Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Geführte Protokoll für fäkale mikrobielle Charakterisierung von 16 s rRNA-Amplifikate Sequenzierung

doi: 10.3791/56845 Published: March 19, 2018

Summary

Dieses Manuskript beschreibt ein detaillierte standardisierte Protokoll von Hochdurchsatz-16 s rRNA-Amplifikate Sequenzierung. Das Protokoll stellt eine integrierte, uniformierte Machbare und preiswerte Protokoll Kotprobe Sammlung durch Datenanalysen ab. Dieses Protokoll ermöglicht die Analyse einer großen Anzahl von Proben mit strengen Standards und mehrere Steuerelemente.

Abstract

Der menschliche Darm Microbiome spielt eine zentrale Rolle beim Schutz der Zellen vor Verletzungen, bei der Verarbeitung von Energie und Nährstoffen und bei der Förderung der Immunität. Abweichungen von was als eine gesunde Mikrobiota Komposition (Dysbiose gilt) können lebenswichtige Funktionen führt zu pathologischen Bedingungen beeinträchtigen. Bisherigen und laufenden Forschung Bemühungen haben auf die Charakterisierung der Zusammenhänge zwischen mikrobiellen Zusammensetzung und menschliche Gesundheit und Krankheit.

Fortschritte in der Sequenzierung von Hochdurchsatz-Technologien ermöglichen Charakterisierung der mikrobiellen Zusammensetzung Darm. Diese Methoden umfassen 16 s rRNA-Amplifikate Sequenzierung und Schrotflinte Sequenzierung. 16 s rRNA-Amplifikate Sequenzierung wird verwendet, um taxonomische Zusammensetzung Profil während Schrotflinte Sequenzierung zusätzliche Informationen über Gene Vorhersagen und funktionellen Annotation bietet. In einer gezielte Sequenzierung Methode der 16 s rRNA Gens Variable Region von Vorteil ist die wesentlich geringeren Kosten im Vergleich zu Schrotflinte Sequenzierung. Sequenzunterschiede in der 16 s rRNA-Gen dienen als mikrobieller Fingerabdruck zur Identifikation und Quantifizierung von verschiedenen Taxa innerhalb einer einzelnen Probe.

Große internationale Anstrengungen haben Standards für die 16 s rRNA-Amplifikate Sequenzierung eingetragen. Mehrere Studien berichten jedoch eine Sourceschaltung der Variation von Batch-Effekt verursacht. Zur Minimierung dieser Effekt, uniformierten Protokolle für die Probenentnahme, müssen Verarbeitung und Sequenzierung umgesetzt werden. Dieses Protokoll schlägt die Integration von allgemein verwendeten Protokolle ab Kotprobe Sammlung auf Datenanalysen. Dieses Protokoll beinhaltet einen stützenfreie, direkt-PCR Ansatz, der gleichzeitige Handling und DNA-Extraktion einer großen Zahl von Stuhlproben, zusammen mit PCR Verstärkung der V4 Region ermöglicht. Darüber hinaus wird das Protokoll beschreibt die Analyse Pipeline und liefert ein Skript mit der neuesten Version des QIIME (QIIME-2-Version 2017.7.0 und DADA2). Dieses schrittweise Protokoll zielt darauf ab, die Interessenten bei der Einleitung der Verwendungdes der 16 s rRNA-Amplifikate Sequenzierung in einer robusten, reproduktive, einfach zu bedienen, detaillierte Weise zu führen.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Konzentrierte Anstrengungen wurden unternommen, Microbiome Vielfalt und Fülle, als ein weiterer Aspekt für den Fang von Unterschiede und Ähnlichkeiten zwischen den Individuen in gesunden und pathologischen Bedingungen besser zu verstehen. Alter2,3, Geographie4, Lebensstil5,6, und Krankheit5 zeigten sich die Zusammensetzung der Darm Microbiome zugeordnet werden, aber viele Bedingungen und Populationen wurden noch nicht vollständig gekennzeichnet. Vor kurzem wurde berichtet, dass das Mikrobiom für therapeutische Anwendungen7,8,9geändert werden kann. Daher ist zusätzliche Einblicke in die Beziehung zwischen verschiedenen physiologischen Bedingungen und der mikrobiellen Zusammensetzung der erste Schritt zur Optimierung der potenzielle zukünftige Änderungen.

Die traditionelle mikrobielle Kultur-Methoden sind durch niedrige Erträge10,11begrenzt und sind konzipiert als einen binären Zustand, wo ein Bakterium ist entweder, im Darm zu präsentieren, oder nicht. Hochdurchsatz-DNA-basierte Sequenzierung hat mikrobielle Ökologie, ermöglichen die Erfassung aller Mitglieder der mikrobiellen Gemeinschaft revolutioniert. Länge und Qualität bleiben erhebliche Hindernisse für genaue Taxonomie Zuordnung12lesen Sequenz jedoch. Darüber hinaus können Batch-Effekte, Hochdurchsatz-basierte Experimente leiden an denen Messungen von nicht-biologischen oder nichtwissenschaftlichen Variablen13betroffen sind. In den letzten Jahren haben mehrere Programme eingerichtet, um der menschlichen Mikrobiom, einschließlich der amerikanischen Darm-Projekt, die Vereinigten Staaten (US) Human Microbiome Project und das Vereinigte Königreich (UK) MetaHIT Projekt zu studieren. Diese Initiativen haben Unmengen an Daten generiert, die nicht aufgrund mangelnder Konsistenz in ihren Ansätzen leicht vergleichbar sind. Eine Vielzahl von internationalen Projekten wie International Human Microbiome Consortium, das Projekt International Human Microbiome Standards und der National Institute of Standards and Technology (NIST) versucht, einige dieser Probleme14-Adresse , und entwickelt Standards für Microbiome Messungen, die das Erreichen der reproduktiven Ergebnisse ermöglichen sollte. Hier beschriebene ist ein integriertes Protokoll mehrere allgemein verwendeten Methoden15,16 für die 16 s rRNA Hochdurchsatz-Sequenzierung (16 s-Seq) ab Kotprobe Sammlung durch Datenanalysen. Das Protokoll beschreibt einen stützenfreien PCR-Ansatz, ursprünglich für direkte Extraktion von pflanzlichen DNA16, ermöglichen das gleichzeitige Handling einer großen Zahl von fäkalen Proben in relativ kurzer Zeit mit hoher Qualität verstärkt DNA für eine gezielte Sequenzierung der mikrobiellen Variable V4 Region auf einer gemeinsamen Plattform der Sequenzierung. Dieses Protokoll soll Wissenschaftler, die Verwendung der 16 s rRNA-Amplifikate Sequenzierung gewissermaßen robuste, reproduktive, einfach zu bedienen, ausführliche Einleitung mit wichtigen Kontrollen führen. Eine geführte und detaillierte Schritt-für-Schritt-Protokoll kann Batch-Effekt minimieren und so wird mehr vergleichbare Ergebnisse der Sequenzierung zwischen Labors zulassen.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Ethische, Genehmigung für die Studie wurde von der lokalen Forschungsethikkommission Sheba gewährt und alle Methoden wurden gemäß den einschlägigen Richtlinien und Verordnungen durchgeführt. Das Protokoll erhalten eine Zustimmung des Patienten-Ausnahme von der lokalen ethischen Review Board, seit der Fäkalien, die verwendet wurden wurden bereits vorgelegt der Mikrobiologie-Kern im Rahmen des klinischen Aufarbeitung und ohne erkennbare Patienteninformationen als Alter, Geschlecht und mikrobielle Ergebnisse. Geschrieben, wurde die Einwilligung von gesunden Probanden und der Institutional Review Board bewilligt. Einige dieser Proben wurden bereits in einer vorherigen Analyse1aufgenommen.

1. Probe Handhabung

  1. Sammeln eine ca. 5 mm2 Abstrich (etwa die Größe von einem Radiergummi) aus einer frischen Kotprobe mit einem sterilen Tupfer in einem Test tube (siehe Tabelle der Materialien). Speichern Sie alle Tupfer mit Stuhlproben bei-80 ° C innerhalb von 24 h. Die fäkale Tupfer können es bleiben, bis die Weiterverarbeitung.

(2) DNA-Extraktion

  1. Die Extraktion und Verdünnung Lösungen bei Raumtemperatur auftauen (siehe Tabelle der Materialien).
  2. Übertragung der fäkale Tupfer in eine leere 2 mL Sammlung Rohr (siehe Tabelle der Materialien). Passen Sie die Tupfer Stick Größe durch Schneiden sie mit einer sauberen Schere Rohr Verschluss mit minimalen Cross-Kontamination zu ermöglichen. Jede Sammlung-Röhrchen mit der fäkalen Tupfer und Vortex mischen fügen Sie 250 μL der Extraktionslösung hinzu.
  3. Die Proben für 10 min in ein kochendes Wasserbad erwärmen (95-100° C). Jede Probe und Vortex mischen fügen Sie 250 μL der Verdünnung der Lösung hinzu.
  4. Lagern Sie die 2 mL Röhrchen mit der extrahierten DNA und den Tupfer bei 4 ° c

(3) PCR und Bibliothek-Vorbereitung

Arbeiten Sie für Schritt 3.1 und 3.2 in einer PCR-Workstation, die sauber, bietet Vorlage und Amplifikate Umgebung.

  1. Beschriften Sie die Primer (Tabelle 1) entsprechend ihren Barcode. Verdünnen Sie jede Grundierung in doppelt destilliertem Wasser (DDW) zu einer 50 μM Konzentration und speichern bei-20 ° C.
  2. Verwenden Sie eine 96-Well-Platte für PCR-Reaktionen. Jede Platte kann 32 verschiedene Proben enthalten, die von 32 verschiedenen Index Primer versehen sind. Tauen Sie der forward Primer und die 32 reverse Primer bei Raumtemperatur auf und verdünnen sie bis 5 μM.
  3. 100 Reaktionen (Endvolumen in jede Vertiefung werden 20 µl) bereiten Sie PCR Reaktionsmischungen durch das Mischen von 100 μL von 5 μM Forward Primer, 1 mL 2 X PCR Master Mix und 400 μl DDW vor. Legen Sie 15 μl dieser PCR Mischung in jede Vertiefung (insgesamt 96 Wells). 3 verschiedene Brunnen (32 verschiedene Grundierungen in Triplicates bietet insgesamt 96 Wells) fügen Sie 1 μL jeder 5 μM Reverse indizierten Grundierung hinzu.
  4. In einem Pre-PCR eigene Zone, was bedeutet einen sauberen Werkbank, die Vorlage und Amplifikate frei, ist hinzufügen 4 μL jeder extrahierten DNA-Probe Reaktionsgemischen (jede extrahierte DNA-Probe ist in dreifacher Ausfertigung verstärkt — 32 Proben pro 96-Well-Platte).
  5. Führen PCR mit den folgenden Einstellungen: erste Denaturierung von 94 ° C für 3 min; gefolgt von 35 Zyklen der Denaturierung bei 94 ° C für 1 min, bei 55 ° C für 1 min und Erweiterung bei 72 ° C für 1 min Glühen; und eine letzte Verlängerung bei 72 ° C für 10 Minuten.
  6. Kombinieren Sie auf einer anderen Bank, die als ein Post-PCR-eigene Zone definiert wird jeweils dreifacher PCR-Reaktion in einem Einzelband-Rohr (60 μl pro Probe).
  7. Zur Beurteilung der Qualität der PCR Amplifikate laufen Sie 4 μL jeder kombiniert PCR-Reaktion auf eine Interkalation Bromid-gefärbten 1 % Agarose-Gel. Unter UV-Wellenlänge von 260 nm, die positive Amplifikate erscheint in einem erwarteten Bandgröße von 375-425 bp. Nur diese Amplifikate werden in den nachfolgenden Schritten berücksichtigt.
    Hinweis: Jede Probe wird in dreifacher Ausfertigung, Bedeutung verstärkt, dass jede Probe in 3 verschiedenen PCR-Reaktionen verstärkt wird. Nicht skalieren.

(4) Bibliothek Quantifizierung und Reinigung

  1. Um einen Pool äquimolaren Konzentration aller PCR Proben zu erhalten, zu quantifizieren jedes Amplifikate durch eine doppelte stranded DNA (DsDNA quantifizieren Reagenz) fluoreszierendes Nukleinsäure Fleck (siehe Tabelle der Materialien), geeignet für die gleichzeitige Quantifizierung eines großen Höhe der Proben.
    Hinweis: Da der Größenbereich der Amplifikate zweideutig ist, dient die tatsächliche Höhe in Nanogramm eine äquimolaren Konzentration zu laden.
  2. Kombinieren Sie 500 ng jeder Probe in ein einziges, sterilen Röhrchen. Vortex mischen.
  3. Führen Sie 200 μL der gepoolten Bibliothek auf einer Interkalation Bromid-gefärbten 1 % Agarosegel. Extrahieren Sie die 375-425-bp-Bands aus dem Gel mit einem Gel Extraction Kit gemäß den Anweisungen des Herstellers (siehe Tabelle der Materialien) und die gepoolte Bibliothek in 80 μl DDW eluieren.
    Hinweis: Die gepoolte Bibliothek Größe ausgewählt, um unspezifische Amplifikationsprodukte vom Host DNA reduzieren sollte.
  4. Messen Sie die endgültige Bibliothek Konzentration mit Hilfe eines hochsensiblen DsDNA Kit gemäß den Anweisungen des Herstellers zu erkennen (siehe Tabelle der Materialien). Messen Sie die genaue Bibliotheksgröße mit einem hochsensiblen Trennung und Analyse-Kit für DNA-Bibliotheken nach den Anweisungen des Herstellers (siehe Tabelle der Materialien).

(5) Sequenzierung

  1. Verdünnen die gepoolte Bibliothek bis 19:00 mit Zusatz von 20 % Steuerelementbibliothek (siehe Tabelle der Materialien), nach der Sequenzierung Maschine Protokoll.
  2. Für die Sequenzierung lesen Verwendung kundenspezifisch angefertigt, Grundierungen, die komplementär zu den V4 Verstärkung Zündkapseln sind (siehe Tabelle 1).
  3. Verwendung einer dritten benutzerdefinierten gestaltete Sequenzierung Grundierung, die den Barcode in einer zusätzlichen liest (siehe Tabelle 1) und erzeugt gepaart Ende liest 175 Basen Länge in jeder Richtung, entsprechend den Vorgaben des Herstellers.
  4. Laufen Sie die Sequenzierung Maschine und erhalten Sie FASTQ Dateien nach Protokoll des Herstellers.

6. Datenverarbeitung

  1. Zusammen nähen Sie und verarbeiten Sie die überlappenden gepaart-End FASTQ Dateien in einer Daten-Kuration-Pipeline in QIIME 2 Version 2017.7.017umgesetzt. Demultiplex liest nach Probe bestimmten Barcodes.
  2. Verwenden Sie DADA218 für Qualitätskontrolle und Sequenz-Variante (SVs)-Erkennung. Kürzen Sie liest am 13 Basen aus dem 3'-Ende und 15 Stützpunkte von 5'-Ende, verwerfen liest mit mehr als 2 erwartete Fehler. Erkennen und Entfernen der Chimären verwenden die Konsensmethode — Chimären sind in Proben einzeln erkannt und Sequenzen gefunden Chimären in Sekundenbruchteilen genügend Proben werden entfernt.
  3. SVs taxonomische Klassifikation mit eine Naive Bayes ausgestattet-Sichter durchführen, ausgebildet am August 2013 99 % Identität Greengenes Datenbank-6, für 175 lange Lese- und der vorwärts/rückwärts-Primer eingestellt.
  4. Verdünnen Sie alle Proben zu Tiefe von 2.146 Sequenzen.
  5. Nutzen Sie ungewichteten UniFrac für Messung der β-Vielfalt (zwischen Probe Vielfalt19,20) auf die verdünnten Proben, um eine Probe-Größe-Effekt zu vermeiden.
  6. Verwenden Sie die daraus resultierenden Distanzmatrix um eine Analyse der wichtigsten Koordinaten (HKoA) durchzuführen.
    Hinweis: Die Datenverarbeitung Skript und Mapping-Dateien dienen als ergänzendes Material (ergänzende Material 1 und 2).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Eine schematische Darstellung des Protokolls ist in Abbildung 1dargestellt.

Wir haben prospektiv Stuhlproben von hospitalisierten Patienten mit vermuteten infektiösen Durchfall gesammelt. Diese Proben wurden klinische Mikrobiologielabor am Sheba Medical Center zwischen Februar und Mai 2015 vorgelegt wie zuvor beschrieben1war. Stuhlproben wurden herkömmliche mikrobiologische Kultur in der klinischen Mikrobiologielabor durchgeführt und breites Spektrum Hochdurchsatz-16 s-Seq parallel unterzogen. Darüber hinaus wurden Stuhlproben von gesunden Erwachsenen zum Vergleich sequenziert.

In dieser Analyse lag der Schwerpunkt auf die Qualitätskontrolle der Daten und repräsentative Ergebnisse anzeigen der Ausgabe von QIIME217erhalten. Zunächst wurden Sequenzierung in 6 negative Kontrollproben erzielten Ergebnisse für Qualitätskontrolle einschließlich überprüft: i) PCR ohne Vorlage, Ii) PCR auf sauberen und sterilen Tupfer in Extraktion und Verdünnung Lösung und (Iii) PCR auf gemischte Extraktion und Verdünnung Lösungen. Tabelle 2 zeigt, dass alle negativen Kontrollproben ≤118 Gesamtanzahl der Lesezugriffe (Durchschnitt von 29 Sequenzen), in erster Linie von Mycoplasma Taxa, während alle anderen analysierten Proben zeigten Mittelwert insgesamt hatte liest der 10622.57 (±1211.34-Standard-Fehler) und keine Mycoplasma lesen die Qualitätskontrolle der wichtigsten Proben übergeben.

Sechzehn Proben, dass jeder aus der selben Stuhlprobe stammt aber ging durch andere Bibliothek Vorbereitung mit verschiedenen reverse Barcode Primer wurden als Positivkontrollen verwendet. Diese 16 Proben enthalten 8 mit positiven Kulturen für Campylobacter, Salmonellenoder Shigellen , die durch die klinische Mikrobiologielabor und 8, die gemeldet wurden, als mit negativen Kulturen gemeldet wurden. Eine Bereich Grundstück auf der Ebene des Tierreichs ist in Abbildung 2dargestellt. Proben, die stammt aus der selben Stuhlprobe aber ging durch andere Bibliothek Vorbereitung mit verschiedenen reverse Barcode Primern zeigen sehr konsequent relative Häufigkeit (Mantel Test zwischen Duplikate von Phylum Ebene taxonomische relative Häufigkeit Werte simuliert p-Wert = 1 x 10-04 basierend auf 9999 Wiederholungen).

Wichtigsten Koordinaten Analyse (HKoA), die Dimensionalität der Eingabedaten reduziert, wurde auf der UniFrac-Matrix zur Probe Trennung und Ähnlichkeit visuell zu erkunden. In Abbildung 3Asind sequenzierte Proben, die stammen aus der gleichen ursprünglichen Stuhlprobe aber ging durch andere Bibliothek Vorbereitung gleich gefärbt. In der Tat diejenigen liegen relativ eng in der HKoA Handlung (Mantel Test zwischen Duplikate PC1 PC2 Werte simulierte p-Wert = 1e-04 basierend auf 9999 Wiederholungen). Darüber hinaus ist die durchschnittliche ungewichtete Unifrac Beta-Vielfalt Abstand zwischen Proben in dieser Studie 0.706, während der durchschnittliche Abstand zwischen zwei Duplikate 0,235 ist (Rang Summe Wilcoxon test p-Wert = 4.205 x 10-11). Interessanterweise zeigten Proben, die Kultur positiv für Campylobacter, Salmonellenoder Shigellen Enteropathogens waren signifikant unterschiedlich PC1 Werte (Rang Summe Wilcoxon test p-Wert = 0,011) im Vergleich zu Proben mit negative Ergebnisse der Kultur. Abbildung 3 b zeigt die gleichen HKoA Handlung aber jetzt Proben durch die relative Häufigkeit der Proteobakterien gefärbt sind. Proben mit hohem Proteobakterien Fülle hatte deutlich unterschiedliche Werte von PC1 (Spearman-Korrelation R =-0.533, p-Wert = 0.000975). Diese Ergebnisse stehen im Einklang mit früheren Analyse dieser Daten, wo hospitalisierte Patienten haben tiefe steigt in Taxa von Proteobakterien Phylum1. Hier haben wir gezeigt, dass PC1 mit Proteobakterien Fülle, mit Kultur positiven Proben clustering meist auf der einen Seite der PC1 Achse und Kultur negative Proben clustering meist auf der anderen Seite, zusammen mit den gesunden Proben korreliert ist.

Figure 1
Abbildung 1 : Flussdiagramm aus Stuhlproben, relative Häufigkeit der mikrobiellen. 1) Probenbehandlung: links, Stuhlproben in einem sterilen Tupfer Rohr gesammelt werden. Richtig, ist die Tupfer Stick Größe angepasst, durch Schneiden um die Schließung von 2 ml-Tube und Lagerung zu ermöglichen. 2) DNA-Extraktion: DNA wird durch PCR-Spalten-freie Direktansprache gewonnen. 3) Bibliothek Vorbereitung: links, 4 μL der extrahierte DNA wird mit vorwärts/rückwärts-Index Primer verstärkt. Jede rückwärts-Primer enthält 12 Basis Barcode. Jede Probe wird in dreifacher Ausfertigung verstärkt. Eine 96-Well-Platte enthält 32 verschiedene Barcodes. Verbinden Sie rechts, jeden Barcode dreifacher in ein Einzelband-Rohr. Eine 96-Well-Platte enthält 96 verschiedene Barcodes. 4) Bibliothek Quantifizierung: oberen Panel, screening auf positiven Proben, Amplifikate auf Interkalation Bromid-gefärbten 1 % Agarosegel erkannt wurden. Untere Leiste, Quantifizierung der positiven Amplifikate äquimolaren Konzentration von 500 ng Amplifikate von jeder Probe in eine einzelne Bibliothek Pool zu erreichen. 5) Bibliothek Reinigung: oberen Panel, die gepoolte Bibliothek ist Gel für die Größenauswahl und Reinigung extrahiert. Untere Leiste, die genaue Größe der Bibliothek und Konzentration wird gemessen. 6) Sequenzierung: Hochdurchsatz-Sequenzierung der gepoolten Bibliothek. 7) die Sequenzierungsdaten durch eine bioinformatische Pipeline für 16 s rRNA-Amplifikate mikrobielle Ökologie analysiert. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 2
Abbildung 2 : Konsequente relative Häufigkeit zwischen Proben, die stammt aus der selben Stuhlprobe aber ging durch andere Bibliothek Vorbereitung. Taxonomische relative Häufigkeit der Ebene der Phylum ist pro Probe gezeigt, wie angegeben. Relative Häufigkeit wird für 16 fäkalen Proben aus hospitalisierten Patienten mit vermuteten infektiösen Durchfall, dass jeder durch andere Bibliothek Vorbereitung (Duplikat 1 und 2) mit verschiedenen reverse Barcode Primern und von 3 gesunden Kontrollen ging angezeigt. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 3
Abbildung 3 : Phylogenetische Diversität zeigen konsistente Ergebnisse für Proben, die stammt aus der selben Stuhlprobe, sondern ging durch andere Bibliothek Vorbereitung. Wichtigsten Koordinaten Analyse (HKoA), die Dimensionalität der Eingabedaten reduziert wurde auf der UniFrac-Matrix zur Probe Trennung und Ähnlichkeit visuell zu erkunden. Der Abstand zwischen zwei Proben entspricht der Differenz in ihrer Microbiome Zusammensetzung. (A) ungewichteten UniFrac HKoA plot. Jeder Punkt entspricht eine einzelne sequenzierte Probe. Proben stammen aus der gleichen ursprünglichen Stuhlprobe sind gleich gefärbt. Proben von hospitalisierten Patienten mit positiven Hocker Kultur berichtet von der klinischen Mikrobiologie1 zeichnen sich durch Quadrate, hospitalisierte Patienten mit Kultur in Dreiecke1und gesunde Erwachsene aus einem separaten Sequenzierung Lauf1 negativ mit gefüllt in Kreisen gekennzeichnet sind. (B) dieselbe HKoA wie in A, aber Proben sind jetzt durch ihre relative Häufigkeit der Proteobakterien, gefärbt, wie angegeben. Bitte klicken Sie hier für eine größere Version dieser Figur.

Primer-name Primer Sequenz Primer-Beschreibung
Forward primer AATGATACGGCGACCACCGAGATCTACAC - TATGGTAATT - GT - GTGCCAGCMGCCGCGGTAA 5' Adapter Sequenz - Grundierung Pad weiterleiten - Forward Primer Linker - Forward primer
Reverse-Index-Grundierung CAAGCAGAAGACGGCATACGAGAT - XXXXXXXXXXXX - AGTCAGTCAG - CC - GACTACHVGGGTWTCTAAT Umkehren Sie Ergänzung von 3' Adapter Sequenz - Golay Barcode - rückwärts-Primer Pad - rückwärts-Primer Linker - rückwärts-primer
Lesen Sie 1 Sequenzierung Grundierung TATGGTAATT - GT - GTGCCAGCMGCCGCGGTAA Weiterleiten der Grundierung Pad - Forward Primer Linker - Forward primer
Lesen Sie 2 Sequenzierung Grundierung AGTCAGTCAG - CC - GGACTACHVGGGTWTCTAAT Reverse Primer Pad - rückwärts-Primer Linker - rückwärts-primer
Index-Sequenz-Grundierung ATTAGAWACCCBDGTAGTCC - GG - CTGACTGACT Umgekehrte Ergänzung des rückwärts-Primer - umgekehrte Ergänzung des rückwärts-Primer Linker - umgekehrte Ergänzung des rückwärts-Primer-Pads

Tabelle 1: Primer Liste.

Probe Anzahl der Post mal gelesen
erste Qualitätskontrolle in
QIIME
PCR auf sauberen Tupfer in Extraktion und Verdünnung Lösung-1 118
PCR auf sauberen Tupfer in Extraktion und Verdünnung Lösung-2 39
PCR ohne Vorlage -1 0
PCR ohne Vorlage-2 0
PCR auf Extraktion und Verdünnung Lösungen Mix - 1 16
PCR auf Extraktion und Verdünnung Lösungen Mix - 2 0
Proben (Mittelwert ± Standardfehler) 10622.57 ± 1211.34

Tabelle 2: Anzahl der Lesevorgänge für Negativkontrollen und Stuhlproben.

Ergänzende Material 1: Datenverarbeitung Skript Bitte klicken Sie hier, um diese Datei herunterladen.

Ergänzende Material 2: Mapping-Datei. Bitte klicken Sie hier, um diese Datei herunterladen.

Ergänzende Material 3: Primer Schema. Bitte klicken Sie hier, um diese Datei herunterladen.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

16 s rRNA-Amplifikate und Metagenomik Shotgun Sequencing haben Popularität in klinischer Mikrobiologie Anwendungen21,22,23gewonnen. Diese Techniken sind vorteilhaft in ihre erhöhte Fähigkeit, kultivierbare und nicht-kultivierbare Taxa, die Bereitstellung von Daten über die relative Häufigkeit der pathogenen Inokulum und ihre Fähigkeit, genauer gesagt eine infektiöse Biofilm zu identifizieren zu erfassen Fingerabdruck-24. Die Fortschritte auf dem Gebiet der Microbiome Forschung haben Unmengen an Daten generiert, die nicht aufgrund mangelnder Konsistenz in den verschiedenen Ansätzen leicht vergleichbar sind. In den letzten Jahren haben mehrere Konsortien versucht, einige dieser Probleme zu beheben. Dieses Protokoll folgt ähnlichen Bibliothek Vorbereitung als die Erde Microbiome Project (EMP). Hinzugefügt ist jedoch ein detaillierte Schritt für Schritt Protokoll für DNA-Extraktion aus Stuhlproben durch Analysen Pipeline.

Bisher wurde 16 s rRNA Sequenzierung zur mikrobiellen Zusammensetzung Muster Stuhlproben von gesunden Probanden nicht ins Krankenhaus eingeliefert und von hospitalisierten Patienten mit vermuteten infektiösen Durchfall und traditionelle Kultur Ergebnisse zu charakterisieren. Aus dieser Analyse ergab, dass hospitalisierte Patienten in Taxa von Proteobakterien Phylum1Tiefe erhöht haben. Hier beschriebene ist ein integriertes Protokoll der allgemein verwendeten Methoden für die 16 s rRNA Gens Amplikons Sequenzierung mit PCR-Spalten-freie Direktansprache, die ursprünglich für die Extraktion von pflanzlichen DNA-16. Dieser Ansatz kann effizient und schnell qualitativ hochwertige verstärkt-DNA-Bibliotheken auf die V4 Variable Region der 16 s rRNA-Gen aus einer großen Anzahl von Proben geeignet für Hochdurchsatz-16 s rRNA Sequenzierung zu extrahieren.

Da dies eine Sequenzierung von DNA-basierte Methode ist, sind Daten auf aeroben und Anaerobier mikrobieller Gemeinschaften in eine einzelne Kotprobe präsent erhalten. Das Protokoll angenommen die Primer, die originell gestaltete15 gegen die V4-Region von der 16 s rRNA-Gen waren. Wichtig ist, die umgekehrte Verstärkung Grundierung enthalten eine zwölf Basis Barcode-Sequenz, die Bündelung von bis zu 2.167 verschiedene Proben in jeder Gasse15unterstützt. Die nach vorne Verstärkung Grundierung beinhaltet neun zusätzliche Basen im Großraum Adapter, die gepaart-End Sequenzierung auf die Sequenzierung Plattform25 (Tabelle 1 und ergänzende Material 3) unterstützen. Dieser Ansatz ermöglicht Umgang mit einer Bibliothek bestehend aus 250 Stuhlproben, die auf einer Bahn mit einer laufenden Tiefe von 10622,57 ± 1211,34 (Mittelwert ± Standardfehler) liest pro Probe zu einem Preis von ~ 30 Dollar pro Probe sequenziert wurden.

Um die Qualitätskontrolle zu gewährleisten, empfehlen wir die Verwendung der folgenden Negativkontrollen; (i) PCR ohne DNA Schablone, Ii) PCR DNA extrahiert aus einer sauberen sterilen Tupfer und Iii) gemischt PCR auf Extraktion und Verdünnung Lösung. Für die Positivkontrollen empfiehlt es sich, einschließlich Proben, die stammt aus der selben Stuhlprobe, sondern ging durch andere Bibliothek Vorbereitung mit verschiedenen reverse Barcode Grundierungen und Proben aus vorherigen Ausführungen als interne Qualitätskontrolle. Andere optionale Positivkontrollen verwendet werden sind diese Microbiome Messstandards zur Verfügung gestellt von NIST. Die durchschnittliche liest Abdeckung für den Negativkontrollen ist deutlich geringer im Vergleich zu den tatsächlichen Stuhlproben (Tabelle 1) und setzte sich in erster Linie von Mycoplasma Taxa. Weiter zeigten wir die Konsistenz der Sequenzierung Ergebnisse mit den Proben, die jeweils aus dem gleichen fäkal Material entstanden, aber das ging durch andere Bibliothek Vorbereitung (Abbildung 3). Dieses Ergebnis bestätigt auch, dass bei der Verwendung unserer integrierten Methode gibt es keine Kreuzkontamination zwischen Proben.

In diesem Protokoll führen wir eine integrierte uniformierte, machbare Protokoll um große Anzahl von Proben zu analysieren. Dieses Protokoll zielt darauf ab, führen Wissenschaftler, die bei der Einleitung der Verwendungdes der 16 s rRNA-Amplifikate Sequenzierung in eine robuste, reproduktive, einfach zu bedienen, preiswert, detaillierte Möglichkeit aus fäkal Sammlung, Datenanalysen, wichtige Steuerelemente verwenden. Mit dieser standardisierten detaillierte geführte Protokoll, kann Batch Effekte minimieren und mehr vergleichbare Ergebnisse der Sequenzierung zwischen verschiedenen Labors zu ermöglichen.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren haben nichts preisgeben.

Acknowledgments

Diese Arbeit wurde zum Teil unterstützt von Programms-CORE (Zuschüsse Nr. 41/11), Israel Science Foundation (Grant Nr. 908/15), und die europäischen Morbus Crohn und Colitis Organisation (ECCO).

Materials

Name Company Catalog Number Comments
Primers Integrated DNA Technologies (IDT)
Extraction solution Sigma-Aldrich E7526
Dilution solution Sigma-Aldrich D5688
Kapa HiFi HotStart ReadyMix PCR Kit KAPABIOSYSTEMS KK2601 PCR Master mix
Quant-iT PicoGreen dsDNA Reagent kit Invitrogen P7589 dsDNA quantify reagent
MinElute Gel extraction kit Qiagen 28606
Agarose Amresco 0710-250G
Ultra Pure Water Dnase and Rnase Free Biological Industries 01-866-1A
Qubit dsDNA HS assay kit Molecular probes Q32854 dsDNA detecting kit
High Sensitivity D1000 Agilent Technologies Screen Tape 5067-5582 separation and analysis
Screen Tape Assay Agilent Technologies Reagents 5067-5583 for DNA libraries
PhiX Control v3 Illumina 15017666 control library
MiSeq Reagent Kit v2 (500 cycle) Illumina MS-102-2003
Ethidium Bromide Amresco E406-10mL-TAM
2 mL collection tubes SARSTEDT 72.695.400 Safe Seal collection tubes
Plastic stick swab in PP test tube STERILE INTERIOR 23117
Name Company Catalog Number Comments
Equipment
PCR Machine Applied Biosystems 2720 Thermal Cycler
Sequncing Machine Illumina Miseq
PCR workstation Biosan UV-cleaner
scissors
vortexer Scientific Industries Vortex-Genie 2

DOWNLOAD MATERIALS LIST

References

  1. Braun, T., et al. Fecal microbial characterization of hospitalized patients with suspected infectious diarrhea shows significant dysbiosis. Scientific Reports. 7, 1088 (2017).
  2. De Filippo, C., et al. Impact of diet in shaping gut microbiota revealed by a comparative study in children from Europe and rural Africa. Proceedings of the National Academy of Sciences of the United States of America. 107, 14691-14696 (2010).
  3. Yatsunenko, T., et al. Human gut microbiome viewed across age and geography. Nature. 486, 222-227 (2012).
  4. Rodriguez, J. M., et al. The composition of the gut microbiota throughout life, with an emphasis on early life. Microbial Ecology in Health and Disease. 26, 26050 (2015).
  5. Turnbaugh, P. J., et al. An obesity-associated gut microbiome with increased capacity for energy harvest. Nature. 444, 1027-1031 (2006).
  6. McDonald, D., et al. An improved Greengenes taxonomy with explicit ranks for ecological and evolutionary analyses of bacteria and archaea. The ISME Journal. 6, 610-618 (2012).
  7. Bakken, J. S., et al. Treating Clostridium difficile infection with fecal microbiota transplantation. Clinical Gastroenterology and Hepatology. 9, 1044-1049 (2011).
  8. Khoruts, A., Dicksved, J., Jansson, J. K., Sadowsky, M. J. Changes in the composition of the human fecal microbiome after bacteriotherapy for recurrent Clostridium difficile-associated diarrhea. Journal of Clinical Gastroenterology. 44, 354-360 (2010).
  9. Nood, E. V., et al. Duodenal infusion of donor feces for recurrent Clostridium difficile. The New England Journal of Medicine. 368, 407-415 (2013).
  10. Koplan, J. P., Benfari Ferraro, M. J., Fineberg, H. V., Rosenberg, M. L. Value of stool cultures. The Lancet. 316, 413-416 (1980).
  11. Platts-Mills, J. A., Liu, J., Houpt, E. R. New concepts in diagnostics for infectious diarrhea. Mucosal Immunology. 6, 876-885 (2013).
  12. Bokulich, N. A., et al. Quality-filtering vastly improves diversity estimates from Illumina amplicon sequencing. Nature Methods. 10, 57-59 (2013).
  13. Leek, J. T., et al. Tackling the widespread and critical impact of batch effects in high-throughput data. Nature Reviews Genetics. 11, (2010).
  14. Dubilier, N., McFall-Ngai, M., Zhao, L. Create a global microbiome effort. Nature. 526, 631-634 (2015).
  15. Caporaso, J. G., et al. Global patterns of 16S rRNA diversity at a depth of millions of sequences per sample. PNAS. 108, 4516-4522 (2011).
  16. Flores, G. E., Henley, J. B., Fierer, N. A direct PCR approach to accelerate analyses of human-associated microbial communities. PloS One. 7, (2012).
  17. Caporaso, J. G., et al. QIIME allows analysis of high-throughput community sequencing data. Nature Methods. 7, 335-336 (2010).
  18. Callahan, B. J., et al. DADA2: High-resolution sample inference from Illumina amplicon data. Nature Methods. 13, 581-583 (2016).
  19. Lozupone, C., Knight, R. UniFrac: A new phylogenetic method for comparing microbial communities. Applied and Environmental Microbiology. 71, 8228-8235 (2005).
  20. Lozupone, C., Lladser, M. E., Knights, D., Stombaugh, J., Knight, R. UniFrac: An effective distance metric for microbial community comparison. The ISME Journal. 5, 169-172 (2011).
  21. Srinivasan, R., et al. Use of 16S rRNA gene for identification of a broad range of clinically relevant bacterial pathogens. PloS One. 10, e0117617 (2015).
  22. Hiergeist, A., Gläsner, J., Reischl, U., Gessner, A. Analyses of intestinal microbiota: culture versus sequencing. ILAR Journal. 56, 228-240 (2015).
  23. Didelot, X., Bowden, R., Wilson, D. J., Peto, T. E. A., Crook, D. W. Transforming clinical microbiology with bacterial genome sequencing. Nature Reviews Genetics. 13, 601-612 (2012).
  24. Salipante, S. J., et al. Rapid 16S rRNA next-generation sequencing of polymicrobial clinical samples for diagnosis of complex bacterial infections. PloS One. 8, e65226 (2013).
  25. Caporaso, J. G., et al. Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms. The ISME Journal. 6, 1621-1624 (2012).
Geführte Protokoll für fäkale mikrobielle Charakterisierung von 16 s rRNA-Amplifikate Sequenzierung
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Di Segni, A., Braun, T., BenShoshan, M., Farage Barhom, S., Glick Saar, E., Cesarkas, K., Squires, J. E., Keller, N., Haberman, Y. Guided Protocol for Fecal Microbial Characterization by 16S rRNA-Amplicon Sequencing. J. Vis. Exp. (133), e56845, doi:10.3791/56845 (2018).More

Di Segni, A., Braun, T., BenShoshan, M., Farage Barhom, S., Glick Saar, E., Cesarkas, K., Squires, J. E., Keller, N., Haberman, Y. Guided Protocol for Fecal Microbial Characterization by 16S rRNA-Amplicon Sequencing. J. Vis. Exp. (133), e56845, doi:10.3791/56845 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter