Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biochemistry

Рекомбинантная экспрессия белков, кристаллизация и биофизические исследования doi: 10.3791/55576 Published: May 16, 2017

Summary

Bacillus anthracis является облигатным возбудителем фатальной ингаляционной сибирской язвы, поэтому исследования его генов и белков строго регламентированы. Альтернативный подход - изучение ортологичных генов. Мы описываем биофизико-химические исследования ортолога B. anthracis в B. cereus , bc1531, требующие минимального экспериментального оборудования и не имеющих серьезных проблем с безопасностью.

Abstract

Чтобы преодолеть ограничения безопасности и правила при изучении генов и белков от истинных патогенов, их гомологи могут быть изучены. Bacillus anthracis является облигатным возбудителем, вызывающим смертельную ингаляционную сибирскую язву. Bacillus cereus считается полезной моделью для изучения B. anthracis из-за ее тесной эволюционной взаимосвязи. Ген кластера ba1554 - ba1558 B. anthracis высококонсервативен с кластером bc1531 - bc1535 у B. cereus , а также с bt1364 - bt1368 кластером в Bacillus thuringiensis, что указывает на критическую роль ассоциированных генов в роде Bacillus . В этой рукописи описаны методы получения и характеристики белкового продукта первого гена ( ba1554 ) из кластера генов B. anthracis с использованием рекомбинантного белка его ортолога в B. cereus , bc1531.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Рекомбинантная экспрессия белка широко используется для преодоления проблем, связанных с природными источниками белка, таких как ограниченное количество белка и вредное загрязнение. Более того, в исследованиях патогенных генов и белков может быть использован альтернативный лабораторный штамм, который не требует дополнительных мер предосторожности. Например, Bacillus cereus является полезной моделью для изучения Bacillus anthracis из-за их тесной эволюционной связи 1 .

B. anthracis является облигатным возбудителем , который вызывает смертельную ингаляционную сибирскую язву у людей и животных и может потенциально использоваться в качестве биологического оружия 2 . Таким образом, лабораторные исследования B. anthracis строго регулируются Центрами США по контролю за заболеваниями, требующими практики биобезопасности 3 (BSL-3), в соответствии с которой лабораторная зона должна быть изолирована с отрицательным давлением в помещении. В отличие от B. anthracis B. cereus классифицируется как агент BSL-1 и, следовательно, имеет минимальные проблемы безопасности. B. cereus - это оппортунистический патоген, который после заражения вызывает пищевое отравление, которое можно лечить без медицинской помощи. Однако, поскольку B. cereus разделяет многие критические гены с B. anthracis , функции белков B. anthracis могут быть изучены с использованием соответствующих гомологов B. cereus 1 .

Ген кластера ba1554 - ba1558 B. anthracis высококонсервативен с использованием кластера bc1531 - bc1535 B. cereus , а также с bt1364-bt1368 кластером Bacillus thuringiensis , с точки зрения организации и последовательности гена. Кроме того, первые гены ( ba1554 , bc1531 и bt1364 ) соответствующих кластеров абсолютно сохраняются ( т.е. идентичность 100% нуклеотидной последовательности), impliНг критической роли генный продукт в Bacillus видов. Из-за его расположения в этих кластерах генов ba1554 был ошибочно идентифицирован как предполагаемый регулятор транскрипции 3 . Однако анализ аминокислотной последовательности продукта ba1554 показывает, что он относится к семейству MazG, которое обладает нуклеотидной пирофосфогидролазной активностью и не связано с активностью транскрипционных факторов 4 , 5 . Хотя белки, принадлежащие к семейству MazG, разнообразны по отношению к общей последовательности и длине, они имеют общий ~ 100 остаточный домен MazG, характеризующийся мотивом EXXE 12-28 EXXD («X» обозначает любой аминокислотный остаток, а число Указывает количество X остатков).

Домен MazG не всегда непосредственно учитывает определенную каталитическую активность. Член MazG от Escherichia coli (EcMazG) обладает двумя доменами MazG, но наС-концевой домен MazG является ферментативно активным 6 . Более того, субстратная специфичность ферментов MazG варьирует от неспецифических нуклеозидтрифосфатов (для EcMazG) до специфических dCTP / dATP (для интегрина-ассоциированного MazG) и dUTP (для dUTPases) 6 , 7 , 8 , 9 . Таким образом, биофизикохимические анализы белка BA1554 необходимы для подтверждения его активности NTP-азы и для расшифровки его субстратной специфичности.

Здесь мы приводим поэтапный протокол, согласно которому большинство лабораторий без BSL-3 могут следовать, чтобы охарактеризовать белковый продукт гена B.cereus bc1531 , который является ортологом B. anthracis ba1554 на молекулярном уровне. Вкратце, рекомбинантный BC1531 (rBC1531) экспрессировали в E.coli и очищали с использованием метки аффинности. Для рентгеновских кристаллографических экспериментов кристаллыУсловия белка rBC1531 были скринированы и оптимизированы. Для оценки ферментативной активности rBC1531 активность NTPазы контролировали колориметрически, чтобы избежать радиоактивно меченых нуклеотидов, которые традиционно использовались. Наконец, анализ полученных биофизикохимических данных позволил нам определить состояние олигомеризации и каталитические параметры rBC1531, а также получить данные рентгеноструктурного анализа кристалла rBC1531.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Получение и очистка рекомбинантного белка rBC1531

  1. Получение рекомбинантной белковой плазмиды BC1531 (rBC1531)
    1. Готовят геномную ДНК B. cereus 10 .
    2. Амплифицировать ген bc1531 из матрицы геномной ДНК B. cereus путем полимеразной цепной реакции (ПЦР) с использованием прямых и обратных праймеров (см. Список материалов) для создания сайтов рестрикционных ферментов Bam HI и Sal I, соответственно 10 .
    3. Дайте продукт ПЦР и модифицированный вектор pET49b (pET49bm), используя Bam HI и Sal I, как описано 11 .
    4. Смешайте переваренный продукт ПЦР и вектор (соотношение 3: 1) с этапа 1.1.3 с использованием ДНК-лигазы Т4 в 10 мкл реакции, как описано 11 . Инкубируйте при температуре 18 ° С в течение 30 мин.
    5. Внесите 3 мкл реакции лигирования в 50 мкл chemicaLly компетентных клеток E.coli DH5α в пробирке. Аккуратно перемешайте пипеткой вверх и вниз и поставьте на лед в течение 30 мин. Тепловой удар в течение 45 с при 42 ° С. Добавить 1 мл среды Luria-Bertani (LB) и выращивать клетки при энергичном встряхивании (250 об / мин, 37 ° С, 45 мин).
    6. Возьмите 100 мкл трансформированных клеток из стадии 1.1.6 и распределите их на чашки с LB-агаром со 100 мкг / мл канамицина (Kan). Инкубируйте в течение ~ 18 ч при 37 ° C.
    7. Выбирают колонии, используя стерильный наконечник, и выращивают клетки в 3 мл среды LB со 100 мкг / мл Kan; Энергично встряхивают (250 об / мин, 37 ° C, 18 часов).
    8. Подготовьте плазмидную ДНК, используя метод лизис-щелочной SDS, как описано 10 .
    9. Подтвердите нуклеотидную последовательность экспрессии rBC1531 с использованием секвенирования ДНК 12 .
  2. Сверхэкспрессия белка rBC1531
    1. Повторно трансформируйте штамм Е. coli BL21 (DE3) с помощью rBC1531-expКак описано в шагах 1.1.5-1.1.6, для сверхэкспрессии.
    2. Выберите колонию и произведите ее в 10 мл среды LB, содержащей 50 мкг / мл Kan (LB + Kan); Энергично встряхивают в течение 18 ч при 37 ° C.
    3. Инокулируют 10 мл культуры в течение ночи в 1 л среды LB + Kan и растут при 37 ° С до тех пор, пока оптическая плотность при 600 нм не достигнет ~ 0,7.
    4. Погрузите культуру в ледяную воду на ~ 15 минут, чтобы охладить температуру до 18 ° C и добавьте к культуральной среде изопропил -D-1-тиогалактопиранозид (IPTG) в конечной концентрации 1 мМ для экспрессии рекомбинантного белка. Выращивайте культуру при температуре 18 ° C в течение дополнительных ~ 16-18 часов.
  3. Очистка rBC1531
    1. Собирают клетки центрифугированием (5000 xg, 4 ° C, 30 минут). Тщательно удаляйте надосадочную жидкость, чтобы не мешать клеткам. Повторно суспендируют клетки в 50 мл раствора фосфатно-буферного солевого раствора (PBS), содержащего 10 мМ имидазола.
    2. Люси клетки дважды обработкой ультразвуком на льду, чтобы предотвратить перегрев клеточных лизатов (время: 2 мин 30 с, цикл на: 5 с, цикл выключен: 10 с, амплитуда: 38%).
    3. Очистите клеточный лизат центрифугированием (~ 25000 × g, 4 ° C, 30 мин).
    4. Смешайте 3 мл никелевых шариков и 60 мл PBS, содержащего 10 мМ имидазола, и процедите через гравитацию дополнительного буфера для осаждения уравновешенных никелевых гранул в колонке для хроматографии на 2,5 х 10 см.
    5. Пипетку переносят супернатант с этапа 1.3.3 на колонку с предварительно уравновешенными никелевыми шариками и инкубируют при 4 ° С в течение 2 ч на прядильном колесе с низкой скоростью (~ 20 об / мин).
    6. Позвольте супернатанту стекать под действием силы тяжести и промывайте никелевые шарики в колонке три раза 100 мл PBS, содержащего 10 мМ имидазола.
    7. Элюируют белок rBC1531, применяя 4 × 5 мл PBS, содержащего 250 мМ имидазола.
    8. Берут 15 мкл элюирования с этапа 1.3.7 и запускают его на 15% SDS-PAGE. Визуализируйте полосы белка наГель с использованием окраски Кумасси синим 10 .
  4. Удаление аффинных меток белка rBC1531 протеолизом тромбина
    1. Пипетируют фракции в диализную пробирку (молекулярная масса отсекают: 3 кДа) и помещают пробирку в стакан, содержащий 4 л совместимого с расщеплением тромбина буфера (20 мМ HEPES, рН 7,4, 150 мМ NaCl и 1,5 мМ β-меркаптоэтанола) При 4 ° С в течение ночи.
    2. Внесите фракции и перенесите их в коническую трубку.
    3. Измерьте поглощение при 280 нм и оцените концентрацию белка rBC1531, как описано 13 .
    4. Принять 50 мкг rBC1531 в 0,5 мл пробирке и добавить различные количества тромбина ( т.е. 2, 1, 0,6 и 0,3 единиц). Инкубируйте rBC1531 и тромбиновые реакции при 20 ° C в течение ~ 3 часов, чтобы определить наименьшее количество тромбина, необходимое для расщепления N-концевой аффинной метки.
    5. Запустите реакции rBC1531 и тромбина на 15%SDS-PAGE и определяют наименьшее количество тромбина ( например, 0,3 единицы тромбина на 50 мкг rBC1531), которое полностью переваривает N-концевую аффинную метку и вырабатывает rBC1531 без метки.
    6. Добавить 10 мг белка rBC1531 и 60 единиц тромбина в 15 мл пробирку и инкубировать при 20 ° С в течение ~ 3 часов для протеолитической реакции тромбина.
    7. Примените стандарты гель-фильтрации к колонке с эксклюзионной хроматографией (SEC), чтобы подготовить стандартную кривую молекулярных масс и объемов элюирования, как описано 13 .
    8. Положите переваренный тромбином белок rBC1531 с этапа 1.4.6 в центрифужную пробирку с фильтром (молекулярная масса отключен: 3 кДа) и центрифугируйте при 3000 g при 4 ° C, чтобы уменьшить до объема менее 5 мл.
    9. Наносят концентрированный белок rBC1531 на колонку SEC и собирают 60 элюированных фракций в 0,5 мл на пробирку 13 .
    10. Взять по 15 мкл каждой фракции, запустить их на 15% SDS-PAGE и стабильноВ геле, использующем окрашивающий раствор Кумасси (0,15% (мас. / Об.), Кумасси блестящий синий, 40% (об. / Об.) Метанол и 10% (об. / Об.) Ледяной уксусной кислоты), как описано 10 .
    11. Пипетируйте фракции, содержащие rBC1531, и соберите их в одну пробирку.

2. Кристаллизация и оптимизация rBC1531

  1. Условия скрининга для кристаллизации белка rBC1531
    1. Сконцентрируйте rBC1531 с этапа 1.4.11 до ~ 18,5 мг / мл с использованием центробежной пробирки фильтра, как описано на этапе 1.4.8.
    2. Добавить 50 мкл каждого раствора для кристаллизационного скрининга (см. Раздел 2.2) 14 в лунки 96-луночных планшетов для кристаллизации в сидячем положении. Поместите 0,5 мкл 18,5 мг / мл раствора белка rBC1531 на сидячую кровать. Смешайте раствор белка с 0,5 мкл раствора в лунках, повторив процесс для всей пластины.
    3. Накройте пластину прозрачной клейкой пленкой.Поместите 96-луночные планшеты при 18 ° C и позвольте диффузии паров.
    4. Сканирование капель при увеличении 20-40 раз с использованием светового микроскопа для ежедневного наблюдения за образованием кристаллов в течение 2-3 недель.
    5. Собрать данные 12 рентгеноструктурного анализа с использованием полученных кристаллов белка rBC1531.
  2. Оптимизация условий кристаллизации rBC1531
    1. Приготовьте 500 мкл выбранного начального раствора для кристаллизации ( например, 0,1 М натрийкакодилата, рН 6,5 и 1,0 М цитрата натрия) и заполните 24-луночную кристаллизационную пластину для сидения.
    2. Добавьте 0,5 мкл 18,5 мг / мл раствора белка rBC1531 в сидячий слой, смешайте с 0,5 мкл раствора в лунке и сразу же покрывайте прозрачную клейкую пленку. Поместите пластину при 18 ° C.
    3. Наблюдайте рост кристаллов под световым микроскопом в течение недели.
    4. Оптимизация различных условий кристаллизации путем изменения рН ( т.е.., PH 5,5-6,8) 0,1 М какодилата и путем изменения концентрации соли ( т.е. 0,9-1,2 М) цитрата натрия для получения особых кристаллов. Наблюдать рост кристаллов в течение ~ 1 недели и собирать данные рентгеноструктурного анализа 12 .

3. Характеристика нуклеозидтрифосфатазы (NTPase) Активность rBC1531

  1. Валидация неорганического фосфат-зависимого колориметрического исследования
    1. Готовят запас пирофосфата (100 мМ) и разбавляют его до конечных концентраций 0,1, 0,25, 0,5, 1,0, 5,0, 10, 50, 100 и 250 мкМ в 200 мкл реакционного буфера (20 мМ HEPES, рН 7,4, 150 ММ NaCl и 2 мМ MgCl 2 ) в дублированных 96-луночных планшетах. Используйте первую пластину в качестве контроля (это не содержит пирофосфатазы). Убедитесь, что вторая пластина содержит пирофосфатазу в качестве рабочей пластины, как указано на этапе 3.1.2.
    2. Добавить 0,01 единицы Saccharomyces cerevisiae неорганической рЙофосфатазы (1 мкл) в лунки рабочей пластины и инкубируют при 20 ° С в течение 30-60 мин.
    3. Приготовление раствора молибдата кислоты путем смешивания растворов молибдата аммония (0,86% об. / Об.) И аскорбиновой кислоты (14 об.%) В соотношении 7: 3. Добавьте 16 мкл раствора кислоты молибдата в рабочую и контрольную лунки и подождите 15 мин.
    4. Считайте оптическую плотность при 690 нм (OD 690 нм).
  2. Колориметрический анализ NTPase
    1. Готовят запас 100 мМ нуклеозидтрифосфатного (NTP) субстрата и разбавляют до желаемой концентрации ( например, 0, 0,2, 4,4, 11, 22, 44, 88 или 132 мкМ) в 180 мкл буфера для анализа (20 мМ HEPES, РН 7,4, 150 мМ NaCl и 2 мМ MgCl 2 ).
    2. Добавьте 20 мкг rBC1531 (1,5 мМ) и субстраты NTP с этапа 3.2.1 до 200 мкл на реакцию в 96-луночном планшете и пипеткой вверх и вниз, чтобы хорошо перемешать. Накройте пластину ее крышкой и поместите ее в инкубатор с температурой 37 ° C в течение 30 минутДля осуществления реакции гидролиза субстрата.
    3. Перенесите планшет на водяную баню с температурой 70 ° C и дайте ему постоять в течение 15 минут, чтобы остановить каталитические реакции, опосредованные rBC1531.
    4. Добавить 0,01 единицы неорганической пирофосфатазы S. cerevisiae (1 мкл) в каждую лунку реакционной планшеты (из стадии 3.2.3) и инкубировать при 20 ° С в течение 30 мин. Добавьте 16 мкл раствора кислоты молибдата в реакционную планшету, чтобы получить цвет (~ 15 мин). Читайте на OD 690 нм .
    5. Проанализируйте, используя уравнение Михаэлиса-Ментен, как описано 12 .

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Характеристика интересующего белка в этом исследовании начиналась с приготовления достаточного количества рекомбинантного белка B. cereus bc1531 (rBC1531), предпочтительно более нескольких миллиграмм. Фрагмент ДНК, кодирующий белок BC1531, был получен с помощью ПЦР с использованием геномной ДНК B. cereus в качестве матрицы, так как он содержит ортологичные гены, идентичные ba1554 . RBC1531 был сверхэкспрессирован как растворимый белок в клетках Е. coli . Белок rBC1531 экспрессировали 6x-гистидиновой меткой и сайтом расщепления тромбина на своем N-конце 12 . В качестве первой стадии очистки rBC1531 очищали с помощью никель-аффинной хроматографии ( фиг.1А ). Затем проводили испытание на переваривание тромбина для определения минимального количества тромбина, необходимого для полного расщепления метки сродства от rBC1531 ( фиг. 1А ). В наших руках было 0,3 единицы тромбинаЧтобы полностью удалить тег affinity из rBC1531. Таким образом, при масштабировании 10 мг rBC1531 обрабатывали 60 единицами тромбина для удаления метки. После расщепления тромбином без маркировки rBC1531 наносят на колонку SEC для удаления любых растворимых агрегатов и примесей с более высоким или низким молекулярным весом. Фракции rBC1531 анализировали с помощью SDS-PAGE, результаты которого показали, что rBC1531 составлял ~ 99% ( фиг. 1A ). В целом 1 л культуры дает ~ 8 мг белка rBC1531.

Для оценки олигомерного статуса rBC1531 проводили SEC. Стандартная линейная кривая, которая коррелирует логарифмическое значение молекулярных масс образцов с соответствующими объемами элюирования, была построена с использованием пиков белковых стандартов ( рисунок 1B ). RBC1531 элюировали при объеме элюирования ~ 84 мл, и его кажущаяся молекулярная масса оценивалась как ~ 55 кДа. Учитывая, что вычисленный молекулярный мыИз мономера rBC1531 составляет ~ 13 кДа, эти результаты показывают, что rBC1531 собирается в виде тетрамера.

Очищенный rBC1531 подвергали скринингу для кристаллизации с использованием ~ 400 условий в методе диффузии паров с сидением. Кристаллы rBC1531 появлялись через ~ 2 дня при двух условиях: состоянии А, 0,1 М цитрате натрия (рН 5,5) и 20% ПЭГ 3000 ( фиг. 2А ) и состоянии В, 0,1 М какодилата натрия (рН 6,5) и 1,0 М натрия Цитрат ( фиг.2В ). Условия кристаллизации оптимизировали путем варьирования рН (0,1 М цитрата натрия, рН 5,0-6,0) и концентрации ПЭГ 3000 (18-21% ПЭГ 3000) из условия А и путем изменения рН (0,1 М какодилата натрия, рН 5,5-6,8) и концентрации соли (0,9-1,2 М цитрата натрия) из условия В. Кристаллы, пригодные для дифракции, были получены только для условия В, тогда как кристаллы из условия А имели тенденцию к росту, а не к сингулярности. Кристаллы состояния ВДифрагированного рентгеновского излучения до разрешения 2,74 Å ( фиг. 2C ) и использовались для определения структуры rBC1531.

Наблюдение консервативного домена MazG в белковой последовательности BA1554 свидетельствует о наличии активности NTPазы, способной гидролизировать NTP. Гидролиз NTP обычно дает нуклеозиддифосфат (NDP) и неорганический фосфат (Pi) или нуклеозидмонофосфат (NMP) и пирофосфат (PPi). PPi требует дополнительной пирофосфатазной активности для получения Pi. Уровни Pi могут быть непосредственно измерены с использованием молибдата, который образует комплекс синего цвета с Pi (молибдат-Pi), который можно контролировать с использованием оптической плотности на длине волны 690 нм (OD 690 нм) ( фиг. 3A ). В нашем исследовании после гидролиза NTP с помощью rBC1531 после добавления молибдата не наблюдалось видимого синего цвета ( фиг. 3B ). Однако, когда пирофосфатазу добавляли к rBC1531-опосредованному NTP-гидролизу rEaction, цвет изменился на темно-синий ( рис. 3B ), что указывает на то, что rBC1531 обладает активностью NTP-пирофосфогидролазы. График концентрации OD 690 нм и NTP анализировали с использованием метода нелинейной регрессии для определения кинетических параметров (V max 0,75 и K m 10 мкМ) для фермента rBC1531 ( фигура 3C ).

Рисунок 1
Рисунок 1: SDS-PAGE и анализ эксклюзионной хроматографии (SEC). ( A ) SDS-PAGE анализ rBC1531. (Слева) Пики элюирования rBC1531 от аффинной хроматографии на никеле (дорожка 2, Ni) и SEC (дорожка 3) анализировались вместе с белковыми стандартами (дорожка 1, помечены в kDa). (Справа) Анализ расщепления тромбином rBC1531 для удаления метки аффинности. Количество тромбина, добавленного к 50 мкг rBC1531 в различных реакциях, составляет indВ единицах выше геля. ( B ) Анализ эксклюзионной хроматографии (SEC) rBC1531 и белковых стандартов. (Слева) Профили элюирования rBC1531 (синий) и стандарты (красный). Молекулярные массы стандартных белков показаны выше каждого пика, в кДа. Вертикальная (y) и горизонтальная (x) оси показывают милли-абсорбционные единицы (мАU при 280 нм) и объемы удерживания (мл) соответственно. (Справа). Видимый молекулярный размер rBC1531 оценивали с использованием линейного графика для молекулярных масс, логарифмической шкалы и объемов элюирования белковых стандартов (R 2 = 0,9934). Нажмите здесь, чтобы просмотреть увеличенную версию этого рисунка.

фигура 2
Рисунок 2: Кристаллизация и дифракция рентгеновских лучей. ( A ) кристаллы rBC1531 в условияхНа-А, 0,1 М цитрата натрия (рН 5,5) и 20% ПЭГ 3000. ( В ) кристаллы rBC1531 в условиях В, 0,1 М какодилата натрия (рН 6,5) и 1,0 М цитрата натрия. Показаны начальные (слева) и оптимизированные (средний и правый) кристаллы. Для рентгеновской дифракции использовался оптимизированный кристалл rBC1531 (справа, ~ 0,35 мм × ~ 0,35 мм × ~ 0,20 мм). Масштабы шкалы = 100 мкм. ( C ) рентгенограмма кристалла rBC1531, полученная на пучковой линии PAL BL-7A 12 . Стрелка указывает место с высоким разрешением. Нажмите здесь, чтобы просмотреть увеличенную версию этого рисунка.

Рисунок 3
Рисунок 3: Активность NTPase. ( A ) Образование комплекса молибден-Pi зависит от концентрации Pi. Оптическая плотность при 690 нм равна diПрямо связано с увеличением уровней Pi. Ось Y и ось X представляют собой OD 690 нм и концентрацию (μM) для Pi соответственно. ( B ) Изменение цвета при добавлении пирофосфатазы. В первом ряду лунок пирофосфатаза не добавлялась и не образовывала пи-комплекс голубого цвета. Однако второй ряд состоит из ячеек, в которых реакции rBC1531-NTP обрабатываются пирофосфатазой и имеют синий цвет. Значения OD 690 нм увеличивались с увеличением концентраций NTP. ( C ) Михаэлис-Ментенский участок реакций rBC1531-NTP. Ось Y и ось X представляют собой OD 690 нм и концентрацию (0-120 мкМ) субстратов NTP, соответственно. Шкалы ошибок представляют собой стандартное отклонение для трех отдельных экспериментов. Нажмите здесь, чтобы просмотреть увеличенную версию этого рисунка.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторам нечего раскрывать.

Acknowledgments

Рентгеновские дифракционные наборы были собраны на пучковой линии 7А Лаборатории ускорителей Пхохан (Корея). Это исследование было поддержано Программой фундаментальных исследований, проводимой Национальным научно-исследовательским фондом Кореи (NRF), финансируемой Министерством науки, ИКТ и перспективного планирования (2015R1A1A01057574 МЗ).

Materials

Name Company Catalog Number Comments
Bacillus cereus ATCC14579 Korean Collection for Tissue Culture 3624
Genomic DNA prep kit GeneAll 106-101 Genomic DNA preparation
Forward primer Macrogen GAAGGATCCGGAAGCAAAAA
CGATGAAAGATATGCA
BamHI site is underlined
Reverse primer Macrogen CTTGTCGACTTATTCTTTCTCT
CCCTCATCAATACGTG
SalI site is underlined
nPfu-Forte Enzynomics P410 PCR polymerase
BamHI Enzynomics R003S
SalI Enzynomics R009S
pET49b expression vector Novagen 71463 Expression vector was modified to add affinity tags and BamHI/SalI sites10
T4 DNA ligase Enzynomics M001S
Dialysis memebrane Thermofisher 18265017
Dry block heater JSR JSBL-02T
LB broth (Luria-Bertani) LPS solution LB-05
LB Agar, Miller (Luria-Bertani) Becton, Dickinson and Company
Kanamycin LPS solution KAN025
Mini-prep kit Favorgen FAPDE300 Plasmid DNA preparation
BL21(DE3) Competent cell Novagen 69450-3CN
Isopropyl β-D-1-thiogalactopyranoside (IPTG) Fisher BioReagents 50-213-378
Sodium chloride Daejung 7548-4100 PBS material
Potassium chloride Daejung 6566-4405 PBS material
Potassium phosphate Bio Basic Inc PB0445 PBS material
Sodium phosphate Bio Basic Inc S0404 PBS material
Imidazole Bio Basic Inc IB0277
Sonicator Sonics VCX 130
Ni-NTA agaros Qiagen 30210 Nickel bead
Rotator Finepcr AG
Precision Plus Protein Dual Color Standards Bio-rad 1610374 SDS-PAGE protein standard
Coonmassie Brilliant Blue R-250 Fisher BioReagents BP101-25 Coomassie staining solution
Methyl alcohol Samchun chemical M0585 Coomassie staining solution
Acetic acid Daejung 1002-4105 Coomassie staining solution
Dialysis memebrane Thermofisher 68035
2-Mercaptoethanol Sigma-aldrich M6250
Thrombin Merckmillipore 605157-1KUCN Prepare aliquots of 20 μL (1 Unit per μL) and store at 70 °C and thaw before use
Superdex 200 16/600 General Electric 28989335 Size exclusion chromatography
Gel filtration standard Bio-rad 151-1901
Centrifugal filter Amicon UFC800396
Crystralization plates Hampton research HR3-083 96-well sitting drop plate
The JCSG core suite I-IV Qiagen 130924-130927 Crystallization secreening solution
Microscope Nikon SMZ745T
Cryschem plates Hampton research HR3-158 24-well sitting drop plate
Inorganic pyrophosphatase Sigma 10108987001
Ammonium molybdate solution Sigma 13106-76-8
L-ascorbic acid Sigma 50-81-7
NTP substrate Startagene 200415-51
Spectrophotometer Biotek SynergyH1 microplate reader
GraphPad Prism 5 GraphPad Prism 5 for Window

DOWNLOAD MATERIALS LIST

References

  1. Ivanova, N., et al. Genome sequence of Bacillus cereus and comparative analysis with Bacillus anthracis. Nature. 423, 87-91 (2003).
  2. Spencer, R. C. Bacillus anthracis. J Clin Pathol. 56, 182-187 (2003).
  3. Deli, A., et al. LmbE proteins from Bacillus cereus are de-N-acetylases with broad substrate specificity and are highly similar to proteins in Bacillus anthracis. FEBS J. 277, 2740-2753 (2010).
  4. Gross, M., Marianovsky, I., Glaser, G. MazG -- a regulator of programmed cell death in Escherichia coli. Mol Microbiol. 59, 590-601 (2006).
  5. Galperin, M. Y., Moroz, O. V., Wilson, K. S., Murzin, A. G. House cleaning, a part of good housekeeping. Mol Microbiol. 59, 5-19 (2006).
  6. Lee, S., et al. Crystal structure of Escherichia coli MazG, the regulator of nutritional stress response. J Biol Chem. 283, 15232-15240 (2008).
  7. Moroz, O. V., et al. Dimeric dUTPases, HisE, and MazG belong to a new superfamily of all-alpha NTP pyrophosphohydrolases with potential "house-cleaning" functions. J Mol Biol. 347, 243-255 (2005).
  8. Robinson, A., et al. A putative house-cleaning enzyme encoded within an integron array: 1.8 A crystal structure defines a new MazG subtype. Mol Microbiol. 66, 610-621 (2007).
  9. Moroz, O. V., et al. The crystal structure of a complex of Campylobacter jejuni dUTPase with substrate analogue sheds light on the mechanism and suggests the "basic module" for dimeric d(C/U)TPases. J Mol Biol. 342, 1583-1597 (2004).
  10. Green, M., Sambrook, J. Molecular cloning: A laboratory Manual. 1, John Inglis. (2012).
  11. Brown, T. A. Gene cloning an introduction. Chapman & Hall. (1986).
  12. Kim, M. I., Hong, M. Crystal structure of the Bacillus-conserved MazG protein, a nucleotide pyrophosphohydrolase. Biochem Biophys Res Commun. 472, 237-242 (2016).
  13. Sheehan, D. Physical biochemistry: Principles and applications. A John Wiley & Sons. (2009).
  14. Lesley, S. A., Wilson, I. A. Protein production and crystallization at the joint center for structural genomics. J Struct Funct Genomics. 6, 71-79 (2005).
  15. Jeon, Y. J., et al. Structural and biochemical characterization of bacterial YpgQ protein reveals a metal-dependent nucleotide pyrophosphohydrolase. J Struct Biol. 195, 113-122 (2016).
Рекомбинантная экспрессия белков, кристаллизация и биофизические исследования<em&gt; Bacillus</em&gt; -содержащая нуклеотидная пирофосфорилаза, BcMazG
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Kim, M. I., Lee, C., Hong, M. Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG. J. Vis. Exp. (123), e55576, doi:10.3791/55576 (2017).More

Kim, M. I., Lee, C., Hong, M. Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG. J. Vis. Exp. (123), e55576, doi:10.3791/55576 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter