A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

A Facile Protocol to Generate Site-Specifically Acetylated Proteins in Escherichia Coli

6.7K views

DOI:

10.3791/57061

December 9th, 2017

In This Article

Summary

Genetic code expansion serves as a powerful tool to study a wide range of biological processes, including protein acetylation. Here we demonstrate a facile protocol to exploit this technique for generating homogeneously acetylated proteins at specific sites in Escherichia coli cells.

Abstract

Post-translational modifications that occur at specific positions of proteins have been shown to play important roles in a variety of cellular processes. Among them, reversible lysine acetylation is one of the most widely distributed in all domains of life. Although numerous mass spectrometry-based acetylome studies have been performed, further characterization of these putative acetylation targets has been limited. One possible reason is that it is difficult to generate purely acetylated proteins at desired positions by most classic biochemical approaches. To overcome this challenge, the genetic code expansion technique has been applied to use the pair of an engineered pyrrolysyl-tRNA synthetase variant, and its cognate tRNA from Methanosarcinaceae species, to direct the cotranslational incorporation of acetyllysine at the specific site in the protein of interest. After first application in the study of histone acetylation, this approach has facilitated acetylation studies on a variety of proteins. In this work, we demonstrated a facile protocol to produce site-specifically acetylated proteins by using the model bacterium Escherichia coli as the host. Malate dehydrogenase was used as a demonstration example in this work.

Introduction

Post-translational modifications (PTMs) of proteins occur after the translation process, and arise from covalent addition of functional groups to amino acid residues, playing important roles in almost all the biological processes, including gene transcription, stress response, cellular differentiation, and metabolism1,2,3. To date, about 400 distinctive PTMs have been identified4. The intricacy of the genome and the proteome is amplified to a great extent by protein PTMs, as they regulate protein activity and localization, and affect the interaction with other molecules such as proteins, nucleic acids, lipids, and cofactors5.

Protein acetylation has been at the forefront of PTMs studies in the last two decades6,7,8,9,10,11,12. Lysine acetylation was first discovered in histones more than 50 years ago13,14, has been well scrutinized, and is known to exist in more than 80 transcription factors, regulators, and various proteins15,16,17. Studies on protein acetylation have not only provided us with a deeper understanding of its regulatory mechanisms, but also guided treatments for a number of diseases caused by dysfunctional acetylation18,19,20,21,22,23. It was believed that lysine acetylation only happens in eukaryotes, but recent studies have shown that protein acetylation also plays key roles in bacterial physiology, including chemotaxis, acid resistance, activation, and stabilization of pathogenicity islands and other virulence related proteins24,25,26,27,28,29.

A commonly used method to biochemically characterize lysine acetylation is using site-directed mutagenesis. Glutamine is used as a mimic of acetyllysine because of its similar size and polarity. Arginine is utilized as a non-acetylated lysine mimic, since it preserves its positive charge under physiological conditions but cannot be acetylated. However, both mimics are not real isosteres and do not always yield the expected results30. The most rigorous approach is to generate homogeneously acetylated proteins at specific lysine residues, which is difficult or impossible for most classical methods due to the low stoichiometry of lysine acetylation in nature7,11. This challenge has been unraveled by the genetic code expansion strategy, which employs an engineered pyrrolysyl-tRNA synthetase variant from Methanosarcinaceae species to charge tRNAPyl with acetyllysine, utilizes the host translational machinery to suppress the UAG stop codon in the mRNA, and directs the incorporation of acetyllysine in the designed position of the target protein31. Recently, we have optimized this system with an improved EF-Tu-binding tRNA32 and an upgraded acetyllysyl-tRNA synthetase33. Furthermore, we have applied this enhanced incorporation system in acetylation studies of malate dehydrogenase34 and tyrosyl-tRNA synthetase35. Herein, we demonstrate the protocol for generating purely acetylated proteins from the molecular cloning to biochemical identification by using malate dehydrogenase (MDH), which we have extensively studied as a demonstrative example.

Access restricted. Please log in or start a trial to view this content.

Protocol

1. Site-Directed Mutagenesis of the Target Gene

Note: MDH is expressed under T7 promoter in the pCDF-1 vector with the CloDF13 origin and a copy number of 20 to 4034.

  1. Introduce the amber stop codon at the position 140 in the gene by primers (forward primer: GGTGTTTATGACTAGAACAAACTGTTCGGCG and reverse primer: GGCTTTTTTCAGCACTTCAGCAGCAATTGC), following the instruction of the site-directed mutagenesis kit.
  2. Amplify the template plasmid containing the gene of wild-type malate dehydratase, and insert the stop codon mutation by the polymerase chain reaction (PCR) reaction. In the reaction mixture, include 12.5 µL of 2X DNA polymerase enzyme mix, 1.25 µL of 10 µM Forward primer, 1.25 µL of 10 µM Reverse primer, 1 µL of template DNA (20 ng/µL) (pCDF-1 plasmid containing the gene of wild-type MDH), and 9 µL of nuclease-free water.
    1. Use PCR reaction parameters as follows: Initial denaturation at 98 °C for 30 s; 25 cycles of 10 s at 98 °C, 30 s at 55 °C, and 3 min at 72 °C; final extension at 72 °C for 3 min. After PCR, add the amplified material directly to the Kinase-Ligase-DpnI enzyme mix from the kit for 1 h at room temperature for circularization and template removal.
      Note: The reaction mixture contains 1 µL of PCR product, 5 µL of 2X Reaction Buffer, 1 µL of 10X Kinase-Ligase-DpnI enzyme mix, and 3 µL of nuclease-free water.
  3. Add 5 µL of the reaction mix to the tube of 25 µL thawed competent E. coli DH5α cells from the kit. Carefully flick the tube to mix, and place the mixture on ice for 30 min. Heat shock the mixture at 42 °C for 30 s, and place on ice for additional 5 min.
    1. Pipette 600 µL of room temperature Super Optimal broth with Catabolite repression (SOC) media from the kit into the mixture, incubate at 37 °C for 60 min with shaking at 250 rpm, spread 100 µL onto a lysogeny broth (LB) agar plate with the corresponding antibiotic, and incubate overnight at 37 °C with shaking at 250 rpm.
  4. Pick 4-6 single colonies into 6 mL fresh LB media with the corresponding antibiotic, and incubate at 37 °C overnight with shaking at 250 rpm. Extract plasmids from each overnight culture by the plasmid purification kit, following the manufacturer's manual, then send plasmids for DNA sequencing according to the protocol of the service provider to confirm the stop codon mutation at correct positions.
  5. Store the strain with the correct sequence at -80 °C by mixing 1 mL overnight culture and 300 µL 100% DMSO.

2. Expression of the Acetylated Protein

  1. Insert the genes of optimized acetyllysyl-tRNA synthetase33 and optimized tRNAPyl 32 into the pTech plasmid. Place the tRNA synthetase gene under the constitutive lpp promoter. Place the tRNA gene under the constitutive proK promoter34.
    1. Co-transform the expression vector34 containing the mutated TAG-containing gene of malate dehydrogenase, and the plasmid harboring the optimized acetyllysine incorporation system, into 25 µL thawed competent E. coli BL21(DE3) cells by heat shock at 42 °C for 10 s, and place on ice for additional 5 min.
    2. Pipette 600 µL of room temperature SOC media into the mixture, incubate at 37 °C for 60 min with shaking at 275 rpm, spread 100 µL onto a plate with 100 µg/mL streptomycin and 50 µg/mL chloramphenicol, and incubate overnight at 37 °C with shaking at 275 rpm.
  2. Pick up a single colony from the plate, and inoculate into 15 mL fresh LB media with 100 µg/mL streptomycin and 50 µg/mL chloramphenicol in a 50 mL tube overnight at 37 °C with shaking at the speed of 250 rpm. Transfer the 15 mL overnight culture to 300 mL fresh LB media with antibiotics in a 1 L flask, and incubate at 37 °C with shaking at 250 rpm.
  3. Dissolve acetyllysine with water to make 100 mM stock solution, store at 4 °C. Add 5 mM acetyllysine and 20 mM nicotinamide (inhibitor of deacetylases) to the growth media when absorbance reaches 0.5 at 600 nm.
    1. Grow cells for an additional 1 h at 37 °C, shaking at 250 rpm, then add 0.5 mM IPTG for protein expression, and grow cells at 25 °C overnight, with shaking at 180 rpm.
      NOTE: The expression conditions may need optimization for different proteins.
  4. Collect cells by centrifuging at 3,000 x g at 4 °C for 15 min, discard the supernatant, and wash cell pellets with the Phosphate-buffered saline (PBS) buffer (10 mM Na2HPO4, 1.8 mM KH2PO4, 137 mM NaCl, 2.7 mM KCl). Collect washed cells at 10,000 x g at 4 °C for 5 min, discard the supernatant, and store cell pellets at -80 °C.

3. Purification of the Acetylated Protein

  1. Thaw the frozen cell pellets on ice, and re-suspend with 15 mL of lysis buffer (50 mM tris(hydroxymethyl)aminomethane (Tris) pH 7.8, 300 mM NaCl, 20 mM imidazole, and 20 mM nicotinamide), 5 µL of β-mercaptoethanol and 1 µL Benzonase nuclease (250 units).
  2. Break cells by 40 kHz sonication at 70% power output with 10 cycles of 10 s short bursts, followed by intervals of 30 s for cooling to form crude extract. Centrifuge crude extract at 20,000 x g for 25 min at 4 °C. Filter the supernatant with the 0.45 µm membrane filter, and load into a column containing 1 mL of nickel-nitrilotriacetic acid (Ni-NTA) resin equilibrated with 20 mL of water and 20 mL of lysis buffer.
    NOTE: Cells could also be broken by mild detergents, if sonication is not available.
  3. Wash the column with 20 mL of wash buffer (50 mM Tris pH 7.8, 300 mM NaCl, 50 mM imidazole, and 20 mM nicotinamide), and then elute with 2 mL of elution buffer (50 mM Tris pH 7.8, 300 mM NaCl, 150 mM imidazole, and 20 mM nicotinamide).
  4. Desalt the elution fraction with desalting buffer (25 mM Tris pH 7.8 and 10 mM NaCl) by the PD-10 column, following the manufacturer's manual. Measure the concentration of the eluted protein by following the instruction of the Bradford protein assay reagent. The desalted protein is ready for further experiments.
    NOTE: Make 50% glycerol stock of the protein, and keep in -80 °C for storage.

4. Biochemical Characterization of the Acetylated Protein

  1. SDS-PAGE and mass spectrometry analyses.
    1. Denature proteins with the sodium dodecyl sulfate (SDS) sample buffer (5 µL protein sample with 2 µL 4X SDS sample buffer) in a 2 mL tube at 105 °C for 5 min, centrifuge the mixture at 2000 x g for 10 s, load onto the 4-20% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) gel, and run at 200 V for 30 min.
    2. Wash the gel with distilled water and shake gently for 5 min, repeating the process 3 times. Discard the water, and stain the gel with Coomassie blue stain for 1 h with gentle shaking. De-stain the gel with distilled water, shake gently for 30 min, and repeat this de-stain 3 times.
    3. Cut the band at 33 kDa on the Coomassie blue-stained SDS-PAGE gel, and send it to mass spectrometry facilities or companies to confirm the acetyllysine was incorporated at the designed position.
      NOTE: The protocol of mass spectrometry analysis followed the previous experiment34.
  2. Western Blotting
    1. Run the SDS-PAGE gel with the same protocol in step 4.1. After the gel run, soak the gel with the transfer buffer (25 mM Tris, 192 mM glycine, pH 8.3, and 20% methanol) for 15 min.
    2. Activate a 0.2 µm, 7 cm x 8.5 cm polyvinylidene difluoride (PVDF) membrane with methanol for 1 min, and rinse with transfer buffer before preparing the transfer sandwich.
      NOTE: Methanol is hazardous in case of skin contact, eye contact, ingestion, or inhalation. Severe over-exposure can result in death.
    3. Make the transfer sandwich from cathode to anode (sponge, filter paper, SDS-PAGE gel, PVDF membrane, filter paper, and sponge). Put the stack in the transfer tank, run at constant current of 350 mA for 45 min.
      NOTE: Transfer time may need optimization.
    4. Wash the PVDF membrane with 25 mL Tris-buffered saline, 0.1% Tween 20 (TBST) (137 mM NaCl, 20 mM Tris, 0.1% Tween-20, pH 7.6) buffer for 5 min with gentle shaking. Block the membrane with 5% Bovine serum albumin (BSA) in the TBST buffer for 1 h at room temperature.
    5. Incubate the membrane with HRP-conjugated acetyllysine-antibody with a final concentration of 1 µg/mL diluted with 5% BSA in TBST at 4 °C overnight with gentle shaking.
      NOTE: For faster results, this step could be performed in room temperature for 1 h. The dilution of antibody may need optimization.
    6. Wash the membrane with 20 mL TBST buffer for 5 min with gentle shaking, repeating the step 4 times. Apply the chemiluminescence substrate to the membrane by following the manufacturer's instructions. Capture the signal with a charge-coupled device (CCD) camera-based imager.

Access restricted. Please log in or start a trial to view this content.

Results

The yield of acetylated MDH protein was 15 mg per 1 L culture, while that of wild-type MDH was 31 mg per 1 L culture. Purified proteins were analyzed by SDS-PAGE as shown in Figure 1. The wild-type MDH was used as a positive control34. The protein purified from cells harboring the acetyllysine (AcK) incorporation system and the mutant mdh gene, but without AcK in growth media, was used as a negative control. Lysine acetylation...

Access restricted. Please log in or start a trial to view this content.

Discussion

The genetic incorporation of noncanonical amino acids (ncAAs) is based on the suppression of an assigned codon, mostly the amber stop codon UAG36,37,38,39, by the ncAA-charged tRNA containing the corresponding anticodon. As is known, the UAG codon is recognized by the release factor-1 (RF1) in bacteria, and it can also be suppressed by near cognate tRNAs from hosts charged by canonical amino ac...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors have nothing to disclose.

Acknowledgements

This work was supported by the NIH (AI119813), the start-up from the University of Arkansas, and the award from Arkansas Biosciences Institute.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
Bradford protein assayBio-Rad5000006Protein concentration
4x Laemmli Sample BufferBio-Rad1610747SDS sample buffer
Coomassie G-250 StainBio-Rad1610786SDS-PAGE gel staining
4-20% SDS-PAGE ready gelBio-Rad4561093Protein determination
Ac-K-100 (HRP Conjugate)Cell Signaling6952Antibody
IPTGCHEM-IMPEX194Expression inducer
Nε-Acetyl-L-lysineCHEM-IMPEX5364Noncanonical amino acid
PD-10 desalting columnGE Healthcare17085101Desalting
Q5 Site-Directed Mutagenesis KitNEBE0554Introducing the stop codon
BL21 (DE3) cellsNEBC2527Expressing strain
QIAprep Spin Miniprep KitQIAGEN27106Extracting plasmids
Ni-NTA resinQIAGEN30210Affinity purification resin
nicotinamideSigma-AldrichN3376Deacetylase inhibitor
β-MercaptoethanolSigma-AldrichM6250Reducing agent
BugBuster Protein Extraction ReagentSigma-Aldrich70584Breaking cells
Benzonase nucleaseSigma-AldrichE1014DNase
ECL Western Blotting SubstrateThermoFisher32106Chemiluminescence
Premixed LB BrothVWR97064Cell growth medium
Bovine serum albuminVWR97061-416western blots blocking

References

  1. Krishna, R. G., Wold, F. Post-translational modification of proteins. Adv Enzymol Relat Areas Mol Biol. 67, 265-298 (1993).
  2. Lothrop, A. P., Torres, M. P., Fuchs, S. M. Deciphering post-translational modification codes. FEBS Lett. 587 (8), 1247-1257 (2013).
  3. Walsh, C. T. Posttranslational modification of proteins : expanding nature's inventory. , Roberts and Company Publishers. Englewood, Colorado. (2006).
  4. Khoury, G. A., Baliban, R. C., Floudas, C. A. Proteome-wide post-translational modification statistics: frequency analysis and curation of the swiss-prot database. Sci Rep. 1, (2011).
  5. Grotenbreg, G., Ploegh, H. Chemical biology: dressed-up proteins. Nature. 446 (7139), 993-995 (2007).
  6. Arif, M., Selvi, B. R., Kundu, T. K. Lysine acetylation: the tale of a modification from transcription regulation to metabolism. Chembiochem. 11 (11), 1501-1504 (2010).
  7. Cohen, T., Yao, T. P. AcK-knowledge reversible acetylation. Science's STKE : signal transduction knowledge environment. (245), pe42(2004).
  8. Drazic, A., Myklebust, L. M., Ree, R., Arnesen, T. The world of protein acetylation. Biochim Biophys Acta. 1864 (10), 1372-1401 (2016).
  9. Escalante-Semerena, J. C. Nε-acetylation control conserved in all three life domains. Microbe. 5, 340-344 (2010).
  10. Kouzarides, T. Acetylation: a regulatory modification to rival phosphorylation? The EMBO journal. 19 (6), 1176-1179 (2000).
  11. Soppa, J. Protein acetylation in archaea, bacteria, and eukaryotes. Archaea. , (2010).
  12. Verdin, E., Ott, M. 50 years of protein acetylation: from gene regulation to epigenetics, metabolism and beyond. Nat Rev Mol Cell Biol. 16 (4), 258-264 (2015).
  13. Allfrey, V. G., Faulkner, R., Mirsky, A. E. Acetylation and Methylation of Histones and Their Possible Role in the Regulation of Rna Synthesis. P Natl Acad Sci USA. 51, 786-794 (1964).
  14. Phillips, D. M. The presence of acetyl groups of histones. Biochem j. 87, 258-263 (1963).
  15. Sterner, D. E., Berger, S. L. Acetylation of histones and transcription-related factors. Microbiology and molecular biology reviews: MMBR. 64 (2), 435-459 (2000).
  16. Glozak, M. A., Sengupta, N., Zhang, X., Seto, E. Acetylation and deacetylation of non-histone proteins. Gene. 363, 15-23 (2005).
  17. Close, P., et al. The emerging role of lysine acetylation of non-nuclear proteins. Cell Mol Life Sci. 67 (8), 1255-1264 (2010).
  18. Iyer, A., Fairlie, D. P., Brown, L. Lysine acetylation in obesity, diabetes and metabolic disease. Immunol Cell Biol. 90 (1), 39-46 (2012).
  19. You, L., Nie, J., Sun, W. J., Zheng, Z. Q., Yang, X. J. Lysine acetylation: enzymes, bromodomains and links to different diseases. Essays Biochem. 52, 1-12 (2012).
  20. Bonnaud, E. M., Suberbielle, E., Malnou, C. E. Histone acetylation in neuronal (dys)function. Biomol Concepts. 7 (2), 103-116 (2016).
  21. Fukushima, A., Lopaschuk, G. D. Acetylation control of cardiac fatty acid beta-oxidation and energy metabolism in obesity, diabetes, and heart failure. Biochim Biophys Acta. 1862 (12), 2211-2220 (2016).
  22. Kaypee, S., et al. Aberrant lysine acetylation in tumorigenesis: Implications in the development of therapeutics. Pharmacol Ther. 162, 98-119 (2016).
  23. Tapias, A., Wang, Z. Q. Lysine Acetylation and Deacetylation in Brain Development and Neuropathies. Genomics Proteomics Bioinformatics. 15 (1), 19-36 (2017).
  24. Hu, L. I., Lima, B. P., Wolfe, A. J. Bacterial protein acetylation: the dawning of a new age. Molecular microbiology. 77 (1), 15-21 (2010).
  25. Jones, J. D., O'Connor, C. D. Protein acetylation in prokaryotes. Proteomics. 11 (15), 3012-3022 (2011).
  26. Bernal, V., et al. Regulation of bacterial physiology by lysine acetylation of proteins. New biotechnol. 31 (6), 586-595 (2014).
  27. Hentchel, K. L., Escalante-Semerena, J. C. Acylation of Biomolecules in Prokaryotes: a Widespread Strategy for the Control of Biological Function and Metabolic Stress. Microbiology and molecular biology reviews : MMBR. 79 (3), 321-346 (2015).
  28. Ouidir, T., Kentache, T., Hardouin, J. Protein lysine acetylation in bacteria: Current state of the art. Proteomics. 16 (2), 301-309 (2016).
  29. Wolfe, A. J. Bacterial protein acetylation: new discoveries unanswered questions. Curr Genet. 62 (2), 335-341 (2016).
  30. Albaugh, B. N., Arnold, K. M., Lee, S., Denu, J. M. Autoacetylation of the histone acetyltransferase Rtt109. J Biol Chem. 286 (28), 24694-24701 (2011).
  31. Neumann, H., Peak-Chew, S. Y., Chin, J. W. Genetically encoding Nε-acetyllysine in recombinant proteins. Nat chem biol. 4 (4), 232-234 (2008).
  32. Fan, C., Xiong, H., Reynolds, N. M., Soll, D. Rationally evolving tRNAPyl for efficient incorporation of noncanonical amino acids. Nucleic Acids Res. 43 (22), e156(2015).
  33. Bryson, D., et al. Continuous directed evolution of aminoacyl-tRNA synthetases to alter amino acid specificity and enhance activity. Nat Chem Biol. , (2017).
  34. Venkat, S., Gregory, C., Sturges, J., Gan, Q., Fan, C. Studying the Lysine Acetylation of Malate Dehydrogenase. J Mol Biol. 429 (9), 1396-1405 (2017).
  35. Venkat, S., Gregory, C., Gan, Q., Fan, C. Biochemical characterization of the lysine acetylation of tyrosyl-tRNA synthetase in Escherichia coli. Chembiochem. 18 (19), 1928-1934 (2017).
  36. Liu, C. C., Schultz, P. G. Adding new chemistries to the genetic code. Annu Rev Biochem. 79, 413-444 (2010).
  37. Mukai, T., Lajoie, M. J., Englert, M., Soll, D. Rewriting the Genetic Code. Annu Rev Microbiol. , (2017).
  38. O'Donoghue, P., Ling, J., Wang, Y. S., Soll, D. Upgrading protein synthesis for synthetic biology. Nat Chem Biol. 9 (10), 594-598 (2013).
  39. Chin, J. W. Expanding and reprogramming the genetic code of cells and animals. Annu Rev Biochem. 83, 379-408 (2014).
  40. O'Donoghue, P., et al. Near-cognate suppression of amber, opal and quadruplet codons competes with aminoacyl-tRNAPyl for genetic code expansion. FEBS Lett. 586 (21), 3931-3937 (2012).
  41. Aerni, H. R., Shifman, M. A., Rogulina, S., O'Donoghue, P., Rinehart, J. Revealing the amino acid composition of proteins within an expanded genetic code. Nucleic Acids Res. 43 (2), e8(2015).
  42. Huang, Y., et al. A convenient method for genetic incorporation of multiple noncanonical amino acids into one protein in Escherichia coli. Mol Biosyst. 6 (4), 683-686 (2010).
  43. Venkat, S., et al. Genetically encoding thioacetyl-lysine as a nondeacetylatable analog of lysine acetylation in Escherichia coli. FEBS Open. , (2017).
  44. Wan, W., Tharp, J. M., Liu, W. R. Pyrrolysyl-tRNA synthetase: an ordinary enzyme but an outstanding genetic code expansion tool. Biochim Biophys Acta. 1844 (6), 1059-1070 (2014).
  45. Gregoretti, I. V., Lee, Y. M., Goodson, H. V. Molecular evolution of the histone deacetylase family: functional implications of phylogenetic analysis. J Mol Biol. 338 (1), 17-31 (2004).
  46. Weinert, B. T., et al. Acetyl-phosphate is a critical determinant of lysine acetylation in E. coli. Mol cell. 51 (2), 265-272 (2013).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

Genetic Code ExpansionSite-Specific AcetylationAcetyllysine IncorporationPyrrolysyl-tRNA SynthetaseAmber Stop CodonEscherichia coli ExpressionProtein PurificationWestern BlottingTandem Mass SpectrometryBL21(DE3) Cells