A Facile Protocol to Generate Site-Specifically Acetylated Proteins in Escherichia Coli

Summary

Genetic code expansion serves as a powerful tool to study a wide range of biological processes, including protein acetylation. Here we demonstrate a facile protocol to exploit this technique for generating homogeneously acetylated proteins at specific sites in Escherichia coli cells.

Abstract

Post-translational modifications that occur at specific positions of proteins have been shown to play important roles in a variety of cellular processes. Among them, reversible lysine acetylation is one of the most widely distributed in all domains of life. Although numerous mass spectrometry-based acetylome studies have been performed, further characterization of these putative acetylation targets has been limited. One possible reason is that it is difficult to generate purely acetylated proteins at desired positions by most classic biochemical approaches. To overcome this challenge, the genetic code expansion technique has been applied to use the pair of an engineered pyrrolysyl-tRNA synthetase variant, and its cognate tRNA from Methanosarcinaceae species, to direct the cotranslational incorporation of acetyllysine at the specific site in the protein of interest. After first application in the study of histone acetylation, this approach has facilitated acetylation studies on a variety of proteins. In this work, we demonstrated a facile protocol to produce site-specifically acetylated proteins by using the model bacterium Escherichia coli as the host. Malate dehydrogenase was used as a demonstration example in this work.

Introduction

Post-translational modifications (PTMs) of proteins occur after the translation process, and arise from covalent addition of functional groups to amino acid residues, playing important roles in almost all the biological processes, including gene transcription, stress response, cellular differentiation, and metabolism^1,2,3. To date, about 400 distinctive PTMs have been identified⁴. The intricacy of the genome and the proteome is amplified to a great extent by protein PTMs, as they regulate protein activity and localization, and affect the interaction wi....

Protocol

1. Site-Directed Mutagenesis of the Target Gene

Note: MDH is expressed under T7 promoter in the pCDF-1 vector with the CloDF13 origin and a copy number of 20 to 40³⁴.

1. Introduce the amber stop codon at the position 140 in the gene by primers (forward primer: GGTGTTTATGACTAGAACAAACTGTTCGGCG and reverse primer: GGCTTTTTTCAGCACTTCAGCAGCAATTGC), following the instruction of the site-directed mutagenesis kit.
2. Amplify the template plasmid containing the gene of wild-type malate dehydratase, and insert the stop codon mutation by the polymerase chain reaction (PCR) reac....

Results

The yield of acetylated MDH protein was 15 mg per 1 L culture, while that of wild-type MDH was 31 mg per 1 L culture. Purified proteins were analyzed by SDS-PAGE as shown in Figure 1. The wild-type MDH was used as a positive control³⁴. The protein purified from cells harboring the acetyllysine (AcK) incorporation system and the mutant mdh gene, but without AcK in growth media, was used as a negative control. Lysine acetylation.......

Discussion

The genetic incorporation of noncanonical amino acids (ncAAs) is based on the suppression of an assigned codon, mostly the amber stop codon UAG^36,37,38,39, by the ncAA-charged tRNA containing the corresponding anticodon. As is known, the UAG codon is recognized by the release factor-1 (RF1) in bacteria, and it can also be suppressed by near cognate tRNAs from hosts charged by canonical amino ac.......

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
Bradford protein assay	Bio-Rad	5000006	Protein concentration
4x Laemmli Sample Buffer	Bio-Rad	1610747	SDS sample buffer
Coomassie G-250 Stain	Bio-Rad	1610786	SDS-PAGE gel staining
4-20% SDS-PAGE ready gel	Bio-Rad	4561093	Protein determination
Ac-K-100 (HRP Conjugate)	Cell Signaling	6952	Antibody
IPTG	CHEM-IMPEX	194	Expression inducer
Nε-Acetyl-L-lysine	CHEM-IMPEX	5364	Noncanonical amino acid
PD-10 desalting column	GE Healthcare	17085101	Desalting
Q5 Site-Directed Mutagenesis Kit	NEB	E0554	Introducing the stop codon
BL21 (DE3) cells	NEB	C2527	Expressing strain
QIAprep Spin Miniprep Kit	QIAGEN	27106	Extracting plasmids
Ni-NTA resin	QIAGEN	30210	Affinity purification resin
nicotinamide	Sigma-Aldrich	N3376	Deacetylase inhibitor
β-Mercaptoethanol	Sigma-Aldrich	M6250	Reducing agent
BugBuster Protein Extraction Reagent	Sigma-Aldrich	70584	Breaking cells
Benzonase nuclease	Sigma-Aldrich	E1014	DNase
ECL Western Blotting Substrate	ThermoFisher	32106	Chemiluminescence
Premixed LB Broth	VWR	97064	Cell growth medium
Bovine serum albumin	VWR	97061-416	western blots blocking