Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biochemistry

Expresión de Proteínas Recombinantes, Cristalización y Estudios Biofísicos de un doi: 10.3791/55576 Published: May 16, 2017

Summary

Bacillus anthracis es el patógeno obligado del ántrax por inhalación fatal, por lo que los estudios de sus genes y proteínas están estrictamente regulados. Un enfoque alternativo es estudiar los genes ortólogos. Se describen los estudios biofísicoquímicos de un B. orthracis ortholog en B. cereus , bc1531, que requiere un mínimo de equipo experimental y la falta de graves preocupaciones de seguridad.

Abstract

Para superar las restricciones de seguridad y las regulaciones al estudiar genes y proteínas de patógenos verdaderos, sus homólogos pueden ser estudiados. Bacillus anthracis es un patógeno obligado que causa el ántrax mortal por inhalación. Bacillus cereus es considerado un modelo útil para estudiar B. anthracis debido a su estrecha relación evolutiva. El grupo de genes ba1554 - ba1558 de B. anthracis está altamente conservado con el grupo bc1531 - bc1535 en B. cereus , así como con el grupo bt1364 - bt1368 en Bacillus thuringiensis, lo que indica el papel crítico de los genes asociados en el género Bacillus . Este manuscrito describe métodos para preparar y caracterizar un producto proteico del primer gen ( ba1554 ) del grupo genético en B. anthracis usando una proteína recombinante de su ortholog en B. cereus , bc1531.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

La expresión de proteínas recombinantes se utiliza ampliamente para superar problemas asociados con fuentes de proteínas naturales, tales como cantidades limitadas de proteínas y contaminación perjudicial. Además, en estudios de genes y proteínas patógenos, se puede utilizar una cepa alternativa de laboratorio que no requiere precauciones de seguridad adicionales. Por ejemplo, Bacillus cereus es un modelo útil para estudiar Bacillus anthracis debido a su estrecha relación evolutiva 1 .

B. anthracis es un patógeno obligado que causa el ántrax mortal por inhalación en humanos y ganado y potencialmente puede ser utilizado como bioweapon 2 . Por lo tanto, los estudios de laboratorio sobre B. anthracis están estrictamente regulados por los Centros para el Control y la Prevención de Enfermedades de los Estados Unidos, que requieren prácticas de nivel de bioseguridad 3 (BSL-3) que obligan a separar el área del laboratorio con presión negativa. En contraste con B. anthracis B. cereus se clasifica como un agente BSL-1 y por lo tanto tiene preocupaciones mínimas de seguridad. B. cereus es un patógeno oportunista que, tras la infección, causa intoxicación alimentaria que puede ser tratada sin asistencia médica. Sin embargo, debido a que B. cereus comparte muchos genes críticos con B. anthracis , las funciones de las proteínas de B. anthracis se pueden estudiar usando los correspondientes homólogos de B. cereus 1 .

El grupo de genes ba1554 - ba1558 de B. anthracis se conserva altamente con el grupo bc1531 - bc1535 De B. cereus , así como con el grupo bt1364-bt1368 de Bacillus thuringiensis , en términos de organización de genes y secuencia. Además, los primeros genes ( ba1554 , bc1531 y bt1364 ) de los respectivos grupos están absolutamente conservados ( es decir, 100% de identidad de secuencia de nucleótidos), implyiNg un papel crítico del producto génico en las especies de Bacillus . Debido a su ubicación en estos grupos de genes, ba1554 fue mal identificado como un regulador de transcripción putativo [ 3] . Sin embargo, el análisis de la secuencia de aminoácidos del producto ba1554 indica que pertenece a la familia MazG, que tiene actividad de nucleótido pirofosfohidrolasa y no está asociada con la actividad del factor de transcripción 4 , 5 . Aunque las proteínas pertenecientes a la familia MazG son diversas con respecto a la secuencia y longitud totales, comparten un dominio MazG común de ~ 100-residuo caracterizado por un motivo EXXE 12-28 EXXD ("X" representa cualquier residuo de aminoácido, y el número Indica el número de residuos X).

El dominio MazG no siempre explica directamente una cierta actividad catalítica. Un miembro MazG de Escherichia coli (EcMazG) posee dos dominios MazG, pero enLy el dominio C-terminal MazG es enzimáticamente activo [ 6] . Por otra parte, la especificidad del sustrato de las enzimas MazG varía de nucleoside trifosfatos no específicos (para EcMazG) a dCTP / dATP específicos (para integrinas asociadas a MazG) y dUTP (para dUTPases) 6 , 7 , 8 , 9 . Por lo tanto, los análisis biofísicoquímicos de la proteína BA1554 son necesarios para confirmar su actividad NTPasa y para descifrar su especificidad de sustrato.

En este sentido, proporcionamos un protocolo paso a paso que la mayoría de los laboratorios sin un BSL-3 puede seguir para caracterizar el producto proteico del gen B. cereus bc1531 , que es un ortólogo de B. anthracis ba1554 , a nivel molecular. Brevemente, el BC1531 recombinante (rBC1531) se expresó en E. coli y se purificó usando una etiqueta de afinidad. Para los experimentos cristalográficos de rayos X,Zación de la proteína rBC1531 se seleccionaron y optimizaron. Para evaluar la actividad enzimática de rBC1531, la actividad de NTPasa se monitorizó colorimétricamente para evitar nucleótidos radiactivamente marcados que se han usado convencionalmente. Finalmente, los análisis de los datos biofísicoquímicos obtenidos nos permitieron determinar el estado de oligomerización y los parámetros catalíticos de rBC1531, así como obtener datos de difracción de rayos X del cristal rBC1531.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Producción y Purificación de Proteínas Recombinantes de rBC1531

  1. Preparación de un plásmido de expresión recombinante de la proteína BC1531 (rBC1531)
    1. Preparar el ADN genómico de B. cereus [ 10] .
    2. Amplificar el gen bc1531 de una plantilla de ADN genómico de B. cereus por reacción en cadena de la polimerasa (PCR), utilizando cebadores directos e inversos (véase la Lista de Materiales) para crear sitios de enzimas de restricción Bam HI y Sal I, respectivamente 10 .
    3. Digerir el producto de PCR y un vector pET49b modificado (pET49bm) usando Bam HI y Sal I, como se describe 11 .
    4. Mezclar el producto de la PCR digerido y el vector (relación 3: 1) de la etapa 1.1.3 usando T4 ADN ligasa en una reacción de 10 μL, tal como se describe en 11 . Incubar a 18 ° C durante 30 min.
    5. Pipetee 3 μL de la reacción de ligadura en 50 μl deLmente células E. coli DH5α competentes en un tubo. Mezcle suavemente pipeteando hacia arriba y hacia abajo y colóquelo en hielo durante 30 min. De choque térmico durante 45 s a 42 ° C. Añadir 1 mL de medio Luria-Bertani (LB) y cultivar las células mientras se agita vigorosamente (250 rpm, 37ºC, 45 min).
    6. Tomar 100 μL de las células transformadas de la etapa 1.1.6 y esparcirlas sobre las placas de LB-agar con 100 μg / ml de kanamicina (Kan). Incubar durante ~ 18 ha 37 ° C.
    7. Recoger las colonias utilizando una punta estéril y cultivar las células en 3 ml de medio LB con 100 μg / ml de Kan; Agitar vigorosamente (250 rpm, 37ºC, 18 h).
    8. Preparar ADN plasmídico usando un método de lisis alcalino-SDS, como se describe 10 .
    9. Confirmar la secuencia de nucleótidos de la expresión rBC1531 construir utilizando el ADN de secuenciación [ 12] .
  2. La sobreexpresión de la proteína rBC1531
    1. Re-transformar la E. coli BL21 (DE3) cepa con rBC1531-expPlásmido ressión, como se describe en los pasos 1.1.5-1.1.6, para sobreexpresión.
    2. Seleccionar una colonia y cultivarla en 10 mL de medio LB que contenga 50 μg / mL de Kan (LB + Kan); Agitar vigorosamente durante 18 h a 37 ° C.
    3. Inocular 10 ml de cultivo durante la noche en 1 L de medio LB + Kan y crecer a 37 ° C hasta que la DO 600 (densidad óptica a 600 nm) alcance ~ 0,7.
    4. Sumergir el cultivo en agua helada durante ~ 15 min para enfriar la temperatura a 18 ° C y añadir isopropil β-D-1-tiogalactopiranósido (IPTG) al cultivo a una concentración final de 1 mM para la expresión de proteína recombinante. Cultivar el cultivo a 18 ° C durante un período adicional de ~ 16-18 h.
  3. Purificación de rBC1531
    1. Se cosechan las células por centrifugación (5.000 xg, 4ºC, 30 min). Deseche el sobrenadante cuidadosamente para no alterar las células. Re-suspender las células en 50 ml de solución salina tamponada con fosfato (PBS) que contiene imidazol 10 mM.
    2. Lyse las células dos veces por sonicación en hielo para evitar el sobrecalentamiento de los lisados ​​celulares (tiempo: 2 min 30 s, ciclo en: 5 s, ciclo off: 10 s, amplitud: 38%).
    3. Limpiar el lisado celular por centrifugación (~ 25.000 xg, 4 ° C, 30 min).
    4. Se mezclan 3 ml de perlas de níquel y 60 ml de PBS que contiene imidazol 10 mM y se somete a flujo por gravedad el tampón extra para depositar las perlas de níquel equilibradas en una columna de cromatografía de vidrio de 2,5 x 10 cm.
    5. Pipetear para transferir el sobrenadante del paso 1.3.3 a la columna con perlas de níquel pre-equilibradas e incubar a 4 ° C durante 2 h en una rueda giratoria a una velocidad baja (~ 20 rpm).
    6. Dejar que el sobrenadante se drene por gravedad y lavar las perlas de níquel en la columna tres veces con 100 ml de PBS que contiene imidazol 10 mM.
    7. Eluir la proteína rBC1531 aplicando 4 x 5 ml de PBS que contiene imidazol 250 mM.
    8. Tomar 15 μL de la elución de la etapa 1.3.7 y ejecutarla en SDS-PAGE al 15%. Visualice las bandas de proteínas enEl gel usando tinción azul de Coomassie 10 .
  4. Eliminación de los marcadores de afinidad de la proteína rBC1531 por proteólisis de trombina
    1. Pipetar las fracciones en un tubo de diálisis (peso molecular cortado: 3 kDa) y colocar el tubo en un vaso de precipitados que contenga 4 l de tampón compatible con la escisión de trombina (HEPES 20 mM, pH 7,4, NaCl 150 mM y β-mercaptoetanol 1,5 mM) A 4ºC durante la noche.
    2. Pipetear las fracciones y transferirlas a un tubo cónico.
    3. Medir la absorbancia a 280 nm y estimar la concentración de proteína rBC1531, como se describe [ 13] .
    4. Tomar 50 μg de rBC1531 en un tubo de 0,5 ml y agregar varias cantidades de trombina ( es decir, 2, 1, 0,6 y 0,3 unidades). Incubar las reacciones rBC1531 y trombina a 20 ° C durante ~ 3 h para determinar la menor cantidad de trombina necesaria para escindir la etiqueta de afinidad N-terminal.
    5. Ejecutar las reacciones rBC1531 y trombina en un 15%SDS-PAGE y determinar la cantidad más baja de trombina ( por ejemplo, 0,3 unidades de trombina por 50 μg de rBC1531) que digiere completamente la etiqueta de afinidad N-terminal y produce un rBC1531 libre de marcadores.
    6. Añadir 10 mg de proteína rBC1531 y 60 unidades de trombina a un tubo de 15 ml e incubar a 20 ° C durante ~ 3 h para la reacción de proteolisis de trombina.
    7. Aplicar las normas de filtración en gel a una columna de cromatografía de exclusión de tamaño (SEC) para preparar una curva estándar de pesos moleculares y volúmenes de elución, como se describe 13 .
    8. Colocar la proteína rBC1531 digerida con trombina de la etapa 1.4.6 en un tubo de filtro centrífugo (peso molecular cortado: 3 kDa) y centrifugar a 3.000 g a 4 ° C para reducir a un volumen de menos de 5 ml.
    9. Aplicar la proteína concentrada rBC1531 a la columna SEC y recoger 60 fracciones eluidas en 0,5 ml por tubo [ 13] .
    10. Tomar 15 μL de cada fracción, ejecutarlos en un 15% SDS-PAGE, y staiEn el gel usando una solución de tinción Coomassie (0.15% (p / v) de azul brillante Coomassie, metanol al 40% (v / v) y ácido acético glacial al 10% (v / v) como se describe 10 .
    11. Pipetear las fracciones que contienen rBC1531 y recogerlos en un tubo.

2. Cristalización Tamizaje y Optimización de rBC1531

  1. Condiciones de cribado para la cristalización de la proteína rBC1531
    1. Concentrar el rBC1531 de la etapa 1.4.11 hasta ~ 18,5 mg / mL usando un tubo de filtro centrífugo, como se describe en el paso 1.4.8.
    2. Añadir 50 μl de cada solución de cribado de cristalización (ver sección 2.2) 14 a los pocillos de placas de cristalización de 96 pocillos. Coloque 0,5 μl de la solución de 18,5 mg / ml de proteína rBC1531 sobre una cama sentada. Mezclar la solución de proteína con 0,5 μL de la solución del pocillo, repitiendo el proceso para toda la placa.
    3. Cubra la placa con una película adhesiva transparente.Colocar las placas de 96 pocillos a 18 ° C y permitir la difusión de vapor.
    4. Escanee las gotas a una ampliación de 20-40X usando un microscopio de luz para monitorear la formación de cristales diariamente durante 2-3 semanas.
    5. Recoger datos de difracción de rayos X 12 usando los cristales de proteína rBC1531 obtenidos.
  2. Optimización de las condiciones de cristalización de rBC1531
    1. Preparar 500 μl de la solución de la condición de cristalización inicial seleccionada ( p. Ej., Cacodilato sódico 0,1 M, pH 6,5 y citrato sódico 1,0 M) y rellenar una placa de cristalización de 24 pocillos para la gota sentada.
    2. Añadir 0,5 μL de la solución de 18,5 mg / ml de proteína rBC1531 a un lecho sentado, mezclar con 0,5 μL de la solución del pocillo y cubrir la placa inmediatamente con una película adhesiva transparente. Coloque la placa a 18 ° C.
    3. Observe el crecimiento del cristal bajo un microscopio de luz durante una semana.
    4. Optimizar varias condiciones de cristalización variando el pH ( es decir,, PH 5,5-6,8) de cacodilato 0,1 M y alterando la concentración de sal ( es decir, 0,9-1,2 M) de citrato sódico para obtener cristales singulares. Monitor de crecimiento de cristales durante ~ 1 semana y recoger datos de difracción de rayos X 12 .

3. Caracterización de la actividad Nucleósido Trifosfatasa (NTPasa) de rBC1531

  1. Validación del estudio colorimétrico inorgánico dependiente de fosfato
    1. Preparar una reserva de pirofosfato (100 mM) y diluir a concentraciones finales de 0,1, 0,25, 0,5, 1,0, 5,0, 10, 50, 100 y 250 μM en 200 μl de tampón de reacción (HEPES 20 mM, pH 7,4; 150 MM de NaCl y 2 mM de MgCl2) en placas de 96 pocillos duplicadas. Utilice la primera placa como control (esto no contiene pirofosfatasa). Asegúrese de que la segunda placa contiene pirofosfatasa como placa de trabajo, como se indica en el paso 3.1.2.
    2. Añadir 0,01 unidad de Saccharomyces cerevisiae p inorgánicoYrophosphatase (1 μl) a los pocillos de la placa de trabajo e incubar a 20 ° C durante 30-60 min.
    3. Preparar solución de ácido molibdato mezclando soluciones de molibdato de amonio (0,86% v / v) y ácido ascórbico (14% v / v) en una proporción de 7: 3. Añada 16 μl de solución de ácido molibdato a los pocillos de trabajo y de control y espere 15 min.
    4. Leer la densidad óptica a 690 nm (OD 690nm ).
  2. Ensayo colorimétrico de NTPasa
    1. Preparar una reserva de sustrato de nucleósido trifosfato (NTP) 100 mM y diluir a la concentración deseada ( por ejemplo, 0, 0,2, 4,4, 11, 22, 44, 88 o 132 μM) en 180 μl de tampón de ensayo (HEPES 20 mM, PH 7,4, NaCl 150 mM y MgCl2 2 mM).
    2. Añadir 20 μg de rBC1531 (1,5 mM) y los sustratos NTP desde el paso 3.2.1 hasta 200 μL por reacción en una placa de 96 pocillos y pipetear arriba y abajo para mezclar bien. Cubrir la placa con su tapa y colocarla en una incubadora a 37 ° C durante 30 minPara realizar la reacción de hidrólisis del sustrato.
    3. Transferir la placa a un baño de agua a 70 ° C y dejar reposar durante 15 minutos para detener las reacciones catalíticas mediadas por rBC1531.
    4. Añadir 0,01 unidades de pirofosfatasa inorgánica de S. cerevisiae (1 μl) a cada pocillo de la placa de reacción (de la etapa 3.2.3) e incubar a 20 ° C durante 30 min. Añadir 16 μL de solución de ácido molibdato a la placa de reacción para desarrollar el color (~ 15 min). Leer a DO 690nm .
    5. Analizar utilizando la ecuación de Michaelis-Menten, como se describe 12 .

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

La caracterización de la proteína de interés en este estudio comenzó preparando una cantidad suficiente de proteína B.cereus recombinante bc1531 (rBC1531), preferiblemente más de varios miligramos. El fragmento de ADN que codifica la proteína BC1531 se preparó por PCR utilizando el ADN genómico de B. cereus como plantilla, ya que contiene genes ortólogos idénticos a ba1554 . RBC1531 se sobreexpresó como una proteína soluble en células de E. coli . La proteína rBC1531 se expresó con un marcador de 6x-histidina y un sitio de escisión de trombina en su extremo N-terminal 12 . Como primer paso de purificación, rBC1531 se purificó por cromatografía de afinidad de níquel ( Figura 1A ). A continuación, se realizó un ensayo de digestión de trombina para determinar la cantidad más baja de trombina requerida para la digestión completa de la etiqueta de afinidad de rBC1531 ( Figura 1A ). En nuestras manos, 0,3 unidades de trombina fue sufPara eliminar completamente la etiqueta de afinidad de rBC1531. Por lo tanto, al escala, 10 mg de rBC1531 se trató con 60 unidades de trombina para la eliminación de la etiqueta. Después de la digestión de trombina, se aplicó rBC1531 libre de marcadores a una columna SEC para eliminar cualquier agregado soluble y contaminantes de peso molecular superior o inferior. Las fracciones rBC1531 se analizaron mediante SDS-PAGE, cuyos resultados sugirieron que rBC1531 era ~ 99% puro ( Figura 1A ). En general, 1 l de cultivo produjo ~ 8 mg de proteína rBC1531.

Para estimar el estado oligomérico de rBC1531, SEC se realizó. Se trazó una curva lineal estándar que correlaciona el valor logarıgico de los pesos moleculares de las muestras con sus correspondientes volúmenes de elución utilizando los picos de las normas proteınicas ( Figura 1B ). RBC1531 se eluyó a un volumen de elución de ~ 84 ml, y su peso molecular aparente se estimó como ~ 55 kDa. Dado que el molecular calculadoIght del monómero rBC1531 es ~ 13 kDa, estos resultados indican que rBC1531 se ensambla como un tetrámero.

Se rastreó el rBC1531 purificado para cristalización usando ~ 400 condiciones en un método de difusión de vapor de caída en reposo. Los cristales de rBC1531 aparecieron en ~ 2 días en dos condiciones: condición A, citrato de sodio 0,1 M (pH 5,5) y 20% PEG 3000 ( Figura 2A ) y condición B, 0,1 M de cacodilato de sodio (pH 6,5) y 1,0 M de sodio Citrato ( Figura 2B ). Las condiciones de cristalización se optimizaron variando el pH (citrato de sodio 0,1 M, pH 5,0-6,0) y la concentración de PEG 3000 (18-21% PEG 3000) de la condición A y modificando el pH (cacodilato de sodio 0,1 M, pH 5,5-6,8) y concentración de sal (citrato de sodio 0,9-1,2 M) de la condición-B. Sólo se obtuvieron cristales adecuados a la difracción para la condición B, mientras que los cristales de la condición A tendieron a ser inter-cultivados en lugar de singulares. Condición-B cristalesDifractados a una resolución de 2,74 Å ( Figura 2C ) y se utilizaron para la determinación de la estructura rBC1531.

La observación de un dominio conservado MazG en la secuencia de la proteína BA1554 sugirió la presencia de actividad NTPasa capaz de hidrolizar NTPs. La hidrólisis del NTP generalmente produce nucleósido difosfato (NDP) y fosfato inorgánico (Pi), o nucleósido monofosfato (NMP) y pirofosfato (PPi). PPi requiere actividad pirofosfatasa adicional para producir Pi. Los niveles de Pi se pueden medir directamente usando molibdato, que forma un complejo de color azul con Pi (molibdato-Pi) que puede ser monitoreado utilizando la densidad óptica a una longitud de onda de 690 nm (DO 390nm ) ( Figura 3A ). En nuestro estudio, después de la hidrólisis de NTP por rBC1531, no se produjo color azul visible después de añadir molibdato ( Figura 3B ). Sin embargo, cuando se añadió pirofosfatasa a la hidrólisis de NTP mediada por rBC1531 rEacción, el color cambió a azul profundo ( Figura 3B ), lo que indica que rBC1531 tiene NTP pyrophosphohydrolase actividad. Se analizó un gráfico de la concentración de DO 690nm y NTP utilizando un método de regresión no lineal para determinar los parámetros cinéticos ( Vmax de 0,75 y Km de 10 μM) para la enzima rBC1531 ( Figura 3C ).

Figura 1
Figura 1: Análisis de SDS-PAGE y cromatografía de exclusión por tamaños (SEC). ( A ) Análisis SDS - PAGE de rBC1531. (Izquierda) Se analizaron los picos de elución rBC1531 de la cromatografía de afinidad de níquel (carril 2, Ni) y SEC (carril 3) junto con patrones de proteína (carril 1, marcados en kDa). (Derecha) Análisis de la digestión de trombina de rBC1531 para la eliminación del marcador de afinidad. Las cantidades de trombina añadidas a 50 μg de rBC1531 en diferentes reacciones son indEn unidades por encima del gel. ( B ) Análisis de cromatografía de exclusión de tamaño (SEC) de rBC1531 y los estándares de proteínas. (Izquierda) Perfiles de elución de rBC1531 (azul) y estándares (rojo). Los pesos moleculares de las proteínas estándar se muestran por encima de cada pico, en kDa. Los ejes vertical (y) y horizontal (x) muestran las unidades de milli-absorción (mAU a 280 nm) y volúmenes de retención (mL), respectivamente. (Derecha) Se estimó el tamaño molecular aparente de rBC1531 usando un gráfico lineal para los pesos moleculares, en escala logarítmica y volúmenes de elución de patrones de proteínas (R $$ = 0,9934). Haga clic aquí para ver una versión más grande de esta figura.

Figura 2
Figura 2: Cristalización y difracción de rayos X. ( A ) cristales rBC1531 en condiciones( B ) rBC1531 cristales en condición B, 0,1 M de cacodilato de sodio (pH 6,5) y 1,0 M de citrato sódico (pH 5,5) y 20% de PEG 3000. Se muestran los cristales inicial (izquierdo) y optimizado (medio y derecho). Para la difracción de rayos X se utilizó el cristal rBC1531 optimizado (a la derecha, ~ 0,35 mm x ~ 0,35 mm x ~ 0,20 mm). Barras de escala = 100 μm. ( C ) Imagen de difracción de rayos X del cristal rBC1531 obtenido en la línea de haz PAL BL-7A 12 . La flecha indica un punto de alta resolución. Haga clic aquí para ver una versión más grande de esta figura.

figura 3
Figura 3: Actividad de la NTPasa. ( A ) La formación del complejo molibdeno-Pi depende de la concentración de Pi. La densidad óptica a 690 nm es diDirectamente asociado con el aumento de los niveles de Pi. El eje Y y el eje X representan la DO 690nm y la concentración (μM) de Pi, respectivamente. ( B ) El color cambia con la adición de pirofosfatasa. En la primera hilera de pocillos, no se a~nadió pirofosfatasa y no formó el complejo Pi de color azul. Sin embargo, la segunda fila consiste en pocillos en los que las reacciones de rBC1531-NTP se trataron con pirofosfatasa y desarrollaron un color azul. Los valores de DO 690nm aumentaron con el aumento de las concentraciones de NTP. ( C ) diagrama de Michaelis-Menten de las reacciones rBC1531-NTP. El eje Y y el eje X representan la DO 690nm y la concentración (0-120 μM) de sustratos NTP, respectivamente. Las barras de error representan la desviación estándar para tres experimentos separados. Haga clic aquí para ver una versión más grande de esta figura.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores no tienen nada que revelar.

Acknowledgments

Los conjuntos de datos de difracción de rayos X se recogieron en la línea de haz 7A del Laboratorio de Aceleración de Pohang (Corea). Este estudio fue apoyado por el Programa de Investigación Científica Básica administrado por la Fundación Nacional de Investigación de Corea (NRF), financiado por el Ministerio de Ciencia, TIC y Planificación del Futuro (2015R1A1A01057574 a MH).

Materials

Name Company Catalog Number Comments
Bacillus cereus ATCC14579 Korean Collection for Tissue Culture 3624
Genomic DNA prep kit GeneAll 106-101 Genomic DNA preparation
Forward primer Macrogen GAAGGATCCGGAAGCAAAAA
CGATGAAAGATATGCA
BamHI site is underlined
Reverse primer Macrogen CTTGTCGACTTATTCTTTCTCT
CCCTCATCAATACGTG
SalI site is underlined
nPfu-Forte Enzynomics P410 PCR polymerase
BamHI Enzynomics R003S
SalI Enzynomics R009S
pET49b expression vector Novagen 71463 Expression vector was modified to add affinity tags and BamHI/SalI sites10
T4 DNA ligase Enzynomics M001S
Dialysis memebrane Thermofisher 18265017
Dry block heater JSR JSBL-02T
LB broth (Luria-Bertani) LPS solution LB-05
LB Agar, Miller (Luria-Bertani) Becton, Dickinson and Company
Kanamycin LPS solution KAN025
Mini-prep kit Favorgen FAPDE300 Plasmid DNA preparation
BL21(DE3) Competent cell Novagen 69450-3CN
Isopropyl β-D-1-thiogalactopyranoside (IPTG) Fisher BioReagents 50-213-378
Sodium chloride Daejung 7548-4100 PBS material
Potassium chloride Daejung 6566-4405 PBS material
Potassium phosphate Bio Basic Inc PB0445 PBS material
Sodium phosphate Bio Basic Inc S0404 PBS material
Imidazole Bio Basic Inc IB0277
Sonicator Sonics VCX 130
Ni-NTA agaros Qiagen 30210 Nickel bead
Rotator Finepcr AG
Precision Plus Protein Dual Color Standards Bio-rad 1610374 SDS-PAGE protein standard
Coonmassie Brilliant Blue R-250 Fisher BioReagents BP101-25 Coomassie staining solution
Methyl alcohol Samchun chemical M0585 Coomassie staining solution
Acetic acid Daejung 1002-4105 Coomassie staining solution
Dialysis memebrane Thermofisher 68035
2-Mercaptoethanol Sigma-aldrich M6250
Thrombin Merckmillipore 605157-1KUCN Prepare aliquots of 20 μL (1 Unit per μL) and store at 70 °C and thaw before use
Superdex 200 16/600 General Electric 28989335 Size exclusion chromatography
Gel filtration standard Bio-rad 151-1901
Centrifugal filter Amicon UFC800396
Crystralization plates Hampton research HR3-083 96-well sitting drop plate
The JCSG core suite I-IV Qiagen 130924-130927 Crystallization secreening solution
Microscope Nikon SMZ745T
Cryschem plates Hampton research HR3-158 24-well sitting drop plate
Inorganic pyrophosphatase Sigma 10108987001
Ammonium molybdate solution Sigma 13106-76-8
L-ascorbic acid Sigma 50-81-7
NTP substrate Startagene 200415-51
Spectrophotometer Biotek SynergyH1 microplate reader
GraphPad Prism 5 GraphPad Prism 5 for Window

DOWNLOAD MATERIALS LIST

References

  1. Ivanova, N., et al. Genome sequence of Bacillus cereus and comparative analysis with Bacillus anthracis. Nature. 423, 87-91 (2003).
  2. Spencer, R. C. Bacillus anthracis. J Clin Pathol. 56, 182-187 (2003).
  3. Deli, A., et al. LmbE proteins from Bacillus cereus are de-N-acetylases with broad substrate specificity and are highly similar to proteins in Bacillus anthracis. FEBS J. 277, 2740-2753 (2010).
  4. Gross, M., Marianovsky, I., Glaser, G. MazG -- a regulator of programmed cell death in Escherichia coli. Mol Microbiol. 59, 590-601 (2006).
  5. Galperin, M. Y., Moroz, O. V., Wilson, K. S., Murzin, A. G. House cleaning, a part of good housekeeping. Mol Microbiol. 59, 5-19 (2006).
  6. Lee, S., et al. Crystal structure of Escherichia coli MazG, the regulator of nutritional stress response. J Biol Chem. 283, 15232-15240 (2008).
  7. Moroz, O. V., et al. Dimeric dUTPases, HisE, and MazG belong to a new superfamily of all-alpha NTP pyrophosphohydrolases with potential "house-cleaning" functions. J Mol Biol. 347, 243-255 (2005).
  8. Robinson, A., et al. A putative house-cleaning enzyme encoded within an integron array: 1.8 A crystal structure defines a new MazG subtype. Mol Microbiol. 66, 610-621 (2007).
  9. Moroz, O. V., et al. The crystal structure of a complex of Campylobacter jejuni dUTPase with substrate analogue sheds light on the mechanism and suggests the "basic module" for dimeric d(C/U)TPases. J Mol Biol. 342, 1583-1597 (2004).
  10. Green, M., Sambrook, J. Molecular cloning: A laboratory Manual. 1, John Inglis. (2012).
  11. Brown, T. A. Gene cloning an introduction. Chapman & Hall. (1986).
  12. Kim, M. I., Hong, M. Crystal structure of the Bacillus-conserved MazG protein, a nucleotide pyrophosphohydrolase. Biochem Biophys Res Commun. 472, 237-242 (2016).
  13. Sheehan, D. Physical biochemistry: Principles and applications. A John Wiley & Sons. (2009).
  14. Lesley, S. A., Wilson, I. A. Protein production and crystallization at the joint center for structural genomics. J Struct Funct Genomics. 6, 71-79 (2005).
  15. Jeon, Y. J., et al. Structural and biochemical characterization of bacterial YpgQ protein reveals a metal-dependent nucleotide pyrophosphohydrolase. J Struct Biol. 195, 113-122 (2016).
Expresión de Proteínas Recombinantes, Cristalización y Estudios Biofísicos de un<em&gt; Bacillus</em&gt; -conservado Nucleótido Pirofosforilasa, BcMazG
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Kim, M. I., Lee, C., Hong, M. Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG. J. Vis. Exp. (123), e55576, doi:10.3791/55576 (2017).More

Kim, M. I., Lee, C., Hong, M. Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG. J. Vis. Exp. (123), e55576, doi:10.3791/55576 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter