Deze methode beschrijft de klonen, expressie en zuivering van recombinante Nsa1 voor structurele bepaling door middel van röntgendiffractie en small-angle X-ray scattering (SAXS), en is van toepassing voor de hybride structurele analyse van andere eiwitten die beide bevatten besteld en ontregelde domeinen.
Bepaling van de volledige structuur van ribosoom vergadering factor Nsa1 van Saccharomyces cerevisiae (S. cerevisiae) is uitdagend vanwege de wanordelijke en protease labile C-terminus van het eiwit. Dit manuscript worden de methoden beschreven om te zuiveren van recombinante Nsa1 van S. cerevisiae voor structurele analyse door middel van röntgendiffractie zowel SAXS. Röntgendiffractie werd gebruikt om op te lossen van de structuur van het welgeordende N-terminale WD40 domein van Nsa1, en vervolgens SAXS werd gebruikt voor het oplossen van de structuur van de C-terminus van Nsa1 in oplossing. Verstrooiing oplossingsgegevens werd bijeengezocht uit full-length Nsa1 in oplossing. De theoretische verstrooiing amplitudes werden berekend op basis van de hoge resolutie kristalstructuur van het domein WD40, en dan een combinatie van vastlichaam en ab initio modellering geopenbaard de C-terminus van Nsa1. Met deze hybride aanpak werd de quaternaire structuur van de gehele proteïne gereconstrueerd. De methoden die hier worden gepresenteerd gelden over het algemeen voor de hybride structurele bepaling van andere eiwitten die bestaat uit een mix van gestructureerde en ongestructureerde domeinen.
Ribosomen zijn grote ribonucleoprotein machines die de essentiële rol van het vertalen van mRNA naar eiwitten in alle levende cellen verrichten. Ribosomen bestaan uit twee subeenheden die worden geproduceerd in een complex proces ribosoom biogenese1,2,3,4genoemd. Eukaryotische ribosoom vergadering, is afhankelijk van de steun van honderden essentiële ribosomal vergadering factoren2,3,5. Nsa1 (het Nop7 gekoppeld 1) is een eukaryote ribosoom vergadering factor die vereist is voor de productie van de grote ribosomal subeenheid6, en is bekend als WD-repeat met 74 (WDR74) in hogere organismen7. WDR74 heeft aangetoond dat vereist is voor de vorming van de blastocyst in muizen8en de promotor van de WDR74 is vaak gemuteerd in kanker cellen9. De functie en de precieze mechanismen van Nsa1/WDR74 in ribosoom vergadering zijn echter nog steeds grotendeels onbekend. Om te beginnen te ontdekken van de rol van Nsa1/WDR74 tijdens de rijping van de eukaryote ribosoom, werden meerdere structurele analyses uitgevoerd, waaronder röntgendiffractie en kleine hoek X-ray scattering (SAXS)10.
Middel van röntgendiffractie, nucleaire magnetische resonantie (NMR) spectroscopie, elektronenmicroscopie en SAXS zijn alle belangrijke technieken voor de studie van macromoleculaire structuur. Grootte, vorm, beschikbaarheid en stabiliteit van macromoleculen invloeden de structurele biologie methode waarvoor een bepaalde macromolecule beste zal worden geschikt, maar het combineren van meerdere technieken door middel van een zogenaamde “hybride”-aanpak wordt steeds een steeds nuttig hulpmiddel11. Met name zijn röntgendiffractie en SAXS krachtige en complementaire methoden voor structurele bepaling van macromoleculen12.
Kristallografie biedt hoge resolutie atomaire structuren, variërend van kleine moleculen aan grote cellulaire machines zoals het ribosoom, en heeft geleid tot talrijke doorbraken in het begrip van de biologische functies van eiwitten en andere macromoleculen13. Bovendien, harnassen structuur gebaseerde drug design de kracht van kristalstructuren voor moleculaire docking door rekenmethoden, een kritische dimensie toe te voegen aan ontdekking en ontwikkeling van de drug14. Ondanks haar brede toepasbaarheid zijn flexibele en ongeordende systemen uitdagend om te beoordelen door kristallografie aangezien crystal verpakking kan worden belemmerd of elektron dichtheid kaarten mogelijk onvolledige of van slechte kwaliteit. SAXS is daarentegen een oplossingsgerichte en lage resolutie structurele aanpak staat om flexibele systemen, variërend van wanordelijke loops en termini intrinsiek ongeordende eiwitten12,15,16te beschrijven. Gezien het feit dat het is compatibel met een breed scala van deeltje grootte12, kunt SAXS werken synergetisch met kristallografie uit te breiden het bereik van biologische vragen die kunnen worden aangepakt door structurele studies.
Nsa1 is geschikt voor een structurele aanpak van hybride omdat het bevat een goed gestructureerde WD40 domein gevolgd door een functionele, maar flexibele C-terminus die niet vatbaar voor röntgendiffractie methoden. Hier volgt een protocol voor het klonen, expressie en zuivering van S. cerevisiae Nsa1 voor hybride structurele bepaling door middel van röntgendiffractie en SAXS. Dit protocol kan worden aangepast om te bestuderen van de structuren van de andere eiwitten die bestaan uit een combinatie van bevolen en ongeordende regio’s.
Met behulp van dit protocol, werd recombinante Nsa1 van S. cerevisiae gegenereerd voor structurele studies door middel van röntgendiffractie zowel SAXS. Nsa1 was goed opgevoede in oplossing en gekristalliseerd in meerdere kristal vormen. Tijdens de optimalisatie van deze kristallen, werd ontdekt dat de C-terminus van Nsa1 gevoelig voor aantasting van het protease was. De hoge resolutie, orthorhombisch kristal vorm kan alleen worden gedupliceerd met C-terminal truncatie varianten van Nsa1, waarschijnlijk omdat d…
The authors have nothing to disclose.
Diffractie gegevens werden verzameld in Zuidoost-regionale samenwerking toegang Team (SER-kat) 22-ID en 22-BM straallijnen op de geavanceerde Photon bron (JBS), Argonne National Laboratory. De SAXS gegevens verzameld over de SIBILLEN beamline op het voorschot licht bron (ALS), Lawrence Berkeley National Laboratory. We bedank het personeel op de SIBILLEN beamline voor hun medewerking aan externe gegevens verzamelen en verwerken. Wij zijn dankbaar aan de National Institute of Environmental Health Sciences (NIEHS) massaspectrometrie onderzoeks- en steungroep voor hulp het eiwit domeingrenzen bepalen. Dit werk werd ondersteund door het Amerikaanse nationale Instituut van gezondheid intramurale Research Program; Amerikaanse National Institute of Environmental Health Sciences (NIEHS) (ZIA ES103247 naar R. E. S.) en de Canadese instituten van gezondheidsonderzoek (CIHR, 146626 tot M.C.P). Gebruik van de APS werd ondersteund door de ons Department of Energy, Office of Science, Office of Basic Energy Sciences onder Contract nr. W-31-109-Eng-38. Gebruik van de geavanceerde licht bron (ALS) werd gesteund door de directeur, Office of Science, Office van energie basiswetenschappen, van het US Department of Energy onder Contract nr. DE-AC02-05CH11231. Extra ondersteuning voor de SIBILLEN SAXS beamline afkomstig is van de National Institute of Health project MINOS (R01GM105404) en een High-End Instrumentation Grant S10OD018483. Wij zouden ook graag Andrea Moon en Dr. Sara Andres bedanken voor hun kritische lezing van dit manuscript.
Molecular Cloning of Nsa1 | |||
pMBP2 parallel vector | Sheffield et al, Protein Expression and Purification 15, 34-39 (1999) | We used a modified version of pMBP2 which included an N-terminal His-tag (pHMBP) | |
S. cerevisiae genomic DNA | ATCC | 204508D-5 | |
Primers for cloning Nsa1 | |||
SC_Nsa1_FLFw | IDT | CGC CAA AGG CCT ATGAGGTTACTAGTCAGCTGTGT GGATAG |
|
SC_Nsa1_FLRv | IDT | AATGCAGCGGCCGCTCAAATTTT GCTTTTCTTACTGGCTTTAGAAGC AGC |
|
SC_Nsa1_DeltaCFw | IDT | GGGCGCCATGGGATCCATGAGG TTACTAGTCAGCTGTGTGG |
|
SC_Nsa1_DeltaCRv | IDT | GATTCGAAAGCGGCCGCTTAAAC CTTCCTTTTTTGCTTCCC |
|
Recombinant Protein Production and Purification of Nsa1 | |||
Escherichia coli BL21 (DE3) Star Cells | Invitrogen | C601003 | |
pMBP- NSA1 and various truncations | Lo et al., 2017 | ||
Selenomethionine | Molecular Dimensions | MD12-503B | |
IPTG, Dioxane-Free | Promega | V3953 | |
EDTA Free Protease Inhibitor Cocktail | Sigma-Aldrich | 4693159001 | |
Sodium Chloride | Caledon Laboratory Chemicals | 7560-1-80 | |
Magnesium Chloride hexahydrate | Sigma-Aldrich | M2670 | |
Tris Buffer, 1 M pH7.5 | KD Medical | RGF-3340 | |
Glycerol | Invitrogen | 15514-029 | |
beta-mercaptoethanol | Sigma | M6250 | |
1M Imidazole, pH 8.0 | Teknova | I6980-06 | |
Talon Affinity Resin | Clonetech | 635503 | |
Amicon Ultra 15 mL Centrifugal Filter (MWCO 10K) | Millipore | UFC901024 | |
HiLoad 16/600 Superdex 200 Prep Grade Gel Filtration Column | GE-Healthcare | 28989335 | |
TEV Protease | Prepared by NIEHS Protein Expression Core | Expression plasmid provided by NCI (Tropea et al. Methods Mol Biology, 2009) | |
4-15% Mini-PROTEAN TGX Precast Protein Gels | BioRad | 456-8056 | |
Crystallization, Proteolytic Screening | |||
Crystal Screen | Hampton Research | HR2-110 | |
Crystal Screen 2 | Hampton Research | HR2-112 | |
Salt Rx | Hampton Research | HR2-136 | |
Index Screen | Hampton Research | HR2-144 | |
PEG/Ion Screen | Hampton Research | HR2-139 | |
JCSG+ | Molecular Dimensions | MD1-37 | |
Wizard Precipitant Synergy | Molecular Dimensions | MD15-PS-T | |
Swissci 96-well 3-drop UVP sitting drop plates | TTP Labtech | 4150-05823 | |
3inch Wide Crystal Clear Sealing Tape | Hampton Research | HR4-506 | |
Proti-Ace Kit | Hampton Research | HR2-429 | |
PEG 1500 | Molecular Dimensions | MD2-100-6 | |
PEG 400 | Molecular Dimensions | MD2-100-3 | |
HEPES/sodium hydroxide pH 7.5 | Molecular Dimensions | MD2-011- | |
Sodium Citrate tribasic | Molecular Dimensions | MD2-100-127 | |
22 mm x 0.22 mm Siliconized Coverslides | Hampton Research | HR3-231 | |
24 Well Plates with sealant (VDX Plate with Sealant) | Hampton Research | HR3-172 | |
18 mM Mounted Nylon Loops (0.05 mm to 0.5 mM) | Hampton Research | HR4-945, HR4-947, HR4-970, HR4-971 | |
Seed Bead Kit | Hampton Research | HR2-320 | |
Magnetic Crystal Caps | Hampton Research | HR4-779 | |
Magnetic Cryo Wand | Hampton Research | HR4-729 | |
Cryogenic Foam Dewar | Hampton Research | HR4-673 | |
Crystal Puck System | MiTeGen | M-CP-111-021 | |
Full Skirt 96 well Clear Plate | VWR | 10011-228 | |
AxyMat Sealing Mat | VWR | 10011-130 | |
Equipment | |||
UVEX-m | JAN Scientific, Inc. | ||
Nanodrop Lite Spectrophotometer | Thermo-Fisher | ||
Mosquito Robot | TTP Labtech | ||
Software/Websites | |||
HKL2000 | Otwinoski and Minor, 1997 | ||
Phenix | Adams et al., 2010 | ||
Coot | Emsley et al., 2010 | ||
ATSAS | Petoukhov et al., 2012 | https://www.embl-hamburg.de/biosaxs/atsas-online/ | |
Scatter | Rambo and Tainer, 2013 | ||
Pymol | The PyMOL Molecular Graphics System, Version 1.8 Schrödinger, LLC. | ||
BUNCH | Petoukhov and Svergun, 2005 | ||
CRYSOL | Svergun et al, 1995 | ||
PRIMUS | Konarev et al, 2003 | ||
EOM | Tria et al, 2015 |