Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biochemistry

Expressão de Proteína Recombinante, Cristalização e Estudos Biofísicos de doi: 10.3791/55576 Published: May 16, 2017

Summary

Bacillus anthracis é o agente patogénico obrigatório do antraz mortal por inalação, pelo que os estudos dos seus genes e proteínas são rigorosamente regulados. Uma abordagem alternativa é estudar genes ortólogos. Descrevemos estudos biofísico-químicos de um ortólogo de B. anthracis em B. cereus , bc1531, requerendo equipamento experimental mínimo e sem preocupações de segurança graves.

Abstract

Para superar as restrições e regulamentações de segurança ao estudar genes e proteínas de patógenos verdadeiros, seus homólogos podem ser estudados. Bacillus anthracis é um agente patogénico obrigatório que provoca o antraz mortal por inalação. Bacillus cereus é considerado um modelo útil para estudar B. anthracis devido à sua estreita relação evolutiva. O grupo de genes ba1554 - ba1558 de B. anthracis é altamente conservado com o cluster bc1531 - bc1535 em B. cereus , bem como com o cluster bt1364 - bt1368 em Bacillus thuringiensis, indicando o papel crítico dos genes associados no gênero Bacillus . Este manuscrito descreve métodos para preparar e caracterizar um produto proteico do primeiro gene ( ba1554 ) do grupo genético em B. anthracis usando uma proteína recombinante de seu ortholog em B. cereus , bc1531.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

A expressão de proteína recombinante é amplamente utilizada para superar problemas associados a fontes de proteína naturais, tais como quantidades limitadas de proteínas e contaminação prejudicial. Além disso, nos estudos de genes patogénicos e proteínas, uma estirpe laboratorial alternativa que não requer precauções adicionais de segurança pode ser utilizada. Por exemplo, Bacillus cereus é um modelo útil para estudar Bacillus anthracis devido à sua estreita relação evolutiva 1 .

B. anthracis é um agente patogénico obrigatório que provoca o antraz mortal por inalação em seres humanos e gado e pode potencialmente ser utilizado como arma biológica 2 . Assim, os estudos laboratoriais sobre B. anthracis são rigorosamente regulados pelos Centros de Controle de Doenças dos Estados Unidos, exigindo práticas de nível 3 de biossegurança (BSL-3), que determinam que a área do laboratório seja segregada com pressão negativa. Em contraste com B. anthracis B. cereus é categorizado como um agente BSL-1 e, portanto, tem preocupações mínimas de segurança. B. cereus é um patógeno oportunista que, após a infecção, provoca intoxicação alimentar que pode ser tratada sem assistência médica. No entanto, uma vez que B. cereus partilha muitos genes críticos com B. anthracis , as funções das proteínas de B. anthracis podem ser estudadas utilizando os correspondentes homólogos de B. cereus 1 .

O agrupamento de genes ba1554 - ba1558 de B. anthracis é altamente conservado com o agrupamento bc1531 - bc1535 De B. cereus , bem como com o grupo bt1364-bt1368 de Bacillus thuringiensis , em termos de organização e sequência de genes. Além disso, os primeiros genes ( ba1554 , bc1531 e bt1364 ) dos respectivos clusters são absolutamente conservados ( isto é, 100% de identidade de sequência de nucleótidos), implyiUm papel crítico do produto gênico nas espécies de Bacillus . Devido à sua localização nestes agrupamentos de genes, ba1554 foi mal identificado como um suposto transcrição regulador [ 3] . No entanto, a análise da sequência de aminoácidos do produto ba1554 indica que pertence à família MazG, que tem actividade de nucleótido pirofosfoidrolase e não está associada à actividade do factor de transcrição 4 , 5 . Embora as proteínas pertencentes à família MazG sejam diversas em relação à sequência e ao comprimento globais, partilham um domínio MazG comum de ~ 100 resíduos caracterizado por um motivo EXXE 12-28 EXXD ("X" significa qualquer resíduo de aminoácido e o número Indica o número de resíduos X).

O domínio MazG nem sempre representa diretamente uma determinada atividade catalítica. Um membro MazG de Escherichia coli (EcMazG) possui dois domínios MazG, mas emO domínio MazG C-terminal é enzimaticamente activo 6 . Além disso, a especificidade do substrato de enzimas MazG varia de nucleosídeos trifosfatos não específicos (para EcMazG) para dCTP / dATP específicos (para integrados MazG) e dUTP (para dUTPases) 6 , 7 , 8 , 9 . Por conseguinte, são necessárias análises biofísicoquímicas da proteína BA1554 para confirmar a sua actividade NTPase e para decifrar a sua especificidade de substrato.

Aqui, fornecemos um protocolo passo a passo que a maioria dos laboratórios sem uma instalação BSL-3 pode seguir para caracterizar o produto proteico do gene B. cereus bc1531 , que é um ortholog de B. anthracis ba1554 , a nível molecular. Resumidamente, BC1531 recombinante (rBC1531) foi expresso em E. coli e purificado utilizando um marcador de afinidade. Para experimentos cristalográficos de raios X,Zação da proteína rBC1531 foram selecionadas e otimizadas. Para avaliar a actividade enzimática de rBC1531, a actividade de NTPase foi monitorizada colorimetricamente para evitar nucleótidos marcados radioactivamente que foram convencionalmente utilizados. Finalmente, as análises dos dados biofísico-químicos obtidos nos permitiram determinar o estado de oligomerização e os parâmetros catalíticos de rBC1531, bem como obter dados de difração de raios X a partir do cristal rBC1531.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Produção e Purificação de Proteína Recombinante de rBC1531

  1. Prepara�o de um plasm�eo de express� da prote�a BC1531 recombinante (rBC1531)
    1. Preparar DNA genômico de B. cereus 10 .
    2. Amplificar o gene bc1531 a partir de um molde de ADN genómico de B. cereus por reacção em cadeia com polimerase (PCR), utilizando iniciadores directos e inversos (ver a Lista de Materiais) para criar locais de enzimas de restrição Bam HI e Sal I, respectivamente 10 .
    3. Digerir o produto de PCR e um vector pET49b modificado (pET49bm) utilizando Bam HI e Sal I, como descrito 11 .
    4. Mistura-se o produto de PCR digerido e o vector (razão 3: 1) do passo 1.1.3 utilizando ADN-ligase de T4 numa reacção de 10 μL, tal como descrito 11 . Incubar a 18 ° C durante 30 min.
    5. Pipetar 3 μL da reação de ligação em 50 μL deLmente células E. coli DH5α competentes num tubo. Misture suavemente pipetando para cima e para baixo e coloque em gelo por 30 min. Choque térmico durante 45 s a 42 ° C. Adicionar 1 mL de meio Luria-Bertani (LB) e crescer as células enquanto agita vigorosamente (250 rpm, 37 ° C, 45 min).
    6. Tomar 100 μL das células transformadas do passo 1.1.6 e espalhá-las sobre as placas LB-agar com 100 μg / mL de canamicina (Kan). Incubar durante ~ 18 h a 37 ° C.
    7. Escolher as col�ias utilizando uma ponta est�il e cultivar as c�ulas em 3 mL de meio LB com 100 � / mL de Kan; Agitar vigorosamente (250 rpm, 37 ° C, 18 h).
    8. Preparar o ADN plasmídico utilizando um método de lise alcalino-SDS, como descrito 10 .
    9. Confirmar a sequência nucleotídica da construção da expressão de rBC1531 utilizando sequenciação de ADN 12 .
  2. A sobre-expressão da proteína rBC1531
    1. Re-transformar a estirpe E. coli BL21 (DE3) com rBC1531-expPlasm�eo de ress�io, tal como descrito nos passos 1.1.5-1.1.6, para sobre-express�.
    2. Selecione uma colônia e cresça em 10 mL de meio LB contendo 50 μg / mL de Kan (LB + Kan); Agitar vigorosamente durante 18 h a 37 ° C.
    3. Inocular 10 mL de cultura durante a noite em 1 L de meio LB + Kan e crescer a 37 ° C até a DO 600 (densidade óptica a 600 nm) atingir ~ 0,7.
    4. Submergir a cultura em água gelada durante ~ 15 min para arrefecer a temperatura para 18 ° C e adicionar isopropil β-D-1-tiogalactopiranósido (IPTG) à cultura a uma concentração final de 1 mM para a expressão da proteína recombinante. Cultivar a cultura a 18 ° C durante um período adicional de ~ 16-18 h.
  3. Purificação de rBC1531
    1. Colher as células por centrifugação (5.000 xg, 4 ° C, 30 min). Descartar o sobrenadante com cuidado para não perturbar as células. Re-suspender as células em 50 ml de solução salina tamponada com fosfato (PBS) contendo imidazole 10 mM.
    2. Lyse as células duas vezes por sonicação em gelo para evitar o excesso de aquecimento dos lisados ​​celulares (tempo: 2 min 30 s, ciclo em: 5 s, ciclo off: 10 s, amplitude: 38%).
    3. Limpar o lisado celular por centrifugação (~ 25 000 xg, 4 ° C, 30 min).
    4. Misture 3 mL de esferas de níquel e 60 mL de PBS contendo imidazole 10 mM e extraia o tampão extra para depositar as esferas de níquel equilibradas numa coluna de cromatografia de vidro 2,5 x 10 cm.
    5. Pipetar para transferir o sobrenadante do passo 1.3.3 para a coluna com esferas de níquel pré-equilibradas e incubar a 4 ° C durante 2 h num rolo de fiar a uma velocidade baixa (~ 20 rpm).
    6. Deixar o sobrenadante drenar por gravidade e lavar as esferas de níquel na coluna três vezes com 100 mL de PBS contendo imidazole 10 mM.
    7. Eluir a proteína rBC1531 aplicando 4 x 5 mL de PBS contendo imidazole 250 mM.
    8. Tomar 15 μL da eluição do passo 1.3.7 e executá-la em SDS-PAGE a 15%. Visualize as bandas de proteínasO gel usando colora�o azul de Coomassie 10 .
  4. A remoção dos marcadores de afinidade da proteína rBC1531 por proteólise de trombina
    1. Pipetar as fracções em tubo de diálise (peso molecular cortado: 3 kDa) e colocar o tubo num copo contendo 4 L de tampão compatível com a clivagem da trombina (HEPES 20 mM, pH 7,4, NaCl 150 mM e P-mercaptoetanol 1,5 mM) A 4 ° C durante a noite.
    2. Pipetar as frações e transferi-los para um tubo cônico.
    3. Medir a absorvância a 280 nm e estimar a concentração de proteína rBC1531, conforme descrito 13 .
    4. Tomar 50 μg de rBC1531 num tubo de 0,5 ml e adicionar várias quantidades de trombina ( ie, 2, 1, 0,6 e 0,3 unidades). Incubar as reacções rBC1531 e trombina a 20 ° C durante ~ 3 h para determinar a menor quantidade de trombina necessária para clivar o marcador de afinidade N-terminal.
    5. Executar o rBC1531 e reações de trombina em um 15%SDS-PAGE e determinam a quantidade mais baixa de trombina ( por exemplo, 0,3 unidades de trombina por 50 μg de rBC1531) que digerem completamente o marcador de afinidade N-terminal e produzem um rBC1531 livre de marcadores.
    6. Adicionar 10 mg de proteína rBC1531 e 60 unidades de trombina a um tubo de 15 mL e incubar a 20 ° C durante ~ 3 h para a reacção de proteólise de trombina.
    7. Aplicar padrões de filtração de gel a uma coluna de cromatografia de exclusão de tamanho (SEC) para preparar uma curva padrão de pesos moleculares e volumes de eluição, conforme descrito 13 .
    8. Colocar a proteína rBC1531 digerida com trombina do passo 1.4.6 num tubo de filtro centrífugo (peso molecular cortado: 3 kDa) e centrifugar a 3000 g a 4 ° C para reduzir até um volume inferior a 5 mL.
    9. Aplicar a proteína rBC1531 concentrada na coluna SEC e recolher 60 fracções eluídas em 0,5 mL por tubo 13 .
    10. Tomar 15 μL de cada fração, executá-los em uma SDS-PAGE a 15%, e staiN o gel utilizando uma solução de coloração com Coomassie (azul brilhante de Coomassie 0,15% (p / v), metanol a 40% (v / v) e ácido acético glacial a 10% (v / v) como descrito 10 .
    11. Pipetar as frações que contêm rBC1531 e coletá-las em um tubo.

2. Triagem de Cristalização e Optimização de rBC1531

  1. Condições de rastreio para a cristalização da proteína rBC1531
    1. Concentrar o rBC1531 do passo 1.4.11 até ~ 18,5 mg / mL usando um tubo de filtro centrífugo, como descrito no passo 1.4.8.
    2. Adicionar 50 μL de cada solução de rastreio de cristalização (ver secção 2.2) 14 aos poços de placas de cristalização de 96 poços sentadas. Colocar 0,5 μL da solução de proteína rBC1531 de 18,5 mg / mL numa cama sentada. Misturar a solução de proteína com 0,5 μL da solução do poço, repetindo o processo para toda a placa.
    3. Cubra a placa com filme adesivo transparente.Colocar as placas de 96 poços a 18 ° C e permitir a difusão de vapor.
    4. Digitalize as gotas com uma ampliação de 20-40X usando um microscópio de luz para monitorar a formação de cristais diariamente durante 2-3 semanas.
    5. Recolher dados de difracção de raios X 12 utilizando os cristais de proteína rBC1531 obtidos.
  2. Otimização das condições de cristalização de rBC1531
    1. Preparar 500 μL da solução de condição de cristalização inicial seleccionada ( eg, cacodilato de sódio 0,1 M, pH 6,5 e citrato de sódio 1,0 M) e encher uma placa de cristalização de 24 poços para a gota sentada.
    2. Adicionar 0,5 μL da solução de proteína rBC1531 a 18,5 mg / mL a um leito sentado, misturar com 0,5 μL da solução do poço e cobrir imediatamente a placa com película adesiva transparente. Colocar a placa a 18 ° C.
    3. Observe o crescimento do cristal sob um microscópio de luz por uma semana.
    4. Otimizar várias condições de cristalização variando o pH ( ie, PH 5,5-6,8) de cacodilato 0,1 M e alterando a concentração de sal ( isto é, 0,9-1,2 M) de citrato de sódio para se obter cristais singulares. Monitorar o crescimento do cristal durante ~ 1 semana e coletar dados de difração de raios-X 12 .

3. Caracterização da Actividade Nucleósido Trifosfatase (NTPase) de rBC1531

  1. Validação do estudo colorimétrico inorgânico dependente de fosfato
    1. Preparar uma reserva de pirofosfato (100 mM) e dilui-la até concentrações finais de 0,1, 0,25, 0,5, 1,0, 5,0, 10, 50, 100 e 250 μM em 200 μL de tampão de reacção (HEPES 20 mM, pH 7,4; 150 MM de NaCl e 2 mM de MgCl2) em placas de 96 poços em duplicado. Utilizar a primeira placa como controlo (isto não contém pirofosfatase). Certifique-se de que a segunda placa contém pirofosfatase como placa de trabalho, conforme indicado no passo 3.1.2.
    2. Adicionar 0,01 unidades de Saccharomyces cerevisiae p inorgânicoYrophosphatase (1 μL) aos poços da placa de trabalho e incubar a 20 ° C durante 30-60 min.
    3. Preparar solução de ácido molibdato misturando soluções de molibdato de amónio (0,86% v / v) e ácido ascórbico (14% v / v) numa proporção de 7: 3. Adicione 16 μL de solução de ácido molibdato aos poços de trabalho e controle e aguarde 15 min.
    4. Ler a densidade óptica a 690 nm (OD 690 nm).
  2. Ensaio colorimétrico de NTPase
    1. Preparar uma reserva de substrato de nucleósido trifosfato (NTP) 100 mM e diluir até à concentração desejada ( eg 0, 0,2, 4,4, 11, 22, 44, 88 ou 132 μM) em 180 μL de tampão de ensaio (HEPES 20 mM, PH 7,4, NaCl 150 mM e MgCl2 2 mM).
    2. Adicionar 20 μg de rBC1531 (1,5 mM) e os substratos NTP do passo 3.2.1 até 200 μL por reacção numa placa de 96 poços e pipetar para cima e para baixo para misturar bem. Cobrir a placa com a sua tampa e colocá-lo em uma incubadora a 37 ° C por 30 minPara realizar a reacção de hidrólise do substrato.
    3. Transferir a placa para um banho de água a 70 ° C e deixar em repouso durante 15 minutos para parar as reacções catalíticas mediadas por rBC1531.
    4. Adicionar 0,01 unidade de pirofosfatase inorgânica de S. cerevisiae (1 μL) a cada poço da placa de reacção (do passo 3.2.3) e incubar a 20 ° C durante 30 min. Adicionar 16 μL de solução de ácido molibdato à placa de reação para desenvolver a cor (~ 15 min). Ler a OD 690nm .
    5. Analise usando a equação de Michaelis-Menten, como descrito 12 .

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

A caracterização da proteína de interesse neste estudo começou por preparar uma quantidade suficiente de proteína Bc1531 (rBC1531) recombinante de B. cereus , de preferência mais do que vários miligramas. O fragmento de ADN que codifica a proteína BC1531 foi preparado por PCR utilizando o ADN genómico de B. cereus como molde, uma vez que contém genes ortólogos idênticos a ba1554 . RBC1531 foi sobre-expresso como uma proteína solúvel em células de E. coli . A proteína rBC1531 foi expressa com um marcador 6x-Histidina e um local de clivagem de trombina no seu terminal N 12 . Como um primeiro passo de purificação, rBC1531 foi purificado por cromatografia de afinidade de níquel ( Figura 1A ). Em seguida, realizou-se um ensaio de digestão com trombina para determinar a menor quantidade de trombina necessária para a digestão completa do marcador de afinidade de rBC1531 ( Figura 1A ). Em nossas mãos, 0,3 unidades de trombina foram sufPara remover completamente a marca de afinidade de rBC1531. Assim, quando se escalava, tratou-se 10 mg de rBC1531 com 60 unidades de trombina para remoção da marca. Após digestão com trombina, o rBC1531 isento de marcação foi aplicado a uma coluna SEC para remover quaisquer agregados solúveis e contaminantes de peso molecular mais elevado ou mais baixo. As fracções rBC1531 foram analisadas por SDS-PAGE, cujos resultados sugeriram que rBC1531 era ~ 99% puro ( Figura 1A ). Em geral, 1 L de cultura produziu ~ 8 mg de proteína rBC1531.

Para estimar o estado oligomérico de rBC1531, SEC foi realizada. Foi traçada uma curva linear padrão que correlaciona o valor logarítmico dos pesos moleculares das amostras com os respectivos volumes de eluição utilizando os picos dos padrões de proteína ( Figura 1B ). RBC1531 foi eluído a um volume de eluição de ~ 84 mL, e o seu peso molecular aparente foi estimado como ~ 55 kDa. Dado que o calculado molecular nósIght do monómero rBC1531 é ~ 13 kDa, estes resultados indicam que o rBC1531 se monta como um tetrâmero.

O rBC1531 purificado foi rastreado para cristalização usando ~ 400 condições num método de difusão de vapor de sessão-gota. Os cristais rBC1531 apareceram em ~ 2 dias em duas condições: condição A, citrato de sódio 0,1 M (pH 5,5) e 20% PEG 3000 ( Figura 2A ) e condição B, cacodilato de sódio 0,1 M (pH 6,5) e sódio 1,0 M Citrato ( Figura 2B ). As condições de cristalização foram optimizadas variando o pH (citrato de sódio 0,1 M, pH 5,0-6,0) e a concentração de PEG 3000 (18-21% PEG 3000) da condição A e modificando o pH (cacodilato de sódio 0,1 M, pH 5,5-6,8) e concentração de sal (citrato de sódio 0,9-1,2 M) da condição-B. Os cristais adequados à difracção foram obtidos apenas para a condição B, enquanto que os cristais da condição A tenderam a ser inter-cultivados em vez de singulares. Cristais da condição BDifractadas para uma resolução de 2,74 Å ( Figura 2C ) e foram utilizadas para a determinação da estrutura de rBC1531.

A observação de um domínio MazG conservado na sequência da proteína BA1554 sugeriu a presença de actividade de NTPase capaz de hidrolisar NTPs. A hidrólise de NTP geralmente produz nucleosídeo difosfato (NDP) e fosfato inorgânico (Pi), ou nucleósido monofosfato (NMP) e pirofosfato (PPi). PPi requer actividade de pirofosfatase adicional para produzir Pi. Os n�eis de Pi podem ser directamente medidos utilizando molibdato, que forma um complexo de cor azul com Pi (molibdato-Pi) que pode ser monitorizado utilizando a densidade �tica a um comprimento de onda de 690 nm (OD 3 690 nm) ( Figura 3A ). Em nosso estudo, após a hidrólise de NTP por rBC1531, não foi produzida cor azul visível após a adição de molibdato ( Figura 3B ). No entanto, quando se adicionou pirofosfatase à hidrólise de NTP mediada por rBC1531 rEaction, a cor mudou para azul profundo ( Figura 3B ), indicando que rBC1531 tem NTP pirofosfo-hidrolase actividade. Um gráfico da concentração de DO 690nm e NTP foi analisado utilizando um método de regressão não linear para determinar os parâmetros cinéticos ( Vmax de 0,75 e Km de 10 μM) para a enzima rBC1531 ( Figura 3C ).

figura 1
Figura 1: SDS-PAGE e análise de cromatografia de exclusão de tamanho (SEC). ( A ) Análise SDS-PAGE de rBC1531. (Esquerda) Os picos de elui�o de rBC1531 de cromatografia de afinidade de n�uel (pista 2, Ni) e SEC (pista 3) foram analisados ​​juntamente com padr�s de prote�a (pista 1 marcada em kDa). (Direita) Análise da digestão da trombina de rBC1531 para a remoção da marca de afinidade. As quantidades de trombina adicionadas a 50 μg de rBC1531 em diferentes reacções são indEm unidades acima do gel. ( B ) Análise de cromatografia de exclusão de tamanho (SEC) de rBC1531 e padrões de proteína. (Esquerda) Perfis de eluição de rBC1531 (azul) e padrões (vermelho). Os pesos moleculares das proteínas padrão são mostrados acima de cada pico, em kDa. Os eixos vertical (y) e horizontal (x) mostram as unidades de mili-absorção (mAU a 280 nm) e volumes de retenção (mL), respectivamente. (À direita) O tamanho molecular aparente de rBC1531 foi estimado utilizando um gráfico linear para os pesos moleculares, em escala logarítmica e volumes de eluição de padrões de proteínas (R2 = 0,9934). Clique aqui para ver uma versão maior desta figura.

Figura 2
Figura 2: Cristalização e difração de raios-X. ( A ) cristais rBC1531 em condições( B ) cristais de rBC1531 na condição B, cacodilato de sódio 0,1 M (pH 6,5) e citrato de sódio 1,0 M (pH 5,5) e 20% de PEG 3000. São apresentados cristais iniciais (esquerda) e optimizados (médio e direito). Utilizou-se o cristal optimizado rBC1531 (direito, ~ 0,35 mm x ~ 0,35 mm x ~ 0,20 mm) para difracção de raios-X. Barras de escala = 100 μm. ( C ) imagem de difracção de raios X do cristal rBC1531 obtido na linha de luz PAL BL-7A 12 . A seta indica um ponto de alta resolução. Clique aqui para ver uma versão maior desta figura.

Figura 3
Figura 3: Actividade da NTPase. ( A ) A formação do complexo molibdénio-Pi é dependente da concentração de Pi. A densidade óptica a 690 nm é diAssociado com aumento nos níveis de Pi. O eixo Y e o eixo X representam a DO 690nm ea concentração (μM) de Pi, respectivamente. ( B ) A cor muda com a adição de pirofosfatase. Na primeira fila de poços, a pirofosfatase não foi adicionada e não formou o complexo Pi de cor azul. No entanto, a segunda fila consiste em poços nos quais as reacções rBC1531-NTP foram tratadas com pirofosfatase e desenvolveram uma cor azul. Os valores de OD 690nm aumentaram com o aumento das concentrações de NTP. ( C ) Traço de Michaelis-Menten das reacções rBC1531-NTP. O eixo Y e o eixo X representam a DO 690nm ea concentração (0-120 μM) de substratos NTP, respectivamente. As barras de erro representam o desvio padrão para três experiências separadas. Clique aqui para ver uma versão maior desta figura.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores não têm nada a revelar.

Acknowledgments

Os conjuntos de dados de difracção de raios X foram recolhidos na linha 7A do Laboratório de Aceleração de Pohang (Coreia). Este estudo foi apoiado pelo Programa de Investigação Científica Básica administrado através da Fundação Nacional de Investigação da Coreia (NRF), financiado pelo Ministério da Ciência, TIC e Planeamento do Futuro (2015R1A1A01057574 a MH).

Materials

Name Company Catalog Number Comments
Bacillus cereus ATCC14579 Korean Collection for Tissue Culture 3624
Genomic DNA prep kit GeneAll 106-101 Genomic DNA preparation
Forward primer Macrogen GAAGGATCCGGAAGCAAAAA
CGATGAAAGATATGCA
BamHI site is underlined
Reverse primer Macrogen CTTGTCGACTTATTCTTTCTCT
CCCTCATCAATACGTG
SalI site is underlined
nPfu-Forte Enzynomics P410 PCR polymerase
BamHI Enzynomics R003S
SalI Enzynomics R009S
pET49b expression vector Novagen 71463 Expression vector was modified to add affinity tags and BamHI/SalI sites10
T4 DNA ligase Enzynomics M001S
Dialysis memebrane Thermofisher 18265017
Dry block heater JSR JSBL-02T
LB broth (Luria-Bertani) LPS solution LB-05
LB Agar, Miller (Luria-Bertani) Becton, Dickinson and Company
Kanamycin LPS solution KAN025
Mini-prep kit Favorgen FAPDE300 Plasmid DNA preparation
BL21(DE3) Competent cell Novagen 69450-3CN
Isopropyl β-D-1-thiogalactopyranoside (IPTG) Fisher BioReagents 50-213-378
Sodium chloride Daejung 7548-4100 PBS material
Potassium chloride Daejung 6566-4405 PBS material
Potassium phosphate Bio Basic Inc PB0445 PBS material
Sodium phosphate Bio Basic Inc S0404 PBS material
Imidazole Bio Basic Inc IB0277
Sonicator Sonics VCX 130
Ni-NTA agaros Qiagen 30210 Nickel bead
Rotator Finepcr AG
Precision Plus Protein Dual Color Standards Bio-rad 1610374 SDS-PAGE protein standard
Coonmassie Brilliant Blue R-250 Fisher BioReagents BP101-25 Coomassie staining solution
Methyl alcohol Samchun chemical M0585 Coomassie staining solution
Acetic acid Daejung 1002-4105 Coomassie staining solution
Dialysis memebrane Thermofisher 68035
2-Mercaptoethanol Sigma-aldrich M6250
Thrombin Merckmillipore 605157-1KUCN Prepare aliquots of 20 μL (1 Unit per μL) and store at 70 °C and thaw before use
Superdex 200 16/600 General Electric 28989335 Size exclusion chromatography
Gel filtration standard Bio-rad 151-1901
Centrifugal filter Amicon UFC800396
Crystralization plates Hampton research HR3-083 96-well sitting drop plate
The JCSG core suite I-IV Qiagen 130924-130927 Crystallization secreening solution
Microscope Nikon SMZ745T
Cryschem plates Hampton research HR3-158 24-well sitting drop plate
Inorganic pyrophosphatase Sigma 10108987001
Ammonium molybdate solution Sigma 13106-76-8
L-ascorbic acid Sigma 50-81-7
NTP substrate Startagene 200415-51
Spectrophotometer Biotek SynergyH1 microplate reader
GraphPad Prism 5 GraphPad Prism 5 for Window

DOWNLOAD MATERIALS LIST

References

  1. Ivanova, N., et al. Genome sequence of Bacillus cereus and comparative analysis with Bacillus anthracis. Nature. 423, 87-91 (2003).
  2. Spencer, R. C. Bacillus anthracis. J Clin Pathol. 56, 182-187 (2003).
  3. Deli, A., et al. LmbE proteins from Bacillus cereus are de-N-acetylases with broad substrate specificity and are highly similar to proteins in Bacillus anthracis. FEBS J. 277, 2740-2753 (2010).
  4. Gross, M., Marianovsky, I., Glaser, G. MazG -- a regulator of programmed cell death in Escherichia coli. Mol Microbiol. 59, 590-601 (2006).
  5. Galperin, M. Y., Moroz, O. V., Wilson, K. S., Murzin, A. G. House cleaning, a part of good housekeeping. Mol Microbiol. 59, 5-19 (2006).
  6. Lee, S., et al. Crystal structure of Escherichia coli MazG, the regulator of nutritional stress response. J Biol Chem. 283, 15232-15240 (2008).
  7. Moroz, O. V., et al. Dimeric dUTPases, HisE, and MazG belong to a new superfamily of all-alpha NTP pyrophosphohydrolases with potential "house-cleaning" functions. J Mol Biol. 347, 243-255 (2005).
  8. Robinson, A., et al. A putative house-cleaning enzyme encoded within an integron array: 1.8 A crystal structure defines a new MazG subtype. Mol Microbiol. 66, 610-621 (2007).
  9. Moroz, O. V., et al. The crystal structure of a complex of Campylobacter jejuni dUTPase with substrate analogue sheds light on the mechanism and suggests the "basic module" for dimeric d(C/U)TPases. J Mol Biol. 342, 1583-1597 (2004).
  10. Green, M., Sambrook, J. Molecular cloning: A laboratory Manual. 1, John Inglis. (2012).
  11. Brown, T. A. Gene cloning an introduction. Chapman & Hall. (1986).
  12. Kim, M. I., Hong, M. Crystal structure of the Bacillus-conserved MazG protein, a nucleotide pyrophosphohydrolase. Biochem Biophys Res Commun. 472, 237-242 (2016).
  13. Sheehan, D. Physical biochemistry: Principles and applications. A John Wiley & Sons. (2009).
  14. Lesley, S. A., Wilson, I. A. Protein production and crystallization at the joint center for structural genomics. J Struct Funct Genomics. 6, 71-79 (2005).
  15. Jeon, Y. J., et al. Structural and biochemical characterization of bacterial YpgQ protein reveals a metal-dependent nucleotide pyrophosphohydrolase. J Struct Biol. 195, 113-122 (2016).
Expressão de Proteína Recombinante, Cristalização e Estudos Biofísicos de<em&gt; Bacillus</em&gt; -conservado Nucleotide Pyrophosphorylase, BcMazG
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Kim, M. I., Lee, C., Hong, M. Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG. J. Vis. Exp. (123), e55576, doi:10.3791/55576 (2017).More

Kim, M. I., Lee, C., Hong, M. Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG. J. Vis. Exp. (123), e55576, doi:10.3791/55576 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter