciences, des TIC et de la planification future (2015R1A1A01057574 à MH).

Materials

Name Company Catalog Number Comments
Bacillus cereus ATCC14579 Korean Collection for Tissue Culture 3624
Genomic DNA prep kit GeneAll 106-101 Genomic DNA preparation
Forward primer Macrogen GAAGGATCCGGAAGCAAAAA
CGATGAAAGATATGCA
BamHI site is underlined
Reverse primer Macrogen CTTGTCGACTTATTCTTTCTCT
CCCTCATCAATACGTG
SalI site is underlined
nPfu-Forte Enzynomics P410 PCR polymerase
BamHI Enzynomics R003S
SalI Enzynomics R009S
pET49b expression vector Novagen 71463 Expression vector was modified to add affinity tags and BamHI/SalI sites10
T4 DNA ligase Enzynomics M001S
Dialysis memebrane Thermofisher 18265017
Dry block heater JSR JSBL-02T
LB broth (Luria-Bertani) LPS solution LB-05
LB Agar, Miller (Luria-Bertani) Becton, Dickinson and Company
Kanamycin LPS solution KAN025
Mini-prep kit Favorgen FAPDE300 Plasmid DNA preparation
BL21(DE3) Competent cell Novagen 69450-3CN
Isopropyl β-D-1-thiogalactopyranoside (IPTG) Fisher BioReagents 50-213-378
Sodium chloride Daejung 7548-4100 PBS material
Potassium chloride Daejung 6566-4405 PBS material
Potassium phosphate Bio Basic Inc PB0445 PBS material
Sodium phosphate Bio Basic Inc S0404 PBS material
Imidazole Bio Basic Inc IB0277
Sonicator Sonics VCX 130
Ni-NTA agaros Qiagen 30210 Nickel bead
Rotator Finepcr AG
Precision Plus Protein Dual Color Standards Bio-rad 1610374 SDS-PAGE protein standard
Coonmassie Brilliant Blue R-250 Fisher BioReagents BP101-25 Coomassie staining solution
Methyl alcohol Samchun chemical M0585 Coomassie staining solution
Acetic acid Daejung 1002-4105 Coomassie staining solution
Dialysis memebrane Thermofisher 68035
2-Mercaptoethanol Sigma-aldrich M6250
Thrombin Merckmillipore 605157-1KUCN Prepare aliquots of 20 μL (1 Unit per μL) and store at 70 °C and thaw before use
Superdex 200 16/600 General Electric 28989335 Size exclusion chromatography
Gel filtration standard Bio-rad 151-1901
Centrifugal filter Amicon UFC800396
Crystralization plates Hampton research HR3-083 96-well sitting drop plate
The JCSG core suite I-IV Qiagen 130924-130927 Crystallization secreening solution
Microscope Nikon SMZ745T
Cryschem plates Hampton research HR3-158 24-well sitting drop plate
Inorganic pyrophosphatase Sigma 10108987001
Ammonium molybdate solution Sigma 13106-76-8
L-ascorbic acid Sigma 50-81-7
NTP substrate Startagene 200415-51
Spectrophotometer Biotek SynergyH1 microplate reader
GraphPad Prism 5 GraphPad Prism 5 for Window

DOWNLOAD MATERIALS LIST

References

  1. Ivanova, N., et al. Genome sequence of Bacillus cereus and comparative analysis with Bacillus anthracis. Nature. 423, 87-91 (2003).
  2. Spencer, R. C. Bacillus anthracis. J Clin Pathol. 56, 182-187 (2003).
  3. Deli, A., et al. LmbE proteins from Bacillus cereus are de-N-acetylases with broad substrate specificity and are highly similar to proteins in Bacillus anthracis. FEBS J. 277, 2740-2753 (2010).
  4. Gross, M., Marianovsky, I., Glaser, G. MazG -- a regulator of programmed cell death in Escherichia coli. Mol Microbiol. 59, 590-601 (2006).
  5. Galperin, M. Y., Moroz, O. V., Wilson, K. S., Murzin, A. G. House cleaning, a part of good housekeeping. Mol Microbiol. 59, 5-19 (2006).
  6. Lee, S., et al. Crystal structure of Escherichia coli MazG, the regulator of nutritional stress response. J Biol Chem. 283, 15232-15240 (2008).
  7. Moroz, O. V., et al. Dimeric dUTPases, HisE, and MazG belong to a new superfamily of all-alpha NTP pyrophosphohydrolases with potential "house-cleaning" functions. J Mol Biol. 347, 243-255 (2005).
  8. Robinson, A., et al. A putative house-cleaning enzyme encoded within an integron array: 1.8 A crystal structure defines a new MazG subtype. Mol Microbiol. 66, 610-621 (2007).
  9. Moroz, O. V., et al. The crystal structure of a complex of Campylobacter jejuni dUTPase with substrate analogue sheds light on the mechanism and suggests the "basic module" for dimeric d(C/U)TPases. J Mol Biol. 342, 1583-1597 (2004).
  10. Green, M., Sambrook, J. Molecular cloning: A laboratory Manual. 1, John Inglis. (2012).
  11. Brown, T. A. Gene cloning an introduction. Chapman & Hall. (1986).
  12. Kim, M. I., Hong, M. Crystal structure of the Bacillus-conserved MazG protein, a nucleotide pyrophosphohydrolase. Biochem Biophys Res Commun. 472, 237-242 (2016).
  13. Sheehan, D. Physical biochemistry: Principles and applications. A John Wiley & Sons. (2009).
  14. Lesley, S. A., Wilson, I. A. Protein production and crystallization at the joint center for structural genomics. J Struct Funct Genomics. 6, 71-79 (2005).
  15. Jeon, Y. J., et al. Structural and biochemical characterization of bacterial YpgQ protein reveals a metal-dependent nucleotide pyrophosphohydrolase. J Struct Biol. 195, 113-122 (2016).
Expression de protéines recombinantes, cristallisation et études biophysiques d&#39;une<em&gt; Bacillus</em&gt; Pyrophosphorylase nucléotidique conservée, BcMazG
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Kim, M. I., Lee, C., Hong, M. Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG. J. Vis. Exp. (123), e55576, doi:10.3791/55576 (2017).More

Kim, M. I., Lee, C., Hong, M. Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG. J. Vis. Exp. (123), e55576, doi:10.3791/55576 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter