Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biochemistry

재조합 단백질 발현, 결정화 및 생물 물리학 연구 doi: 10.3791/55576 Published: May 16, 2017

Summary

Bacillus anthracis 는 치명적인 흡입 탄저의 병원성 물질이기 때문에 유전자와 단백질에 대한 연구가 엄격히 규제됩니다. 또 다른 접근법은 orthologous 유전자를 연구하는 것이다. B. cereusB. anthracis ortholog (bc1531)에 대한 생물학적 물리 화학적 연구는 최소한의 실험 장비를 필요로하며 심각한 안전 문제가 없다고 설명합니다.

Abstract

진정한 병원체에서 유전자와 단백질을 연구 할 때 안전 제한과 규제를 극복하기 위해 동질성을 연구 할 수 있습니다. Bacillus anthracis 는 치명적인 흡입 탄저병을 일으키는 절대 병원균입니다. Bacillus cereusB. anthracis 를 가까운 진화 관계로 연구하는 데 유용한 모델로 간주됩니다. B. anthracis 의 유전자 클러스터 ba1554 - ba1558Bacillus thuringiensisbt1364 - bt1368 클러스터뿐만 아니라 B. cereusbc1531 - bc1535 클러스터와 잘 보존되어 있으며 Bacillus 속의 관련 유전자의 중요한 역할을 나타낸다. 이 원고는 B. cereus , bc1531 에서 ortholog의 재조합 단백질을 사용하여 B. anthracis 의 유전자 클러스터에서 첫 번째 유전자 ( ba1554 )의 단백질 생성물을 준비하고 특성화하는 방법을 설명합니다.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

재조합 단백질 발현은 제한된 단백질 양 및 유해한 오염과 같은 천연 단백질 공급원과 관련된 문제점을 극복하기 위해 널리 사용됩니다. 또한 병원성 유전자와 단백질 연구에서 추가적인 안전 예방 조치가 필요없는 대체 실험실 균주를 이용할 수 있습니다. 예를 들어, Bacillus cereusBacillus anthracis 를 가까운 진화 적 관계 로 연구하는데 유용한 모델이다.

B. 탄저균은 사람과 가축에서 치명적인 흡입 탄저병을 일으키는 필수 병원체이며 잠재적으로 생물 표지 2 로 사용될 수 있습니다. 따라서 B. anthracis 에 대한 실험실 연구는 BSL-3 (생물 안전성 수준 3) 관행을 요구하는 미국 질병 통제 센터 (Centers for Disease Control)에 의해 엄격히 규제되며 실험실 구역을 음의 실내 압력으로 격리하도록 요구합니다. B. anthracis 와는 대조적으로 B. cereus 는 BSL-1 약제로 분류되어 안전에 대한 염려가 거의 없다. B. cereus 는 감염시 식중독을 일으키는 기회 주의적 병원균으로 의료 지원없이 치료할 수 있습니다. 그러나 B. cereusB. anthracis 와 많은 중요한 유전자를 공유하기 때문에 B. cereus 1의 동족체를 사용하여 B. anthracis 단백질의 기능을 연구 할 수 있습니다.

B. anthracisba1554 - ba1558 유전자 클러스터는 bc1531 - bc1535 클러스터와 잘 보존되어있다. Bacillus thuringiensisbt1364-bt1368 클러스터뿐만 아니라 B. cereus 의 유전자 조직 및 염기 서열에 관한 것이다. 또한, 각 클러스터의 첫 번째 유전자 ( ba1554 , bc1531bt1364 )는 절대적으로 보존되어 있습니다 ( 예 : 100 % 염기 서열 동일성). implyiBacillus 종에서 유전자 산물의 결정적인 역할. 이러한 유전자 클러스터에서의 위치 때문에, ba1554 는 추정 전사 조절 자로 오인되었다. 그러나 ba1554 산물의 아미노산 서열 분석은 MazG family에 속하는 것으로 나타 났는데, 이는 nucleotide pyrophosphohydrolase 활성을 가지고 있으며 전사 인자 활성과 관련이 없다 4 , 5 . MazG 계열에 속하는 단백질은 전체 서열과 길이가 다양하지만 EXXE 12-28 EXXD 모티프로 특징 지워지는 ~ 100 잔기의 MazG 도메인을 공유합니다 ( "X"는 아미노산 잔기를 의미하고 번호 X 잔기의 수를 나타낸다).

MazG 도메인은 특정 촉매 활동을 직접적으로 설명하지는 않습니다. Escherichia coli (EcMazG)의 MazG 구성원은 2 개의 MazG 도메인을 보유하고 있지만C 말단 MazG 도메인은 효소 적으로 활성이다 6 . 또한, MazG 효소의 기질 특이성은 비특이적 뉴 클레오 시드 트리 포스페이트 (EcMazG의 경우)에서 특정 dCTP / dATP (인테그린 관련 MazG의 경우) 및 dUTP (dUTPases의 경우) 6 , 7 , 8 , 9로 다양합니다. 따라서 BA1554 단백질의 생물 물리 화학적 분석은 NTPase 활성을 확인하고 기질 특이성을 해독하기 위해 필요하다.

여기에 BSL-3 시설이없는 대부분의 실험실이 분자 수준에서 B. anthracis ba1554 의 ortholog 인 B. cereus bc1531 유전자의 단백질 생성물을 특성화하기 위해 따라갈 수있는 단계별 프로토콜이 제공됩니다. 간단히, 재조합 BC1531 (rBC1531)을 대장균 에서 발현 시키고 친 화성 태그를 사용하여 정제 하였다. X 선 결정학 실험에서 결정rBC1531 단백질의 zation 조건을 스크리닝하고 최적화 하였다. rBC1531의 효소 활성을 평가하기 위해, NTPase 활성을 비색계로 모니터링하여 통상적으로 사용 된 방사성 표지 된 뉴클레오타이드를 회피 하였다. 마지막으로, 얻어진 생 물리 화학적 데이터의 분석은 rBC1531 결정으로부터 X- 선 회절 데이터를 얻는 것뿐만 아니라 rBC1531의 올리고머 화 상태 및 촉매 매개 변수를 결정할 수있게했다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. rBC1531의 재조합 단백질 생산 및 정제

  1. 재조합 BC1531 단백질 (rBC1531) - 발현 플라스미드
    1. B. cereus 10 의 게놈 DNA를 준비합니다.
    2. Bam HI 및 Sal I 제한 효소 부위를 각각 생성하기 위해 정방향 및 역방향 프라이머 (물질 목록 참조)를 사용하여 폴리머 라제 연쇄 반응 (PCR)에 의해 B. cereus 게놈 DNA의 템플레이트로부터 bc1531 유전자를 증폭시킨다.
    3. PCR 제품과 수정 된 pET49b 벡터 (pET49bm)를 BamHISal I을 사용하여 분해하고 11 .
    4. 설명 된대로 10 μL 반응에서 T4 DNA 리가 제를 사용하여 1.1.3 단계에서 소화 PCR 제품과 벡터 (3 : 1 비율)를 섞는다. 18 ° C에서 30 분 동안 품어 라.
    5. chemica 50 μL에 연결 반응 3 μL 피펫유능한 E. coli DH5α 세포를 튜브에 넣습니다. 피펫 팅을 위아래로 부드럽게 혼합하고 얼음에 30 분 동안 두십시오. 42 ° C에서 45 초 동안 열충격. Luria - Bertani (LB) 배지 1 ML을 추가하고 격렬하게 (250 rpm, 37 ° C, 45 분) 떨고있는 동안 세포를 성장.
    6. 단계 1.1.6에서 형질 전환 한 세포 100 μL를 취해 100 μg / mL kanamycin (칸)이 들어있는 LB- 한천 플레이트에 뿌립니다. 37 ~ 18 시간 동안 ~ 18 시간 동안 품어 낸다.
    7. 멸균 팁을 사용하여 식민지를 선택하고 100 μg / ML 칸과 LB 미디어 3 ML의 세포를 성장; 격렬히 흔들어주세요 (250 rpm, 37 ° C, 18 h).
    8. 10 설명한대로 알칼리성 SDS의 lysis 방법을 사용하여 플라스미드 DNA를 준비합니다.
    9. DNA sequencing 12 를 사용하여 rBC1531 발현 구조의 염기 서열을 확인합니다.
  2. rBC1531 단백질의 과발현
    1. rBC1531-exp로 대장균 BL21 (DE3) 균주를 재조합과발현을 위해 단계 1.1.5-1.1.6에 기술 된대로 레 시온 플라스미드를 사용한다.
    2. 식민지를 선택하고 50 μg / ML 칸 (LB + 칸)을 포함하는 LB 매체의 10 ML에서 그것을 성장; 37 ° C에서 18 시간 동안 격렬히 흔든다.
    3. 1L의 LB + Kan 배지에 밤새 배양 10 mL를 접종하고 OD 600 (600 nm에서의 광학 밀도)이 ~ 0.7에이를 때까지 37 ℃에서 성장시킨다.
    4. 온도를 18 ° C로 낮추고 재조합 단백질 발현을 위해 1 mM의 최종 농도에서 배양 물에 이소 프로필 β-D-1-thiogalactopyranoside (IPTG)를 첨가하기 위해 약 15 분 동안 얼음물에서 배양합니다. 18 ~ 18 ℃에서 16 ~ 18 시간 동안 배양하십시오.
  3. rBC1531의 정제
    1. 원심 분리 (5,000 xg, 4 ° C, 30 분)에 의해 세포를 수확. 세포를 방해하지 않도록주의 깊게 상등액을 버린다. 10 MM 이미 다졸이 들어있는 인산염 완충 식염수 (PBS) 용액 50 mL에 세포를 재현 탁합니다.
    2. 세포 lysates (시간 : 2 분 30 초, 사이클 : 5 초, 사이클 오프 : 10 초, 진폭 : 38 %)의 과열을 방지하기 위해 얼음 sonication에 의해 세포를 두 번 Lyse.
    3. 원심 분리 (~ 25,000 xg, 4 ℃, 30 분)에 의해 세포 용 해물을 맑게한다.
    4. 10 ML 이미 다졸 및 중력 흐름을 포함하는 60 ML 니켈 비즈 3 ML을 섞어 여분의 버퍼 2.5 X 10cm 유리 크로마토 그래피 칼럼에 평형 니켈 구슬을 해결합니다.
    5. 피펫은 사전에 평형 니켈 구슬과 칼럼에 1.3.3에서 뜨는을 전송하고 저속 (~ 20 RPM)에서 회전 바퀴에 4 시간에 2 시간 품어.
    6. 뜨는를 중력에 의해 배수하고 10 MM 이미 다졸을 포함하는 PBS 100 ML로 열에있는 세 번 니켈 구슬을 씻어주십시오.
    7. 250 mM 이미 다졸을 함유 한 PBS 4 x 5 mL를 적용하여 rBC1531 단백질을 용출시켰다.
    8. 1.3.7 단계에서 15 μL의 용리액을 취해 15 % SDS-PAGE에서이를 수행하십시오. 단백질 밴드를 시각화합니다.Coomassie blue 염색법을 사용하여 젤 10 .
  4. 트롬빈 단백 분해에 의한 rBC1531 단백질의 친화력 태그 제거
    1. 분주를 투석 튜브 (분자량 차단 : 3 kDa)에 피펫과 트롬빈 절단 호환 버퍼 (20 MM HEPES, 산도 7.4, 150 MM NaCl 및 1.5 MM β - mercaptoethanol)의 4 L를 포함하는 비커에 튜브를 놓으십시오. 4 ° C에서 하룻밤.
    2. 분수를 피펫과 원뿔 튜브로 전송합니다.
    3. 280 nm에서 흡광도를 측정하고 설명 된 바와 같이 rBC1531 단백질 농도를 추정.
    4. 0.5 mL 튜브에서 rBC1531 50 μg을 채취하고 다양한 양의 트롬빈 ( 즉, 2, 1, 0.6 및 0.3 단위)을 첨가하십시오. rBC1531과 트롬빈 반응을 20 ℃에서 ~ 3 시간 동안 배양하여 N- 말단 친 화성 태그를 절단하는데 필요한 트롬빈의 최소량을 결정한다.
    5. rBC1531 및 트롬빈 반응을 15 %SDS-PAGE로 확인하고 N 말단 친화력 태그를 완전히 소화하고 태그가없는 rBC1531을 생산하는 트롬빈의 최소량 ( 예 : rBC1531 50 μg 당 0.3 단위의 트롬빈)을 결정합니다.
    6. 10mg의 rBC1531 단백질과 60 단위의 트롬빈을 15 mL 튜브에 넣고 20 ℃에서 3 시간 동안 트롬빈 - 단백질 분해 반응을 일으킨다.
    7. 설명 된대로 분자량 및 용출 부피의 표준 곡선을 만들기 위해 크기 - 제외 크로마토 그래피 (SEC) 칼럼에 겔 여과 표준을 적용하십시오.
    8. 원심 분리 필터 튜브 (분자량 차단 : 3 kDa)에 1.4.6 단계의 트롬빈 소화 rBC1531 단백질을 넣고 4,000 ml에서 3,000 g으로 원심 분리하여 5 mL 미만의 부피로 줄입니다.
    9. 농도가 rBC1531 단백질을 SEC 칼럼에 적용하고 튜브 당 0.5 mL로 60 개의 용출 분획물을 수집하십시오 13 .
    10. 각 분획물 15 μL를 취하여 15 % SDS-PAGE에서 실행하고,Coomassie 염색 용액 (0.15 % (w / v) Coomassie 브릴리언트 블루, 40 % (v / v) 메탄올 및 10 % (v / v) 빙초산)을 사용하여 겔을 만들었다.
    11. rBC1531을 포함하는 분수를 피펫 씩 하나의 튜브에 모으십시오.

2. 결정화 스크리닝 및 rBC1531의 최적화

  1. rBC1531 단백질 결정화를위한 스크리닝 조건
    1. 1.4.8에서 설명한대로 원심 분리 필터 튜브를 사용하여 단계 1.4.11에서 rBC1531를 ~ 18.5 mg / mL까지 농축합니다.
    2. 96- 웰 앉아 드롭 결정화 플레이트의 웰에 각 결정화 스크리닝 용액 (섹션 2.2 참조 ) 을 50 μL 씩 첨가한다. 앉아있는 침대에 18.5 mg / mL rBC1531 단백질 용액 0.5 μL를 놓습니다. 용액 전체 0.5 μL와 단백질 용액을 섞어서 전체 플레이트에 대한 과정을 반복하십시오.
    3. 깨끗한 접착 필름으로 판을 덮으십시오.18 ° C에 96 - 웰 플레이트를 놓고 증기 확산을 허용합니다.
    4. 광학 현미경을 사용하여 20 ~ 40 배율로 방울을 스캔하여 2-3 주 동안 매일 크리스탈 형성을 모니터링하십시오.
    5. 얻은 rBC1531 단백질 결정을 사용하여 X- 선 회절 데이터 12 을 수집하십시오.
  2. rBC1531 결정화 조건의 최적화
    1. 선택한 초기 결정화 조건 용액 ( 예 : 0.1 M sodium cacodylate, pH 6.5 및 1.0 M sodium citrate) 500 μL를 준비하고 앉은 방울을 위해 24-well crystallization plate를 채 웁니다.
    2. 앉아있는 침대에 18.5 mg / mL rBC1531 단백질 용액 0.5 μL를 넣고 잘 용액 0.5 μL와 섞은 다음 즉시 투명 필름으로 판을 덮습니다. 플레이트를 18 ° C에 놓습니다.
    3. 가벼운 현미경으로 1 주일 동안 결정 성장을 관찰하십시오.
    4. pH를 변화시켜 다양한 결정화 조건을 최적화하십시오 ( 즉,., pH 5.5-6.8)를 사용하고 구연산 나트륨의 염농도 ( 즉, 0.9-1.2 M)를 변경하여 단핵 결정을 얻는다. 1 주일 동안 결정 성장을 모니터하고 X 선 회절 데이터를 수집하십시오. 12 .

3. rBC1531의 뉴 클레오 시드 트리 포스파타제 (NTPase) 활성의 특성 규명

  1. 무기 인산염 비례 검정의 검증
    1. 피로 인산염 (100 MM)의 주식을 준비하고 반응 버퍼 (20 MM HEPES, 산도 7.4, 150 μl)에 0.1, 0.25, 0.5, 1.0, 5.0, 10, 50, 100 및 250 μm의 최종 농도로 희석 mM NaCl 및 2 mM MgCl 2 )로 2 번 96- 웰 플레이트에서 배양 하였다. 첫번째 판을 대조군으로 사용하십시오 (이것은 피로 포스파타제를 포함하지 않습니다). 두 번째 플레이트에 3.1.2 절에서 설명한대로 작업 플레이트로 pyrophosphatase가 포함되어 있는지 확인하십시오.
    2. Saccharomyces cerevisiae 무기 p 0.01 단위 첨가Yrophosphatase (1 μL)를 작용 플레이트의 웰에 넣고 20 ° C에서 30-60 분 동안 배양합니다.
    3. 몰리브덴 산 암모늄 (0.86 % v / v)과 아스코르브 산 (14 % v / v)을 7 : 3의 비율로 혼합하여 몰리브덴 산 용액을 제조한다. 몰리브덴 산 용액 16 μL를 작업 및 대조 우물에 모두 넣고 15 분 동안 기다린다.
    4. 690 nm (OD 690 nm)에서 광학 밀도를 읽습니다.
  2. 비색 NTPase 분석
    1. 100 mM 뉴 클레오 사이드 트리 포스페이트 (NTP) 기질을 준비하고 검정 완충액 (20 mM HEPES, pH 7.4) 중 180 μL에서 원하는 농도 ( 예 : 0, 0.2, 4.4, 11, 22, 44, 88, 132 μM) pH 7.4, 150 mM NaCl 및 2 mM MgCl 2 )에 용해시켰다.
    2. 96- 웰 플레이트에서 반응 당 200 μL까지 단계 3.2.1에서 rBC1531 (1.5 mM) 및 NTP 기질 20 μg을 첨가하고 잘 혼합하기 위해 위아래로 피펫 팅하십시오. 뚜껑을하여 플레이트를 덮고 30 분 동안 37 ° C 배양기에 두십시오기질 가수 분해 반응을 수행한다.
    3. 플레이트를 70 ° C의 수 욕조에 옮기고 15 분 동안 방치하여 rBC1531 매개 촉매 반응을 중지시킵니다.
    4. S. cerevisiae 무기 pyrophosphatase (1 μL) 0.01 단위를 반응 판 (단계 3.2.3)의 각 웰에 첨가하고 20 ℃에서 30 분 동안 배양한다. 몰리브덴 산 용액 16 μL를 반응 판에 첨가하여 색상을 만듭니다 (~ 15 분). OD 690nm 에서 읽으십시오.
    5. 12 에서 설명한대로 Michaelis-Menten 방정식을 사용하여 분석하십시오.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

본 연구에서 목적 단백질의 특성화는 충분한 양의 재조합 B. cereus bc1531 (rBC1531) 단백질을, 바람직하게는 수 밀리그램 이상으로 제조함으로써 시작되었다. BC1531 단백질을 코딩하는 DNA 단편은 B. cereus 의 게놈 DNA를 주형으로 사용하는 PCR 법으로 ba1554와 동일한 orthologous gene을 포함하고 있으므로 준비 하였다. rBC1531은 대장균 에서 가용성 단백질로 과발현되었다. rBC1531 단백질은 6x- 히스티딘 태그 및 그의 N- 말단 12 에서 트롬빈 절단 부위로 발현되었다. 정제의 첫 번째 단계로서 rBC1531을 니켈 친 화성 크로마토 그래피 ( 그림 1A )로 정제했습니다. 다음으로 트롬빈 소화 시험을 수행하여 rBC1531 ( 도 1A )로부터 친 화성 태그의 완전한 소화에 필요한 트롬빈의 최저량을 결정 하였다. 우리 손에는 0.3 단위의 트롬빈이 들어있었습니다.rBC1531에서 친 화성 태그를 완전히 제거하기에 적합합니다. 따라서, 스케일링시 rBC1531 10mg을 태그 제거 용 트롬빈 60 단위로 처리 하였다. 트롬빈 소화 후, tag-free rBC1531을 SEC 칼럼에 적용하여 용해성 응집체 및 고 분자량 또는 저 분자량 오염물을 제거했습니다. rBC1531 분획을 SDS-PAGE로 분석 한 결과, rBC1531은 ~ 99 % 순수한 것으로 나타났다 ( 도 1A ). 전체적으로 1L의 배양액에서 8mg의 rBC1531 단백질이 생성되었다.

rBC1531의 올리고머 상태를 평가하기 위해 SEC가 수행되었다. 시료의 분자량 로그 값과 해당 용리 부피를 연관시키는 표준 선형 곡선을 단백질 표준 ( 그림 1B )의 피크를 사용하여 플롯했습니다. rBC1531는 ~ 84 mL의 용출 부피에서 용리되었으며, 겉보기 분자량은 ~ 55 kDa로 추정되었다. 주어진 분자량rBC1531 모노머의 ight는 ~ 13 kDa이며,이 결과는 rBC1531이 테트라 머로 조립됨을 나타냅니다.

정화 된 rBC1531을 시팅 드롭 증기 확산법에서 ~ 400 조건을 사용하여 결정화를 위해 스크리닝 하였다. rBC1531 결정은 ​​조건 -A, 0.1M 시트르산 나트륨 (pH 5.5) 및 20 % PEG 3000 ( 도 2A ) 및 조건 -B, 0.1M 나트륨 카코 딜 레이트 (pH 6.5) 및 1.0M 나트륨 citrate ( 그림 2B ). 결정화 조건은 조건 A로부터의 pH (0.1 M 시트르산 나트륨, pH 5.0-6.0) 및 PEG 3000 (18-21 % PEG 3000)의 농도를 변화시키고 pH (0.1 M 나트륨 카코 딜 레이트, pH 5.5-6.8) 및 조건 B의 염농도 (0.9-1.2 M 시트르산 나트륨). 회절에 적합한 결정은 조건 B에 대해서만 얻어졌지만 조건 A의 결정은 단수보다는 상호 성장하는 경향이 있었다. 조건 B 결정체회절 X 선을 2.74Å의 분해능으로 분해하고 ( 도 2C ), rBC1531 구조 결정에 사용 하였다.

BA1554 단백질 서열에서 보존 된 MazG 도메인의 관찰은 NTP를 가수 분해 할 수있는 NTPase 활성의 존재를 암시한다. NTP 가수 분해는 일반적으로 뉴 클레오 사이드 디 포스페이트 (NDP) 및 무기 포스페이트 (Pi) 또는 뉴 클레오 사이드 모노 포스페이트 (NMP) 및 피로 포스페이트 (PPi)를 생성한다. PPi는 Pi를 생성하기 위해 추가적인 피로 포스파타제 활성을 필요로한다. Pi의 수준은 690 nm의 파장 (OD 690 nm)에서 광학 밀도를 사용하여 모니터 할 수있는 Pi (molybdate-Pi)와 청색 착색 된 복합체를 형성하는 몰리브덴 산염을 사용하여 직접 측정 할 수 있습니다 ( 그림 3A ). 우리 연구에서, rBC1531에 의한 NTP 가수 분해 후, 몰리브덴 산염 첨가 후 가시적 인 청색은 생성되지 않았다 ( 도 3B ). 그러나, 피로 포스파타제가 rBC1531- 매개 NTP 가수 분해에 첨가 될 때반응이 진한 파란색으로 바뀌었고 ( 그림 3B ) rBC1531에는 NTP pyrophosphohydrolase 활성이 있음을 나타냅니다. OD 690nm 와 NTP 농도의 플롯을 비선형 회귀 분석법을 사용하여 rBC1531 효소 ( 도 3C )에 대한 운동 파라미터 ( Vmax 는 0.75, Km는 10μM)를 결정 하였다.

그림 1
그림 1 : SDS-PAGE 및 크기 배제 크로마토 그래피 (SEC) 분석. ( A ) rBC1531의 SDS - 페이지 분석. (왼쪽) 니켈 친화도 크로마토 그래피 (레인 2, Ni) 및 SEC (레인 3)로부터의 rBC1531 용출 피크를 단백질 표준 (레인 1, kDa로 표시)과 함께 분석 하였다. (오른쪽) 친화력 태그 제거를위한 rBC1531의 트롬빈 소화 분석. 다른 반응에서 rBC1531의 50 μg에 첨가 된 트롬빈의 양은 ind겔 위의 단위로 희석. ( B ) rBC1531 및 단백질 표준의 크기 - 배제 크로마토 그래피 (SEC) 분석. (왼쪽) rBC1531 (파란색) 및 표준 (빨간색)의 용출 프로필. 표준 단백질의 분자량은 kDa 단위로 각 피크 위에 표시됩니다. 수직 (y) 및 수평 (x) 축은 밀리 - 흡수 단위 (280 nm에서의 mAU) 및 보유 부피 (mL)를 각각 나타낸다. (오른쪽) rBC1531의 겉보기 분자 크기는 분자량, 로그 스케일 및 단백질 표준의 용출 부피 (R2 = 0.9934)에 대한 선형 플롯을 사용하여 추정했습니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 2
그림 2 : 결정화 및 X- 선 회절. condit에 ( A ) rBC1531 결정0.1M 나트륨 시트 레이트 (pH 5.5) 및 20 % PEG 3000. ( B ) 조건 B의 rBC1531 결정, 0.1M 나트륨 카코 딜 레이트 (pH 6.5) 및 1.0M 시트르산 나트륨. 초기 (왼쪽) 및 최적화 (중간 및 오른쪽) 결정이 표시됩니다. X 선 회절에 최적화 된 rBC1531 결정 (오른쪽, ~ 0.35 mm x ~ 0.35 mm x ~ 0.20 mm)을 사용했습니다. 스케일 바 = 100 μm. ( C ) PAL 빔라인 BL-7A 12 에서 얻은 rBC1531 결정의 X- 선 회절 이미지. 화살표는 고해상도 지점을 나타냅니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 3
그림 3 : NTPase 활동. ( A ) 몰리브덴 -Pi 착체의 형성은 Pi 농도에 의존한다. 690 nm에서의 광학 밀도는 dipi 수준의 증가와 직결된다. Y 축과 X 축은 Pi의 OD 690nm 와 농도 (μM)를 각각 나타낸다. ( B ) 파이로 포스파타제 첨가시 색이 변한다. 우물의 첫 번째 열에서는 pyrophosphatase가 첨가되지 않았고 청색의 Pi-complex를 형성하지 않았다. 그러나, 두 번째 행은 rBC1531-NTP 반응이 파이로 포스파타제로 처리되고 청색을 나타내는 우물로 구성됩니다. OD 690nm 값은 NTP 농도의 증가에 따라 증가했다. ( C ) rBC1531-NTP 반응의 Michaelis-Menten 플롯. Y 축 및 X 축은 각각 NTP 기질의 OD 690nm 및 농도 (0-120μM)를 나타낸다. 오차 막대는 세 번의 실험에 대한 표준 편차를 나타냅니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자는 공개 할 것이 없습니다.

Acknowledgments

X 선 회절 데이터 세트는 포항 가속기 연구소 (한국)의 빔라인 7A에서 수집되었다. 이 연구는 과학 기술부, ICT 및 미래 계획 (2015R1A1A01057574, MH)이 자금을 지원하는 국립 과학 재단 (NRF)을 통해 관리되는 기초 과학 연구 프로그램의 지원을 받았다.

Materials

Name Company Catalog Number Comments
Bacillus cereus ATCC14579 Korean Collection for Tissue Culture 3624
Genomic DNA prep kit GeneAll 106-101 Genomic DNA preparation
Forward primer Macrogen GAAGGATCCGGAAGCAAAAA
CGATGAAAGATATGCA
BamHI site is underlined
Reverse primer Macrogen CTTGTCGACTTATTCTTTCTCT
CCCTCATCAATACGTG
SalI site is underlined
nPfu-Forte Enzynomics P410 PCR polymerase
BamHI Enzynomics R003S
SalI Enzynomics R009S
pET49b expression vector Novagen 71463 Expression vector was modified to add affinity tags and BamHI/SalI sites10
T4 DNA ligase Enzynomics M001S
Dialysis memebrane Thermofisher 18265017
Dry block heater JSR JSBL-02T
LB broth (Luria-Bertani) LPS solution LB-05
LB Agar, Miller (Luria-Bertani) Becton, Dickinson and Company
Kanamycin LPS solution KAN025
Mini-prep kit Favorgen FAPDE300 Plasmid DNA preparation
BL21(DE3) Competent cell Novagen 69450-3CN
Isopropyl β-D-1-thiogalactopyranoside (IPTG) Fisher BioReagents 50-213-378
Sodium chloride Daejung 7548-4100 PBS material
Potassium chloride Daejung 6566-4405 PBS material
Potassium phosphate Bio Basic Inc PB0445 PBS material
Sodium phosphate Bio Basic Inc S0404 PBS material
Imidazole Bio Basic Inc IB0277
Sonicator Sonics VCX 130
Ni-NTA agaros Qiagen 30210 Nickel bead
Rotator Finepcr AG
Precision Plus Protein Dual Color Standards Bio-rad 1610374 SDS-PAGE protein standard
Coonmassie Brilliant Blue R-250 Fisher BioReagents BP101-25 Coomassie staining solution
Methyl alcohol Samchun chemical M0585 Coomassie staining solution
Acetic acid Daejung 1002-4105 Coomassie staining solution
Dialysis memebrane Thermofisher 68035
2-Mercaptoethanol Sigma-aldrich M6250
Thrombin Merckmillipore 605157-1KUCN Prepare aliquots of 20 μL (1 Unit per μL) and store at 70 °C and thaw before use
Superdex 200 16/600 General Electric 28989335 Size exclusion chromatography
Gel filtration standard Bio-rad 151-1901
Centrifugal filter Amicon UFC800396
Crystralization plates Hampton research HR3-083 96-well sitting drop plate
The JCSG core suite I-IV Qiagen 130924-130927 Crystallization secreening solution
Microscope Nikon SMZ745T
Cryschem plates Hampton research HR3-158 24-well sitting drop plate
Inorganic pyrophosphatase Sigma 10108987001
Ammonium molybdate solution Sigma 13106-76-8
L-ascorbic acid Sigma 50-81-7
NTP substrate Startagene 200415-51
Spectrophotometer Biotek SynergyH1 microplate reader
GraphPad Prism 5 GraphPad Prism 5 for Window

DOWNLOAD MATERIALS LIST

References

  1. Ivanova, N., et al. Genome sequence of Bacillus cereus and comparative analysis with Bacillus anthracis. Nature. 423, 87-91 (2003).
  2. Spencer, R. C. Bacillus anthracis. J Clin Pathol. 56, 182-187 (2003).
  3. Deli, A., et al. LmbE proteins from Bacillus cereus are de-N-acetylases with broad substrate specificity and are highly similar to proteins in Bacillus anthracis. FEBS J. 277, 2740-2753 (2010).
  4. Gross, M., Marianovsky, I., Glaser, G. MazG -- a regulator of programmed cell death in Escherichia coli. Mol Microbiol. 59, 590-601 (2006).
  5. Galperin, M. Y., Moroz, O. V., Wilson, K. S., Murzin, A. G. House cleaning, a part of good housekeeping. Mol Microbiol. 59, 5-19 (2006).
  6. Lee, S., et al. Crystal structure of Escherichia coli MazG, the regulator of nutritional stress response. J Biol Chem. 283, 15232-15240 (2008).
  7. Moroz, O. V., et al. Dimeric dUTPases, HisE, and MazG belong to a new superfamily of all-alpha NTP pyrophosphohydrolases with potential "house-cleaning" functions. J Mol Biol. 347, 243-255 (2005).
  8. Robinson, A., et al. A putative house-cleaning enzyme encoded within an integron array: 1.8 A crystal structure defines a new MazG subtype. Mol Microbiol. 66, 610-621 (2007).
  9. Moroz, O. V., et al. The crystal structure of a complex of Campylobacter jejuni dUTPase with substrate analogue sheds light on the mechanism and suggests the "basic module" for dimeric d(C/U)TPases. J Mol Biol. 342, 1583-1597 (2004).
  10. Green, M., Sambrook, J. Molecular cloning: A laboratory Manual. 1, John Inglis. (2012).
  11. Brown, T. A. Gene cloning an introduction. Chapman & Hall. (1986).
  12. Kim, M. I., Hong, M. Crystal structure of the Bacillus-conserved MazG protein, a nucleotide pyrophosphohydrolase. Biochem Biophys Res Commun. 472, 237-242 (2016).
  13. Sheehan, D. Physical biochemistry: Principles and applications. A John Wiley & Sons. (2009).
  14. Lesley, S. A., Wilson, I. A. Protein production and crystallization at the joint center for structural genomics. J Struct Funct Genomics. 6, 71-79 (2005).
  15. Jeon, Y. J., et al. Structural and biochemical characterization of bacterial YpgQ protein reveals a metal-dependent nucleotide pyrophosphohydrolase. J Struct Biol. 195, 113-122 (2016).
재조합 단백질 발현, 결정화 및 생물 물리학 연구<em&gt; 바실러스</em&gt; 보존 된 뉴클레오티드 피로 인산화 효소, BcMazG
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Kim, M. I., Lee, C., Hong, M. Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG. J. Vis. Exp. (123), e55576, doi:10.3791/55576 (2017).More

Kim, M. I., Lee, C., Hong, M. Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG. J. Vis. Exp. (123), e55576, doi:10.3791/55576 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter