Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biochemistry

Het combineren van röntgendiffractie met kleine hoek X-Ray Scattering model ongestructureerde regio's van de Nsa1 van S. Cerevisiae

doi: 10.3791/56953 Published: January 10, 2018

Summary

Deze methode beschrijft de klonen, expressie en zuivering van recombinante Nsa1 voor structurele bepaling door middel van röntgendiffractie en small-angle X-ray scattering (SAXS), en is van toepassing voor de hybride structurele analyse van andere eiwitten die beide bevatten besteld en ontregelde domeinen.

Abstract

Bepaling van de volledige structuur van ribosoom vergadering factor Nsa1 van Saccharomyces cerevisiae (S. cerevisiae) is uitdagend vanwege de wanordelijke en protease labile C-terminus van het eiwit. Dit manuscript worden de methoden beschreven om te zuiveren van recombinante Nsa1 van S. cerevisiae voor structurele analyse door middel van röntgendiffractie zowel SAXS. Röntgendiffractie werd gebruikt om op te lossen van de structuur van het welgeordende N-terminale WD40 domein van Nsa1, en vervolgens SAXS werd gebruikt voor het oplossen van de structuur van de C-terminus van Nsa1 in oplossing. Verstrooiing oplossingsgegevens werd bijeengezocht uit full-length Nsa1 in oplossing. De theoretische verstrooiing amplitudes werden berekend op basis van de hoge resolutie kristalstructuur van het domein WD40, en dan een combinatie van vastlichaam en ab initio modellering geopenbaard de C-terminus van Nsa1. Met deze hybride aanpak werd de quaternaire structuur van de gehele proteïne gereconstrueerd. De methoden die hier worden gepresenteerd gelden over het algemeen voor de hybride structurele bepaling van andere eiwitten die bestaat uit een mix van gestructureerde en ongestructureerde domeinen.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Ribosomen zijn grote ribonucleoprotein machines die de essentiële rol van het vertalen van mRNA naar eiwitten in alle levende cellen verrichten. Ribosomen bestaan uit twee subeenheden die worden geproduceerd in een complex proces ribosoom biogenese1,2,3,4genoemd. Eukaryotische ribosoom vergadering, is afhankelijk van de steun van honderden essentiële ribosomal vergadering factoren2,3,5. Nsa1 (het Nop7 gekoppeld 1) is een eukaryote ribosoom vergadering factor die vereist is voor de productie van de grote ribosomal subeenheid6, en is bekend als WD-repeat met 74 (WDR74) in hogere organismen7. WDR74 heeft aangetoond dat vereist is voor de vorming van de blastocyst in muizen8en de promotor van de WDR74 is vaak gemuteerd in kanker cellen9. De functie en de precieze mechanismen van Nsa1/WDR74 in ribosoom vergadering zijn echter nog steeds grotendeels onbekend. Om te beginnen te ontdekken van de rol van Nsa1/WDR74 tijdens de rijping van de eukaryote ribosoom, werden meerdere structurele analyses uitgevoerd, waaronder röntgendiffractie en kleine hoek X-ray scattering (SAXS)10.

Middel van röntgendiffractie, nucleaire magnetische resonantie (NMR) spectroscopie, elektronenmicroscopie en SAXS zijn alle belangrijke technieken voor de studie van macromoleculaire structuur. Grootte, vorm, beschikbaarheid en stabiliteit van macromoleculen invloeden de structurele biologie methode waarvoor een bepaalde macromolecule beste zal worden geschikt, maar het combineren van meerdere technieken door middel van een zogenaamde "hybride"-aanpak wordt steeds een steeds nuttig hulpmiddel11. Met name zijn röntgendiffractie en SAXS krachtige en complementaire methoden voor structurele bepaling van macromoleculen12.

Kristallografie biedt hoge resolutie atomaire structuren, variërend van kleine moleculen aan grote cellulaire machines zoals het ribosoom, en heeft geleid tot talrijke doorbraken in het begrip van de biologische functies van eiwitten en andere macromoleculen13. Bovendien, harnassen structuur gebaseerde drug design de kracht van kristalstructuren voor moleculaire docking door rekenmethoden, een kritische dimensie toe te voegen aan ontdekking en ontwikkeling van de drug14. Ondanks haar brede toepasbaarheid zijn flexibele en ongeordende systemen uitdagend om te beoordelen door kristallografie aangezien crystal verpakking kan worden belemmerd of elektron dichtheid kaarten mogelijk onvolledige of van slechte kwaliteit. SAXS is daarentegen een oplossingsgerichte en lage resolutie structurele aanpak staat om flexibele systemen, variërend van wanordelijke loops en termini intrinsiek ongeordende eiwitten12,15,16te beschrijven. Gezien het feit dat het is compatibel met een breed scala van deeltje grootte12, kunt SAXS werken synergetisch met kristallografie uit te breiden het bereik van biologische vragen die kunnen worden aangepakt door structurele studies.

Nsa1 is geschikt voor een structurele aanpak van hybride omdat het bevat een goed gestructureerde WD40 domein gevolgd door een functionele, maar flexibele C-terminus die niet vatbaar voor röntgendiffractie methoden. Hier volgt een protocol voor het klonen, expressie en zuivering van S. cerevisiae Nsa1 voor hybride structurele bepaling door middel van röntgendiffractie en SAXS. Dit protocol kan worden aangepast om te bestuderen van de structuren van de andere eiwitten die bestaan uit een combinatie van bevolen en ongeordende regio's.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. recombinant eiwitproductie en zuivering van Nsa 1

  1. Nsa1 expressie plasmide ontwerp en klonen
    1. Verkrijgen of kopen van S. cerevisiae genomic DNA.
    2. PCR versterken de sequenties van de doelstelling van Nsa1 (Nsa1FL, residuen 1-463) en C-terminal afgekapt Nsa1 (Nsa1ΔC, residuen 1-434) met passende inleidingen gebruikend genomic DNA van S. cerevisiae en een smelttemperatuur van geïsoleerd ongeveer 60 ° C met een tijd van de uitbreiding van 1-2 min. De volgende inleidingen werden gebruikt om het versterken van de Nsa1:
      SC_Nsa1_FLFw:CGCCAAAGGCCTATGAGGTTACTAGTCAGCTGTGTGGATAG
      SC_Nsa1_FLRv:AATGCAGCGGCCGCTCAAATTTTGCTTTTCTTACTGGCTTTAGAAGCGC
      SC_Nsa1ΔcFw:GGGCGCCATGGGATCCATGAGGTTACTAGTCAGCTGTGTGG
      SC_Nsa1ΔcRv: GATTCGAAAGCGGCCGCTTAAACCTTCCTTTTTTGCTTCCC
    3. Nsa1 in de Escherichia coli (E. coli) expressie vector pHMBP met een N-terminal subclone 6 X-Histidine label gevolgd door de Maltose bindend proteïne (MBP) en een tabak Etch Virus (TEV) protease-site met behulp van standaard kloontechnieken17 .
    4. Gebruik DNA rangschikkend om te verifiëren dat de Nsa1 in het frame met de N-terminal zijn-MBP tag werd gekloond.
  2. Nsa1 eiwit expressie
    1. De expressie plasmid(s) omvormen tot een geschikt E. coli expressie stam met een T7 promotor-gebaseerd systeem. Plaat van de transformants op LB agar platen met 100 µg/mL ampicilline en Incubeer de plaat omgekeerd 's nachts bij 37 ° C.
    2. Enten van een cultuur van de 50 mL voor LB met 100 µg/mL ampicilline van de transformatie-plaat, en 's nachts groeien met schudden bij 200 t/min bij 37 ° C.
    3. Enten van 3 x 1000 mL voor LB in Fernbach kolven met 100 µg/mL ampicilline met 15 mL van de overnachting cultuur en groeien met schudden bij 200 t/min bij 37 ° C.
      Opmerking: Voor de oplossing van de structuur van eiwitten, opneming van de selenomethionyl (SeMet) kan worden bereikt door de groeiende cellen in M9 minimaal medium dat wordt aangevuld met SeMet en een mengsel van het aminozuur voor de remming van methionine productie vóór inductie, in tegenstelling tot de LB-media 18.
    4. Induceren uitdrukking van Nsa1 wanneer de OD600 ~0.8 door toevoeging van isopropyl β-D-1 thiogalactopyranoside (IPTG bereikt) op een eindconcentratie van 1 mM, gevolgd door incubatie bij 25 ° C's nachts met schudden bij 200 omwentelingen per minuut.
    5. Oogsten van cellen door centrifugeren bij 4 ° C gedurende 15 minuten staan bij 5,050 x-g.
      Opmerking: Cellen kunnen worden opgeslagen op lange termijn bij-80 ° C of onmiddellijk gebruikt voor eiwitreiniging.
  3. Nsa1 eiwitreiniging
    1. Resuspendeer de cellen in 25 mL lysisbuffermengsel (50 mM Tris-HCl, pH 7.5, 500 mM NaCl, 10% glycerol, 10 mM MgCl2) vooraf gekoeld bij 4 ° C met een EDTA-vrije protease inhibitor tablet.
    2. Lyse cellen met het ultrasoonapparaat bij 4 ° C (tijd 7 min, 2 s op cyclus, 2 s uit cyclus; amplitude: 70%).
    3. Verduidelijken lysate door centrifugeren bij 26,900 x g gedurende 45 min bij 4 ° C.
    4. Toepassing verduidelijkt lysate aan een kolom van zwaartekracht stroom geladen met 10 mL geïmmobiliseerdet kobalt affiniteit hars, vooraf zijn geëquilibreerd met Lysis-buffermengsel.
    5. Laat het supernatant voorbij de hars door zwaartekracht stroom bij 4 ° C te wassen de hars tweemaal met 100 mL lysisbuffermengsel.
    6. Elueer Nsa1 met 20 mL elutie buffer (50 mM Tris-HCl pH 7.5, van 500 mM NaCl, 5 mM MgCl2, 5% glycerol en 200 mM imidazol).
    7. Neem 15 μl van het eluaat en draaien op een 4-15% SDS-pagina gel om te verifiëren dat het eiwit van de affiniteit hars (figuur 1A) wordt geëlueerd.
    8. Verwijder de MBP tag door TEV protease spijsvertering. 1 mL van TEV protease19 (1 mg/mL stockoplossing) toevoegen aan de Nsa1 affiniteit hars elutie en het bij 4 ° C na een nacht bebroeden.
    9. Concentraat MBP gekloofd Nsa1 naar ~ 5 mL met behulp van een centrifugaal filter met een moleculair gewicht cut off van 10 kDa.
    10. MBP-gekloofd Nsa1 van toepassing op een gel-filtratie-kolom, vooraf geëquilibreerd in buffer (20 mM Tris-HCl pH 7.5, 100 mM NaCl, 1 mM MgCl2, 5% glycerol en 1 mM β-mercaptoethanol) (figuur 1B).
    11. Analyseren van kolom breuken uit gel filtratie om te verifiëren dat MBP gekloofd en van Nsa1 gescheiden door 15 μL monsters uit te voeren op een 4-15% SDS-pagina gel (figuur 1B).
    12. Breuken met Nsa1 combineren en concentreren op 8 mg/mL met behulp van een centrifugaal filter met een moleculair gewicht van cut off van 10 kDa.
    13. De eiwitconcentratie bepalen door het meten van de absorptie bij 280 nm in een spectrofotometer met behulp van het uitsterven coëfficiënt 42530 M-1cm-1. Eiwit direct gebruiken voor Proteolytische screening en kristallisatie proeven.

2. kristallisatie en Proteolytische Screening van Nsa 1

  1. Sparse Matrix Crystal Screening van Nsa1
    1. Centrifugeer 500 μL van de voorraad van de 8 mg/mL van Nsa1 bij 16.000 x g bij 4 ° C gedurende 10 minuten.
    2. Setup kristallisatie proeven met behulp van een robot kristallisatie en sparse matrix crystal schermen. Vul het reservoir van 96 goed laden met 30 μl van de individuele kristallen scherm reagentia van sparse matrix kristallisatie schermen. Vergadering druppels Setup met de robot door het mengen van 250 nL van de goed oplossing met 250 nL van de eiwit-oplossing.
    3. Zegel van de kristallisatie platen met tape en hen uit te broeden bij 25 ° C.
    4. Inspecteer de platen om de twee dagen voor de eerste 2-3 weken met een stereomicroscoop.
    5. Controleer of potentiële kristallen hits bevatten eiwitten met een UV-Microscoop.
      Opmerking: Voor Nsa1 twee verschillende kristallen vormen (kubieke en orthorhombisch, figuur 2A) werden verkregen binnen 1 week uit de volgende schermen: JCSG + voorwaarde B11 (1,6 M Natriumcitraat TRIBASISCH uitdrogen, pH 6,5) en Wizard Precipitant synergie scherm blok 2 voorwaarde C11 (20.1%(v/v) PEG 1500 13.4%(v/v) PEG 400, 0,1 M Tris HEPES/natriumhydroxide, pH 7.5).
  2. Proteolytische Screening
    Opmerking: Tijdens de kristallisatie optimalisatie, werd ontdekt dat de orthorhombisch kristallen van Nsa1 ontstond als gevolg van Proteolytische splijten en de kristallen kon niet worden gedupliceerd met behulp van de full-length proteïne. Met behulp van een combinatie van beperkte proteolyse gekoppeld aan massaspectrometrie, werd vastgesteld dat de C-terminus van Nsa1 gevoelig voor proteolyse was en verwijdering van de C-terminal staart vereist voor latere reproductie van de orthorhombisch kristal vorm was ( Nsa1ΔC).
    1. Bereiden van 1 mg/mL protease stamoplossingen van de volgende proteasen α-Chymotrypsine, trypsine, elastase, papaïne, subtilisin en endoproteinase Glu-C.
    2. 1:10, 1:100 en 1:1000 verdunningen van elk 1 mg/mL protease aandeel maken met verdunning Buffer (10 mM HEPES, pH 7.5, 500 mM natrium chloride).
    3. Pipetteer 1 μL van protease voorraad (1:10, 1:100 en 1:1000) in 9 μL aliquots van eiwitten (1 mg/mL) voor elke protease worden vertoond.
    4. Incubeer de oplossing bij 37 ° C gedurende 1 uur.
    5. Zet de reactie stop door het toevoegen van 10 μL van 2 x SDS-pagina monster buffer en warmte de reactie bij 95 ° C gedurende 5 min.
    6. Analyseer de geklaard door hen uit te voeren op een 4-15% SDS-pagina gel (figuur 2B).
    7. Identificeren protease resistente domeinen van het target-eiwit door analyse van de Spectrometrie van de massa van het in-gel.
    8. Verwijder de protease-onstabiele regio's uit het doel eiwit door het creëren van afgeknotte expressie constructies en na het protocol van het klonen, expressie en zuivering hierboven beschreven.
  3. Kristallisatie optimalisatie
    1. Bereiden of verkrijgen van stamoplossingen van de volgende eerste kristallisatie reagentia: 1,6 M Natriumcitraat TRIBASISCH uitdrogen pH 6,5, 100%(v/v) PEG 400, 50%(v/v) 1500 PEG, 1 M HEPES/natriumhydroxide, pH 7.5.
    2. Bereiden van een stamoplossing van Nsa1FL en Nsa1ΔC bij 8 mg/mL zoals hierboven beschreven.
    3. Optimaliseren van de Nsa1 kubieke kristallen (Nsa1FL).
      1. Bereiden een scherm 24-well raster met putten met 500 µL met een verloop van 1-1.6 M van Natriumcitraat met pH 6,5 van een stamoplossing van 1.6 M Natriumcitraat TRIBASISCH met pH 6,5.
      2. Meng 1 µL van eiwit met 1 µL van goed oplossing en plaats het mengsel in een dia gesiliconiseerd dekking. Zorgvuldig omkeren de dia dekking bovenop de vooraf ingevette goed en zorgen voor het goed is afgedicht, maar zorg niet verstoren de daling of breken van de dia deksel. Herhaal dit proces totdat de lade wordt gevuld en sla bij 25 ° C.
        Opmerking: Kleine kubieke kristallen moeten verschijnen in 2-7 dagen.
      3. Bereiden een microseed voorraad van de kubieke kristallen. Gebruik een gemonteerde nylon lus ~ 10 kleine kubieke kristallen overbrengen naar een 1,5 mL micro-centrifuge buis met een kleine hiel en 50 µL van 1.6 M Natriumcitraat TRIBASISCH wit pH 6,5.
      4. Vortex de 1,5 mL micro-centrifuge buis op hoge snelheid (~ 3000 rpm) voor 1 min.
      5. Een aantal 10-fold seriële verdunningen van het uitgangsmateriaal met 1,6 M Natriumcitraat TRIBASISCH en vortex maken het mengsel grondig voor 5 s.
      6. Vullen elkaar goed aan een raster van 24-well, scherm met 500 µL van 1.6 M Natriumcitraat TRIBASISCH pH 6,5.
      7. Het optimaliseren van de microseeding-voorwaarden door het opzetten van druppels met verschillende verhoudingen van eiwit met de oplossingen van het uitgangsmateriaal (figuur 3A). Grotere kubieke kristallen van diffractie van hoge kwaliteit moeten worden weergegeven in 2-5 dagen (Figuur 3 c).
    4. Optimaliseren van de orthorhombisch kristallen (Nsa1ΔC)
      1. Het scherm van een raster met 500 µL in elk putje met 24 verschillende omstandigheden (figuur 3B) bereiden van stamoplossingen van 50%(v/v) PEG 1500 en 100%(v/v) PEG 400. Naast gradiënten van PEG 1500 en PEG 400, moet elk goed ook bevatten 0,1 M HEPES/natrium hydroxide pH 7.5.
      2. Meng 1 µL van eiwit-oplossing met 1 µL van goed oplossing op een dia gesiliconiseerd dekking. Zorgvuldig wordt omkeren de dia dekking bovenop de vooraf ingevette goed en zorgen voor het goed verzegeld. Herhaal dit proces totdat de hele lade is ingevuld. Opslaan van de schaaltjes bij 25 ° C.
        Opmerking: Nsa1 orthorhombisch kristallen moeten verschijnen in 2-7 dagen.
      3. Verder de orthorhombisch kristallen te optimaliseren door microseeding als beschreven voor de kubieke kristallen (stappen 2.3.3.3 naar 2.3.3.7) met behulp van 500 µL van 20.1%(v/v) PEG 1500, 13.4%(v/v) PEG 400 en 0,1 M HEPES/natrium hydroxide pH 7.5 als de oplossing goed.
        Opmerking: Nsa1 SeMet kristallen moeten worden geoptimaliseerd analoog aan de inheemse kristallen.

3. röntgendiffractie gegevensverzameling en Nsa 1 structuur oplossing

  1. Cryo-bescherming van kristallen en röntgendiffractie gegevensverzameling
    1. Voor de orthorhombisch kristallen (Nsa1ΔC), bereid een cryoprotectant-oplossing van 1 mL met 22.5%(v/v) PEG 1500, 15%(v/v) PEG 400 en 0,1 M HEPES/natrium hydroxide pH 7.5.
    2. Vul een schuim Dewar met vloeibare stikstof, en vooraf een kristal puck koel. Wees voorzichtig bij het werken met vloeibare stikstof en Draag beschermende handschoenen en bril.
    3. Voorzichtig omkeren de dia van de dekking van de kristallisatie putje met kristallen op het podium van een stereomicroscoop.
    4. Pipetteer 2 µL van de cryoprotectant-oplossing op een nieuwe dia die dekking.
    5. Een gemonteerde nylon lus van de juiste grootte voor het kristal hechten aan een magnetische cryo roede.
    6. Met de hulp van de stereomicroscoop, snel overbrengen in een kristal de cryoprotectant-oplossing met de gekoppelde cryo-lus.
    7. Laat het kristal equilibreer gedurende 5 min in de cryoprotectant-oplossing.
    8. Met de hulp van de stereomicroscoop, snel lus van het kristal van de cryoprotectant oplossing en duik-freeze in vloeibare stikstof.
    9. Wachten op de vloeibare stikstof rond de lus om te stoppen met het koken en laat vervolgens de lus van de toverstaf in een bepaalde locatie binnen de crystal puck.
    10. Kubieke Nsa1FL kristallen hoeft niet te worden cryoprotected en kan worden rechtstreeks flitser bevroren (na stappen 3.1.8-3.1.9 hierboven).
    11. Zegel van de crystal-puck met cryo's en transfer naar een verzending stok in een vooraf gekoeld dewar. Bewaren van kristallen in de pucks/dewars tot het verzamelen van gegevens.
    12. Als het verzamelen van gegevens op een synchrotron, schip kristallen naar de synchrotron met behulp van een droge verzender.
    13. Röntgendiffractie gegevens na standaardtechnieken20verzamelen.
      Opmerking: Voor Nsa1 native en SAD (single-golflengte anomalous dispersion) datasets werden verzameld bij 100 K op de SER-CAT lichtbundel lijn 22-ID en 22-BM van de geavanceerde Photon bron bij het Argonne National Laboratory (Chicago, IL). SAD Nsa1 dataset werd verzameld op λ = 0.97911 Å. Gegevens werd opgenomen met een 1 s blootstellingstijd en 0,5 ° oscillaties. De mosaicity van deze kristallen was meestal ongeveer 0.3°.
    14. Proces en schaal het röntgendiffractie beelden voor het genereren van reflectie bestanden voor iedere gegevensverzameling in de juiste ruimtegroep.
      Opmerking: Nsa1 diffractie datasets werden verwerkt met HKL200021. De Nsa1 kubieke kristallen werden verwerkt in de ruimte groep P21, 3 en de orthorhombisch kristallen werden verwerkt in de ruimte groep P212121.
  2. Nsa1 structuur oplossing.
    Opmerking: Er zijn verschillende kristallografie softwarepakketten die kunnen worden gebruikt op te lossen en verfijnen van kristalstructuren, met inbegrip van Phenix en CCP422,23. Hier volgt het protocol voor Nsa1 structuur oplossing met behulp van de Phenix software suite22.
    1. Analyseren de Native en SAD geschaald datasets met phenix.xtriage22.
    2. Het oplossen van de structuur van Nsa1 met Phenix.autosol met behulp van de trieste piek reflectie bestand22,24. Input voor het uitvoeren van het programma van AutoSol, het aantal selenomethionine sites (sites = 9), het bestand fasta opeenvolging van Nsa1ΔC, en de golflengte gebruikt voor triest gegevensverzameling (λ = 0.97911 Å).
      Opmerking: Uit de Nsa1 SAD dataset, phenix.autosol moeten zitten kundig voor de experimentele fasen bepalen en bouwen de meeste van het model.
    3. Handmatige aanpassingen aan het model met Coot25, gevolgd door verfijning van phenix.refine22,26.
    4. De structuur van het hoge-resolutie inheemse orthorhombisch kristal en het kubieke kristal oplossen door moleculaire vervanging met behulp van de Phaser27,28.
    5. Inspecteer na succesvolle structuur oplossing, het model en de dichtheid van de electron kaart in Coot25.
    6. Bouwen en verfijnen van de structuren door het uitvoeren van iteratieve rondes van verfijning in phenix.refine22,26 en modelbouw in de Meerkoet25.

4. SAXS gegevensverzameling, verwerking en modelleren

  1. SAXS gegevensverzameling
    Opmerking: SAXS gegevens werden opgenomen voor full-length S. cerevisiae Nsa1 bij de geavanceerde lichtbron, op de high-throughput SIBILLEN beamline 12.3.1 bij het Lawrence Berkeley National Laboratory, Berkeley, CA29.
    1. Zuiveren van Nsa1FL volgens het protocol zoals hierboven beschreven. 24 uur vóór de verzending van Nsa1FL aan de beamline, eiwit overreden door een gel filtratie kolom geëquilibreerd vooraf in de buffer A.
    2. Bundelen van breuken met Nsa1 en bepalen de eiwitconcentratie, zoals eerder is beschreven.
    3. Bereiden van 30 μl aliquots van een reeks van de concentratie van Nsa1 van 1 op 6.2 mg/mL met buffer A.
    4. 20 μl van elke reeks van de concentratie van Nsa1 overbrengen in een duidelijke volledige rok 96 goed microplate samen met buffer A alleen besturingselementen.
      Opmerking: SAXS gegevens worden verzameld op verdunde oplossingen met behulp van verschillende concentraties van gezuiverde monster aggregatie, Inter deeltje walging, en effecten van straling schade te voorkomen.
    5. Verzegel de microplate met een siliconen afdichting mat en schip 's nachts bij 4 ° C tot de beamline.
    6. Bewaren de microplate bij 4 ° C tot gegevensverzameling.
    7. Onmiddellijk vóór het verzamelen van gegevens, draai de plaat bij 3200 x g gedurende 10 minuten bij 4 ° C luchtbellen te verwijderen van potentiële aggregaten.
    8. SAXS recordgegevens.
      Opmerking: Voor Nsa1, SAXS gegevens werden opgenomen voor de buffer vóór en na elke reeks van eiwit concentratie. Drieëndertig opeenvolgende scans van 0.3 s werden verzameld voor Nsa1FL over een reeks van concentratie (1 op 6.2 mg/mL) bij 10 ° C.
    9. Buffer aftrekken voor SAXS gegevens uitvoeren
      Opmerking: Voor Nsa1 buffer aftrekken was automatisch gedaan bij de beamline maar buffer aftrekken kan ook worden uitgevoerd met behulp van de software van de vermindering van de gegevens zoals Scatter30 en de ATSAS suite31. Buffer aftrekken is een cruciaal onderdeel van gegevensanalyse SAXS en zorg moet worden genomen om ervoor te zorgen dat de buffer die wordt gebruikt voor aftrekken identiek aan de eiwit monster buffer is.
    10. Gemiddelde scant de opeenvolgende 33 om een *ave.dat-bestand voor elke concentratie te maken.
      Opmerking: Overlay de 33 opeenvolgende frames te vergelijken van de curven. Wijzigingen in de verstrooiing bochten na verloop van tijd is vaak een indicatie van de schade door straling. Uitsluiten dat deze frames gemiddeld. Gemiddeld van de opeenvolgende scans van Nsa1 werd automatisch uitgevoerd in de beamline SIBILLEN.
  2. SAXS gegevensverwerking en vergelijking van concentratie serie
    Opmerking: Er zijn verschillende softwarepakketten die kunnen worden gebruikt om SAXS gegevens te analyseren. Voor Nsa1 in de straal van traagheidsstralen en functies van paarsgewijse afstand verdelingen werden bepaald met behulp van PRIMUS32 en Gnom33 van de ATSAS 2.7.2 suite31 en vergeleken in alle concentraties van het eiwit om ervoor te zorgen dat er was geen straling schade of concentratie-afhankelijke Inter deeltje interacties10.
    1. Open een terminal shell en ga naar de directory met de SAXS gegevens.
    2. De PRIMUS32 GUI van binnen de terminal shell te starten.
    3. Binnen de PRIMUS GUI, laden de verstrooiing curven (* ave.dat).
    4. AutoRg te bepalen van de straal van Gyration (Rg) en verstrooiing intensiteit, I(0), voor elke verstrooiing curve gebruiken (* ave.dat).
    5. Genereren van Kratky percelen voor elke verstrooiing curve (* ave.dat), om te evalueren van de mate van compactheid.
    6. AutoGNOM33 te gebruiken voor het berekenen van de paarsgewijse verdelingsfunctie (ook wel genoemd P(r)) voor elke verstrooiing curve (* ave.dat). Voer een begin Dmax ≈ 3 * Rg en optimaliseren van de D-max waarde te verkrijgen van een vloeiende curve van de P(r). Tijdens de optimalisatie van D-max, ervoor zorgen dat de berekende P(r) functie is in overeenstemming met de experimentele verstrooiing curve door het controleren van de gerapporteerde χ2 waarde en visueel beoordelen de totale aanpassen aan de verstrooiing curve.
    7. Berekenen van het molecuulgewicht van de Nsa1 uit de verstrooiing krommen met behulp van het volume van de correlatie34.
    8. Vergelijk de structurele parameters voor elke concentratie om ervoor te zorgen dat er geen schade door straling of concentratie-afhankelijke effecten zijn.
      Opmerking: Effecten van de concentratie kunnen zich manifesteren als een toenemende Rg en Dmax in verband met een toenemende eiwitconcentratie. Voorwaarts verstrooiing I(0) gedeeld door de concentratie van het monster moet ook constant blijft over de eiwit concentratie serie.
  3. SAXS Modeling
    Opmerking: Om te bepalen van de positie van de C-terminus van Nsa1FL, de Nsa1 kristal structuur10 (VOB 5SUM) en de SAXS verstrooiing krommen werden gebruikt voor het uitvoeren van een combinatie van vastlichaam en ab initio modellering, met behulp van de programma's bos 35 en Ensemble optimalisatie methode (EOM)36 van de ATSAS software suite31. Het domein van de WD40 van Nsa1 werd behandeld als een star lichaam, terwijl de C-terminus van Nsa1 samen met verschillende ongeordende lussen van het domein WD40 werden gemodelleerd aanpassen aan de experimentele SAXS gegevens.
    1. De input VOB-bestanden te genereren. Het VOB-bestand moet worden opgesplitst telkens residuen verdwenen uit de belangrijkste keten zijn en het VOB-bestand niet bevatten meerdere conformaties, liganden, of water moleculen.
    2. Voer het programma Pre_BUNCH35 voor te bereiden het invoerbestand VOB bos (pre_bunch.pdb). De volgorde van het target-eiwit (*.seq), het aantal domeinen/PDBs gegenereerd in 4.3.1, input en elk van de afzonderlijke VOB-bestanden gegenereerd boven.
    3. Bereken de amplitudes van de verstrooiing voor elke individuele VOB-bestand met behulp van het programma CRYSOL37. Input het afzonderlijke VOB-bestand en de experimentele SAXS verstrooiing curve (*.dat) uit te voeren CRYSOL. Hierdoor genereert u een bestand amplitudes (* .alm).
    4. Voer het programma bos35 om het model van het domein van de WD40 van Nsa1 tegen de SAXS gegevens met behulp van een gecombineerde rigide lichaam en ab initio aanpak. Ingang van het VOB-bestand van Pre_BUNCH (pre_bunch.pdb), de experimentele SAXS verstrooiing curve (*.dat) en de individuele amplitude (* .alm) bestanden voor elke gedeeltelijke VOB bestand gegenereerd door CRYSOL.
    5. Vergelijk de χ2 waarde van de eerste VOB (5SUM) met die van de ab initio model gegenereerd door bos met behulp van de experimentele SAXS gegevens.
      Opmerking: Een succesvol model van het bos moeten een aanzienlijk lagere χ2 waarde dan het eerste model. De theoretische verstrooiing van het bos-model moet ook goed beschrijven de experimentele gegevens zoals beoordeeld door visuele inspectie van de overlay tussen de theoretische verstrooiing van het model van de bos de SAXS gegevens en de waarde2 χ (Figuur 4, Center-gasleiding).
    6. Handmatig controleren de output bestanden uit bos in Pymol38 overlay van de kristalstructuur met het model gegenereerd door bos en de SAXS envelop (Figuur 4, centrum pijpleiding).
    7. BOS opnieuw 10 - 20 keer voor het genereren van onafhankelijke modellen om te bevestigen dat de modellen vergelijkbaar zijn.
      Opmerking: Voor de Nsa1 was er een aantal χ2 waarden van ~ 1 tot 3 van 20 onafhankelijke loopt.
    8. Ensemble Modeling
      Opmerking: als een optionele benadering bos EOM36 of minimale Ensemble Zoek39 (MES) uitvoert. EOM en MES gebruiken ensemble benaderingen, die geschikt zijn voor eiwitten met flexibele domeinen/regio's die in meerdere conformaties.
      1. Voer het programma EOM36 met behulp van de online server van ATSAS. Input voor het uitvoeren van EOM, de VOB-bestanden uit 4.3.1, de volgorde van de doel-eiwit (*.seq), en de experimentele SAXS gegevens (*.dat).
      2. Vergelijk de χ2 waarden van het begin VOB (5SUM) met die van het ensemble gegenereerd door EOM met behulp van de experimentele SAXS gegevens.
        Opmerking: Een succesvolle EOM ensemble moeten een aanzienlijk lagere χ2 waarde dan het eerste model. De theoretische verstrooiing van het ensemble moet ook goed beschrijven de experimentele gegevens zoals beoordeeld door visuele inspectie van de overlay tussen de theoretische verstrooiing van het ensemble de SAXS gegevens en de waarde2 χ (Figuur 4, rechts pijpleiding). Men moet ook de χ2 waarden uit bos en EOM te bepalen welk model beste beschrijft de experimentele SAXS gegevens vergelijken.
      3. Handmatig controleren het conformeren van de Verkiezingswaarnemingsmissie in Pymol38 te bedekken de kristalstructuur met het conformeren gegenereerd door de Verkiezingswaarnemingsmissie (Figuur 4). Opmerking het totale aantal conformeren en de Fractie van de bezetting voor elke conformer dat aan de verstrooiing curve bijdraagt. Voor meer rigide moleculen, zoals Nsa1, moet het aantal conformeren klein (1-5) (Figuur 4, juiste pijpleiding)36.
      4. Re-run EOM meerdere malen om consistente resultaten.
        Opmerking: Voor de Nsa1 het aantal conformeren was meestal 3 tot en met 4 met χ2 waarden variërend van 0.1 tot 0.3.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Nsa1 was PCR versterkt van S. cerevisiae genomic DNA en subcloned in een vector met een N-terminal 6 x-Histidine affiniteit label, gevolgd door MBP en een TEV protease-site. Nsa1 werd omgevormd tot E. coli BL21(DE3) cellen en hoge opbrengst van eiwit expressie werden verkregen na inductie met IPTG en groei bij 25 ° C's nachts (figuur 1A). Nsa1 was affiniteit-gezuiverd op geïmmobiliseerdet kobalt affiniteit hars, gevolgd door MBP decolleté met TEV protease en uiteindelijk opgelost door grootte uitsluiting chromatografie (figuur 1B). Breuken uit grootte uitsluiting chromatografie met Nsa1 werden gebundeld, geconcentreerd tot 8 mg/mL en vervolgens gebruikt voor de kristallisatie proeven met een robot kristallisatie. Eerste sparse matrix crystal schermen leverde twee verschillende kristallen vormen van Nsa1, kubieke en orthorhombisch (figuur 2A).

Tijdens de optimalisatie van de kubieke en orthorhombisch kristallen, werd ontdekt dat de orthorhombisch kristallen ontstaan als gevolg van Proteolytische splitsing van Nsa1. Beperkte proteolyse en massaspectrometrie werden gebruikt voor het bepalen van de regio van Nsa1 die gevoelig voor proteolyse was, en werd naar voren gebracht dat Nsa1 gevoelig voor een gradiënt van de concentratie van het protease elastase (figuur 2B was). Latere massaspectrometrie analyse bevestigd dat deze aantasting van het gevolg is van verlies van de C-terminus van Nsa1. Een aantal C-terminal opschoningen van Nsa1 werden gegenereerd, schakel de Proteolytische gevoelige C-terminus (figuur 2C). De orthorhombisch kristallen kunnen worden herhaald met het Nsa1ΔC (residuen 1-434) afkappen, die uiteindelijk werd gebruikt voor triest structuurbepaling. De orthorhombisch kristallen kunnen ook worden herhaald door de behandeling van Nsa1FL met elastase gedurende 1 uur bij 4 ° C vóór het opzetten van kristallen schaaltjes.

De kubieke Nsa1 kristallen werden geoptimaliseerd door het gebruik van Nsa1FL door een combinatie van Natriumcitraat verlopen, in combinatie met microseeding (figuur 3A). Dit leverde grote, reproduceerbare kubieke kristallen, met een limiet van de diffractie van ongeveer 2,8 Å resolutie (Figuur 3 c, links). De orthorhombisch kristallen kunnen alleen worden geoptimaliseerd met behulp van de C-terminal truncatie varianten van Nsa1, door het variëren van de hellingen van de concentratie van PEG 1500 en PEG 400, gecombineerd met microseeding, die grote kristallen met een limiet van de diffractie van ongeveer 1,25 opgeleverd Å resolutie (Figuur 3A-C). Experimentele fasen van Nsa1 werden vastgesteld door SeMet-SAD van een SeMet-derivaat van Nsa1ΔC10.

Het N-terminaal zeven-blads β-propeller WD40 domein van Nsa1 werd goed opgelost in zowel de kubieke en orthorhombisch kristalstructuren, maar beide structuren ontbrak elektronen dichtheid voor de C-terminus van Nsa1. SAXS werd vervolgens gebruikt om te bepalen van de positie van het ontbrekende domein van het C-terminal van Nsa1 in oplossing. Na optimalisatie van monster concentratie voor gegevensverzameling, werd de gedeeltelijke atomaire structuur gebruikt uitvoeren van vastlichaam modellering en genereren een ab initio reconstructie van de ontbrekende onderdelen. Het model werd geëvalueerd in termen van de goedheid van de pasvorm voor de berekende verstrooiing bochten aan de experimentele gegevens (Figuur 4, centrum pijpleiding). Het domein van de WD40 van Nsa1 alleen is niet een goede pasvorm van de experimentele SAXS gegevens, zoals blijkt uit de discrepantie tussen de experimentele verstrooiing curve met de theoretische verstrooiing curve, die werd gegenereerd vanuit kristalstructuur VOB ID 5SUM (Figuur 4, linker pijpleiding). Naast vastlichaam modelleren, werd ensemble modelleren ook gedaan. Dit geproduceerd een ensemble van 3 tot en met 4 conformeren van Nsa1 en resulteerde in een lagere χ2 waarde (Figuur 4, juiste pijpleiding). De vermindering in model discrepantie (χ2) met behulp van ensemble modellering bleek de conformationele bemonstering van de staart van de Nsa1 C-terminal in oplossing.

Figure 1
Figuur 1. Meningsuiting en zuivering van Nsa1 met een 6 X-zijne-MBP fusion tag. (A) SDS-pagina-analyse van de eiwituitdrukking in BL21 (DE3) cellen bij 25 ° C's nachts en de eerste stap van de zuivering met behulp van kobalt affiniteit hars. (B) de vertegenwoordiger grootte uitsluiting chromatografische na TEV decollete. De breuken uit grootte uitsluiting chromatografie werden geanalyseerd door SDS-PAGE. De breuken uit piek 1 met Nsa1 werden verzameld en gebruikt voor structurele analyse. Klik hier voor een grotere versie van dit cijfer.

Figure 2
Figuur 2. De C-terminus van Nsa1 is gevoelig voor proteolyse. (A) eerste kristallisatie proeven van Nsa1 leverde twee verschillende kristallen vormen: kubieke en orthorhombisch. UV Microscoop werd gebruikt om te verifiëren dat de kristallen eiwitten bevatten. Vis: Zichtbaar licht, UV: UV microscopen. Schaal bar = 50 µm in elk venster. (B) proteolytic screening geanalyseerd door SDS-PAGE. Drie verdunningen (1:10, 1:100, 1:1000) voor elk aandeel protease (0.1, 0.01, 0,001 mg/mL) werden gecombineerd met aliquots van eiwit (1 mg/mL) worden vertoond. Protease resistente domeinen werden geanalyseerd de door SDS-pagina en massaspectrometrie na een incubatieperiode van 37 ° C gedurende 60 minuten Nsa1-FL: vers gezuiverd eiwit, Nsa1Δ: gezuiverd eiwit 3 weken waarna een aangetaste vorm van het eiwit werd waargenomen bij 4 ° C bewaard. (C) schematische diagram van de Nsa1 full-length (bovenste) en het C-terminal afkappen bouwen (lager). Klik hier voor een grotere versie van dit cijfer.

Figure 3
Figuur 3. Nsa1 kristallisatie optimalisatie. (A) een uitgangsmateriaal was bereid uit eerste kleine kristallen en gebruikt voor het maken van een verdunningsreeks (1 x ~ 1/104x) (microseeding). Door het mengen van 1 µL van eiwit met 1 µL van de verdunde uitgangsmateriaal, groeide de grotere enkele kristallen binnen een week. (B) precipitant verloop van de concentratie voor de optimalisering van de orthorhombisch kristal. (C) geoptimaliseerd kubieke en orthorhombisch kristallen gebruikt voor gegevensverzameling. Groene cirkels geven de typische gebied van de kristallen schaaltjes die opgeleverd gegevensverzameling kwaliteit kristallen. Klik hier voor een grotere versie van dit cijfer.

Figure 4
Figuur 4. Schematische voorstelling van Nsa1 SAXS analyse. Overzicht van de pijpleiding gebruikt SAXS gegevens verwerken en genereren van modellen met bos (midden) en EOM (rechts). De linker pijpleiding toont de discrepantie tussen de experimentele verstrooiing curve (rode cirkels, eiwitconcentratie: 6 mg/mL) met de theoretische verstrooiing curve (blauwe lijn), die werd gegenereerd vanuit de kristalstructuur VOB-ID 5SUM. De modellen werden beoordeeld door vergelijking van de experimentele SAXS verstrooiing curve (rode cirkels, eiwitconcentratie: 6 mg/mL) met de verstrooiing curve afgeleid van het bos model van Nsa1 (zwarte lijn) of het conformeren van de Verkiezingswaarnemingsmissie van Nsa1 (zwarte lijn). In elk model, wordt het domein WD40 weergegeven in cartoon gekleurde in het groen (VOB-ID 5SUM), de flexibele C-terminus in bollen rood gekleurde voor bos en groen, magenta, cyaan en geel voor de afzonderlijke Verkiezingswaarnemingsmissie conformeren wordt weergegeven. De Fractie van elk conformer afgeleid van EOM heet naast het model. Klik hier voor een grotere versie van dit cijfer.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Met behulp van dit protocol, werd recombinante Nsa1 van S. cerevisiae gegenereerd voor structurele studies door middel van röntgendiffractie zowel SAXS. Nsa1 was goed opgevoede in oplossing en gekristalliseerd in meerdere kristal vormen. Tijdens de optimalisatie van deze kristallen, werd ontdekt dat de C-terminus van Nsa1 gevoelig voor aantasting van het protease was. De hoge resolutie, orthorhombisch kristal vorm kan alleen worden gedupliceerd met C-terminal truncatie varianten van Nsa1, waarschijnlijk omdat de flexibele C-terminus van Nsa1 kristal verpakking voorkomen. De structuur van Nsa1 werd opgelost door middel van röntgendiffractie naar hoge resolutie, maar de C-terminus niet gebouwd zou kunnen worden in beide kristal vorm omdat het niet was besteld. Kristallografie is de première techniek voor het bepalen van de atomaire resolutie structuren van macromoleculen rond de grootte van de Nsa1, maar net als bij elke methode, kristallografie enkele beperkingen heeft. Een van de belangrijkste beperkingen van de kristallografie is het onvermogen om op te lossen ongeordende regio's van eiwitten40,41.

De C-terminus van Nsa1 is belangrijk voor goede nucleolar localisatie van het eiwit, onderstrepen de noodzaak te bestuderen van de structuur-10. De C-terminus van Nsa1, werd opgelost door SAXS, een aanvullende structurele biologie techniek om Röntgendiffractie. SAXS gegevens werd opgenomen voor full-length Nsa1 over een reeks van concentratie. Uit deze serie van de concentratie, werd de optimale concentratie voor Nsa1 SAXS gegevens verzamelen en verwerken vastgesteld. SAXS gegevens werden opgenomen voor Nsa1 in 6, 4.5 en 3,0 mg/mL. De Guinier regio, de P(r) functie en het moleculair gewicht waren over de concentratie serie vastbesloten om ervoor te zorgen dat de steekproef was goed gedragen en niet geaggregeerde onder de experimentele omstandigheden getest. Als u wilt reconstrueren de full-length structuur van Nsa1, was de theoretische verstrooiing amplitude bepaald op basis van de gedeeltelijke kristalstructuur en vervolgens ab initio methoden werden gebruikt om het model van de flexibele C-terminus. Uit deze hybride aanpak, werd vastgesteld dat de flexibele C-terminus van Nsa1 naar buiten zich van het bestelde WD40 domein uitstrekt.

Vooruitgang bij de verwerking van de hulpmiddelen heeft de populariteit van SAXS voor macromoleculaire structurele studies gedreven. SAXS meet de X-ray scattering patroon van willekeurig georiënteerde eiwit in oplossing met lage resolutie structurele informatie, met inbegrip van de moleculaire massa en vorm te verstrekken. Bijgevolg heeft SAXS ontpopt als een hulpmiddel van de bevestiging van het krachtige orthogonale structuur voor kristallografie. Dit is grotendeels te wijten aan de ontwikkeling van computationele methoden voor de berekening van de theoretische verstrooiing van atomaire structuren en vergelijkt deze met experimentele SAXS gegevens37. Met behulp van deze aanpak, de conformationele staat quaternaire structuur en hogere-orde vergadering waargenomen in een kristalrooster kan worden vergeleken met de structurele kenmerken van de deeltjes in oplossing. Bovendien, ongeordende loops en termini ontbreekt in hoge resolutie structuren bepaald door middel van röntgendiffractie kunnen worden gemodelleerd met behulp van oplossingsgegevens verstrooiing. Deze hybride structurele aanpak de kristalstructuur gebruikt als een bouwsteen voor SAXS geleide modellering van ontbrekende residuen en heeft bewezen effectief te zijn in kaart brengen van de C-terminus van Nsa110, evenals andere macromoleculen zoals het influenza-A-virus M1 matrix eiwitten42en dode-box RNA chaperones43. Geavanceerde SAXS gebaseerde modeling software kan ook pakken meer complexe systemen, zoals intrinsiek ongeordende eiwitten, door toewijzing van het conformationele landschap van deze systemen met behulp van een reeks van conformeren die samen aan de algehele verstrooiing bijdragen potentieel van de deeltjes in oplossing16,39. Genomen samen, recente vooruitgang in hulpmiddelen voor SAXS gegevens verzamelen en verwerken draagt bij aan het succes van hybride structurele biologie benaderingen voor het aanpakken van uitdagende biologische systemen.

De combinatie van verstrooiing van de oplossing met hoge resolutie structuren is klaar om het beantwoorden van belangrijke vragen over de flexibiliteit en de dynamiek van macromoleculen44. Veel eiwitten, zoals Nsa1, hebben dynamische regio's die belangrijk voor de biologische functie zijn. In dit manuscript een sjabloon-protocol is bedoeld die de combinatie van SAXS met hoge resolutie structuurbepaling gegevens door middel van röntgendiffractie. Naast röntgendiffractie SAXS kan ook worden gebruikt om het compliment van andere technieken van de structurele biologie met inbegrip van NMR, elektron paramagnetisch resonantie (EPR) en fluorescentie resonantie energie transfer (FRET), verder benadrukken het belang van SAXS Als een aanvullende structurele biologie techniek45,46,47.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgments

Diffractie gegevens werden verzameld in Zuidoost-regionale samenwerking toegang Team (SER-kat) 22-ID en 22-BM straallijnen op de geavanceerde Photon bron (JBS), Argonne National Laboratory. De SAXS gegevens verzameld over de SIBILLEN beamline op het voorschot licht bron (ALS), Lawrence Berkeley National Laboratory. We bedank het personeel op de SIBILLEN beamline voor hun medewerking aan externe gegevens verzamelen en verwerken. Wij zijn dankbaar aan de National Institute of Environmental Health Sciences (NIEHS) massaspectrometrie onderzoeks- en steungroep voor hulp het eiwit domeingrenzen bepalen. Dit werk werd ondersteund door het Amerikaanse nationale Instituut van gezondheid intramurale Research Program; Amerikaanse National Institute of Environmental Health Sciences (NIEHS) (ZIA ES103247 naar R. E. S.) en de Canadese instituten van gezondheidsonderzoek (CIHR, 146626 tot M.C.P). Gebruik van de APS werd ondersteund door de ons Department of Energy, Office of Science, Office of Basic Energy Sciences onder Contract nr. W-31-109-Eng-38. Gebruik van de geavanceerde licht bron (ALS) werd gesteund door de directeur, Office of Science, Office van energie basiswetenschappen, van het US Department of Energy onder Contract nr. DE-AC02-05CH11231. Extra ondersteuning voor de SIBILLEN SAXS beamline afkomstig is van de National Institute of Health project MINOS (R01GM105404) en een High-End Instrumentation Grant S10OD018483. Wij zouden ook graag Andrea Moon en Dr. Sara Andres bedanken voor hun kritische lezing van dit manuscript.

Materials

Name Company Catalog Number Comments
Molecular Cloning of Nsa1
pMBP2 parallel vector Sheffield et al, Protein Expression and Purification 15, 34-39 (1999) We used a modified version of pMBP2 which included an N-terminal His-tag (pHMBP)
S. cerevisiae genomic DNA ATCC 204508D-5
Primers for cloning Nsa1
SC_Nsa1_FLFw IDT CGC CAA AGG CCT
ATGAGGTTACTAGTCAGCTGTGT
GGATAG
SC_Nsa1_FLRv IDT AATGCAGCGGCCGCTCAAATTTT
GCTTTTCTTACTGGCTTTAGAAGC
AGC
SC_Nsa1_DeltaCFw IDT GGGCGCCATGGGATCCATGAGG
TTACTAGTCAGCTGTGTGG
SC_Nsa1_DeltaCRv IDT GATTCGAAAGCGGCCGCTTAAAC
CTTCCTTTTTTGCTTCCC
Recombinant Protein Production and Purification of Nsa1
Escherichia coli BL21 (DE3) Star Cells Invitrogen C601003
pMBP- NSA1 and various truncations Lo et al., 2017
Selenomethionine Molecular Dimensions MD12-503B
IPTG, Dioxane-Free Promega V3953
EDTA Free Protease Inhibitor Cocktail Sigma-Aldrich 4693159001
Sodium Chloride Caledon Laboratory Chemicals 7560-1-80
Magnesium Chloride hexahydrate Sigma-Aldrich M2670
Tris Buffer, 1 M pH7.5 KD Medical RGF-3340
Glycerol Invitrogen 15514-029
beta-mercaptoethanol Sigma M6250
1M Imidazole, pH 8.0 Teknova I6980-06
Talon Affinity Resin Clonetech 635503
Amicon Ultra 15 mL Centrifugal Filter (MWCO 10K) Millipore UFC901024
HiLoad 16/600 Superdex 200 Prep Grade Gel Filtration Column GE-Healthcare 28989335
TEV Protease Prepared by NIEHS Protein Expression Core Expression plasmid provided by NCI (Tropea et al. Methods Mol Biology, 2009)
4-15% Mini-PROTEAN TGX Precast Protein Gels BioRad 456-8056
Crystallization, Proteolytic Screening
Crystal Screen Hampton Research HR2-110
Crystal Screen 2 Hampton Research HR2-112
Salt Rx Hampton Research HR2-136
Index Screen Hampton Research HR2-144
PEG/Ion Screen Hampton Research HR2-139
JCSG+ Molecular Dimensions MD1-37
Wizard Precipitant Synergy Molecular Dimensions MD15-PS-T
Swissci 96-well 3-drop UVP sitting drop plates TTP Labtech 4150-05823
3inch Wide Crystal Clear Sealing Tape Hampton Research HR4-506
Proti-Ace Kit Hampton Research HR2-429
PEG 1500 Molecular Dimensions MD2-100-6
PEG 400 Molecular Dimensions MD2-100-3
HEPES/sodium hydroxide pH 7.5 Molecular Dimensions MD2-011-
Sodium Citrate tribasic Molecular Dimensions MD2-100-127
22 mm x 0.22 mm Siliconized Coverslides Hampton Research HR3-231
24 Well Plates with sealant (VDX Plate with Sealant) Hampton Research HR3-172
18 mM Mounted Nylon Loops (0.05 mm to 0.5 mM) Hampton Research HR4-945, HR4-947, HR4-970, HR4-971
Seed Bead Kit Hampton Research HR2-320
Magnetic Crystal Caps Hampton Research HR4-779
Magnetic Cryo Wand Hampton Research HR4-729
Cryogenic Foam Dewar Hampton Research HR4-673
Crystal Puck System MiTeGen M-CP-111-021
Full Skirt 96 well Clear Plate VWR 10011-228
AxyMat Sealing Mat VWR 10011-130
Equipment
UVEX-m JAN Scientific, Inc.
Nanodrop Lite Spectrophotometer Thermo-Fisher
Mosquito Robot TTP Labtech
Software/Websites
HKL2000 Otwinoski and Minor, 1997
Phenix Adams et al., 2010
Coot Emsley et al., 2010
ATSAS Petoukhov et al., 2012 https://www.embl-hamburg.de/biosaxs/atsas-online/
Scatter Rambo and Tainer, 2013
Pymol The PyMOL Molecular Graphics System, Version 1.8 Schrödinger, LLC.
BUNCH Petoukhov and Svergun, 2005
CRYSOL Svergun et al, 1995
PRIMUS Konarev et al, 2003
EOM Tria et al, 2015

DOWNLOAD MATERIALS LIST

References

  1. Thomson, E., Ferreira-Cerca, S., Hurt, E. Eukaryotic ribosome biogenesis at a glance. J Cell Sci. 126, (Pt 21), 4815-4821 (2013).
  2. Woolford, J. L. Jr, Baserga, S. J. Ribosome biogenesis in the yeast Saccharomyces cerevisiae. Genetics. 195, (3), 643-681 (2013).
  3. Kressler, D., Hurt, E., Bassler, J. A Puzzle of Life: Crafting Ribosomal Subunits. Trends Biochem Sci. (2017).
  4. Tomecki, R., Sikorski, P. J., Zakrzewska-Placzek, M. Comparison of preribosomal RNA processing pathways in yeast, plant and human cells - focus on coordinated action of endo- and exoribonucleases. FEBS Lett. (2017).
  5. Kressler, D., Hurt, E., Bassler, J. Driving ribosome assembly. Biochim Biophys Acta. 1803, (6), 673-683 (2010).
  6. Kressler, D., Roser, D., Pertschy, B., Hurt, E. The AAA ATPase Rix7 powers progression of ribosome biogenesis by stripping Nsa1 from pre-60S particles. J Cell Biol. 181, (6), 935-944 (2008).
  7. Hiraishi, N., Ishida, Y., Nagahama, M. AAA-ATPase NVL2 acts on MTR4-exosome complex to dissociate the nucleolar protein WDR74. Biochem Biophy Res Co. 467, (3), 534-540 (2015).
  8. Maserati, M., et al. Wdr74 is required for blastocyst formation in the mouse. PLoS One. 6, (7), e22516 (2011).
  9. Weinhold, N., Jacobsen, A., Schultz, N., Sander, C., Lee, W. Genome-wide analysis of noncoding regulatory mutations in cancer. Nat Genet. 46, (11), 1160-1165 (2014).
  10. Lo, Y. H., Romes, E. M., Pillon, M. C., Sobhany, M., Stanley, R. E. Structural Analysis Reveals Features of Ribosome Assembly Factor Nsa1/WDR74 Important for Localization and Interaction with Rix7/NVL2. Structure. 25, (5), 762-772 (2017).
  11. Lander, G. C., Saibil, H. R., Nogales, E. Go hybrid: EM, crystallography, and beyond. Curr Opin Struc Biol. 22, (5), 627-635 (2012).
  12. Putnam, C. D., Hammel, M., Hura, G. L., Tainer, J. A. X-ray solution scattering (SAXS) combined with crystallography and computation: defining accurate macromolecular structures, conformations and assemblies in solution. Q Rev Biophys. 40, (3), 191-285 (2007).
  13. Jaskolski, M., Dauter, Z., Wlodawer, A. A brief history of macromolecular crystallography, illustrated by a family tree and its Nobel fruits. FEBS J. 281, (18), 3985-4009 (2014).
  14. Zheng, H., et al. X-ray crystallography over the past decade for novel drug discovery - where are we heading next? Expert Opin Drug Dis. 10, (9), 975-989 (2015).
  15. Kikhney, A. G., Svergun, D. I. A practical guide to small angle X-ray scattering (SAXS) of flexible and intrinsically disordered proteins. FEBS Lett. 589, (19 Pt A), 2570-2577 (2015).
  16. Bernado, P., Mylonas, E., Petoukhov, M. V., Blackledge, M., Svergun, D. I. Structural characterization of flexible proteins using small-angle X-ray scattering. J Am Chem Soc. 129, (17), 5656-5664 (2007).
  17. Sheffield, P., Garrard, S., Derewenda, Z. Overcoming expression and purification problems of RhoGDI using a family of "parallel" expression vectors. Protein Expres Purif. 15, (1), 34-39 (1999).
  18. Doublie, S. Preparation of selenomethionyl proteins for phase determination. Methods Enzymol. 276, 523-530 (1997).
  19. Tropea, J. E., Cherry, S., Waugh, D. S. Expression and purification of soluble His(6)-tagged TEV protease. Methods Mol Biol. 498, 297-307 (2009).
  20. Wlodawer, A., Minor, W., Dauter, Z., Jaskolski, M. Protein crystallography for aspiring crystallographers or how to avoid pitfalls and traps in macromolecular structure determination. FEBS J. 280, (22), 5705-5736 (2013).
  21. Otwinowski, Z., Minor, W. Processing of X-ray diffraction data collected in oscillation mode. Macromolecular Crystallography, Pt A. 276, 307-326 (1997).
  22. Adams, P. D., et al. PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta Crystallogr D. 66, (Pt 2), 213-221 (2010).
  23. Winn, M. D., et al. Overview of the CCP4 suite and current developments. Acta Crystallogr D. 67, (Pt 4), 235-242 (2011).
  24. Terwilliger, T. C., et al. Decision-making in structure solution using Bayesian estimates of map quality: the PHENIX AutoSol wizard. Acta Crystallographica Section D. 65, 582-601 (2009).
  25. Emsley, P., Lohkamp, B., Scott, W. G., Cowtan, K. Features and development of Coot. Acta Crystallogr D. 66, (Pt 4), 486-501 (2010).
  26. Afonine, P. V., et al. Towards automated crystallographic structure refinement with phenix.refine. Acta Crystallogr D. 68, (Pt 4), 352-367 (2012).
  27. McCoy, A. J. Solving structures of protein complexes by molecular replacement with Phaser. Acta Crystallogr D. 63, (Pt 1), 32-41 (2007).
  28. McCoy, A. J., et al. Phaser crystallographic software. J Appl Crystallogr. 40, (Pt 4), 658-674 (2007).
  29. Dyer, K. N., et al. High-throughput SAXS for the characterization of biomolecules in solution: a practical approach. Methods Mol Biol. 1091, 245-258 (2014).
  30. Forster, S., Apostol, L., Bras, W. Scatter: software for the analysis of nano- and mesoscale small-angle scattering. J Appl Crystallogr. 43, 639-646 (2010).
  31. Petoukhov, M. V., et al. New developments in the ATSAS program package for small-angle scattering data analysis. J Appl Crystallogr. 45, 342-350 (2012).
  32. Konarev, P. V., Volkov, V. V., Sokolova, A. V., Koch, M. H. J., Svergun, D. I. PRIMUS: a Windows PC-based system for small-angle scattering data analysis. J Appl Crystallogr. 36, 1277-1282 (2003).
  33. Svergun, D. I. Determination of the Regularization Parameter in Indirect-Transform Methods Using Perceptual Criteria. J Appl Crystallogr. 25, 495-503 (1992).
  34. Rambo, R. P., Tainer, J. A. Accurate assessment of mass, models and resolution by small-angle scattering. Nature. 496, (7446), 477-481 (2013).
  35. Petoukhov, M. V., Svergun, D. I. Global rigid body modeling of macromolecular complexes against small-angle scattering data. Biophys J. 89, (2), 1237-1250 (2005).
  36. Tria, G., Mertens, H. D., Kachala, M., Svergun, D. I. Advanced ensemble modelling of flexible macromolecules using X-ray solution scattering. IUCrJ. 2, (Pt 2), 207-217 (2015).
  37. Svergun, D., Barberato, C., Koch, M. H. J. CRYSOL - A program to evaluate x-ray solution scattering of biological macromolecules from atomic coordinates. J Appl Crystallogr. 28, 768-773 (1995).
  38. Schrödinger, LLC. The PyMOL Molecular Graphics System Version 1.8. Available from: https://pymol.org (2015).
  39. Pelikan, M., Hura, G. L., Hammel, M. Structure and flexibility within proteins as identified through small angle X-ray scattering. Gen Physiol Biophys. 28, (2), 174-189 (2009).
  40. Deller, M. C., Kong, L., Rupp, B. Protein stability: a crystallographer's perspective. Acta Crystallogr F. 72, (Pt 2), 72-95 (2016).
  41. Hinsen, K. Structural flexibility in proteins: impact of the crystal environment. Bioinformatics. 24, (4), 521-528 (2008).
  42. Shtykova, E. V., et al. Structural analysis of influenza A virus matrix protein M1 and its self-assemblies at low pH. PLoS One. 8, (12), e82431 (2013).
  43. Mallam, A. L., et al. Solution structures of DEAD-box RNA chaperones reveal conformational changes and nucleic acid tethering by a basic tail. Proc Natl Acad Sci U S A. 108, (30), 12254-12259 (2011).
  44. Papaleo, E., et al. The Role of Protein Loops and Linkers in Conformational Dynamics and Allostery. Chem Rev. 116, (11), 6391-6423 (2016).
  45. Rozycki, B., Boura, E. Large, dynamic, multi-protein complexes: a challenge for structural biology. J Phys Condens Matter. 26, (46), 463103 (2014).
  46. Schlundt, A., Tants, J. N., Sattler, M. Integrated structural biology to unravel molecular mechanisms of protein-RNA recognition. Methods. 118, 119-136 (2017).
  47. Thompson, M. K., Ehlinger, A. C., Chazin, W. J. Analysis of Functional Dynamics of Modular Multidomain Proteins by SAXS and NMR. Methods Enzymol. 592, 49-76 (2017).
Het combineren van röntgendiffractie met kleine hoek X-Ray Scattering model ongestructureerde regio's van de Nsa1 van <em>S. Cerevisiae</em>
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Lo, Y. H., Pillon, M. C., Stanley, R. E. Combining X-Ray Crystallography with Small Angle X-Ray Scattering to Model Unstructured Regions of Nsa1 from S. Cerevisiae. J. Vis. Exp. (131), e56953, doi:10.3791/56953 (2018).More

Lo, Y. H., Pillon, M. C., Stanley, R. E. Combining X-Ray Crystallography with Small Angle X-Ray Scattering to Model Unstructured Regions of Nsa1 from S. Cerevisiae. J. Vis. Exp. (131), e56953, doi:10.3791/56953 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter