여기, 우리가 배아 개발, 운동, 시각화 세포 전기 전압 기자 제 브라 라인을 만드는 과정을 보여 그리고 물고기 종양 vivo에서세포.
전기, 내 생 전기적 신호 이온 채널에 의해 중재 및 세포 막에 있는 펌프 고르기 신경 및 근육 세포의 프로세스와 같은 다른 많은 생물 학적 과정, 신호에 중요 한 역할 배아 개발 패턴입니다. 그러나, vivo에서 전기 활동 모니터링 척추 embryogenesis에 대 한 필요가 있다. 인코딩된 유전자 형광 전압 표시기 (GEVIs)의 진보는이 전에 대 한 솔루션을 제공할 수 만들었습니다. 여기, 우리 유전자 변형 전압 표시기 zebrafish 설립된 전압 표시기, ASAP1를 사용 하 여 만드는 방법에 설명 (가속 센서의 활동 전위 1), 예를 들어. Tol2 키트와 유비 쿼터 스 zebrafish 발기인, ubi, 이 연구에서 선정 됐다. 우리는 또한 게이트웨이 사이트 복제, Tol2 transposon 기반 zebrafish transgenesis, 그리고 일반 epifluorescent 현미경을 사용 하 여 초기 단계 물고기 배아와 물고기 종양에 대 한 이미징 프로세스의 프로세스를 설명 합니다. 이 물고기 라인을 사용 하 여, 우리는 제 브라 embryogenesis, 그리고 물고기 애벌레 운동 하는 동안 세포 전기 전압 변화는 발견. 또한, 몇 가지 zebrafish 악성 말 초 신경 칼 집 종양, 셀은 일반적으로 편광 종양 주변 정상 조직에 비해 관찰 되었다.
전기 이온 채널과1세포 막 있는 펌프에 의해 중재 생 전기 신호를 말합니다. 세포 막과 결합 된 전기 잠재력과 현재 변화, 이온 교환 프로세스 고르기 신경 및 근육 세포의 신호에 대 한 필수적입니다. 또한, 전기 및 이온 기온 변화도 다른 중요 한 생물 학적 기능 에너지 저장, 생 합성, 대사 산물 수송 등의 다양 한이 있다. 생체 전기 신호도 몸 축, 세포 주기, 세포 감 별 법1등 미 발달 패턴 형성의 레 귤 레이 터로 발견 되었다. 따라서, 그것은 이러한 유형의 신호의 미 규제에 기인 하 많은 인간의 선 천 성 질병을 이해 중요 합니다. 패치 클램프 널리 사용 되었습니다 단일 셀 기록, 배아 발달 비보중 여러 셀의 동시 모니터링에 이상적에서 멀리 아직도 이다. 또한, 전압 민감한 작은 분자는 또한 그들의 특이성, 감도, 및 독성 vivo에서 애플리케이션에 적합 하지.
창조의 다양 한 유전자 형광 전압 표시기 (GEVIs) 제공이이 문제를 극복 하기 위해 새로운 메커니즘이 인코딩되고 그들은 원래 신경 모니터링 위한 했다 비록 배아 개발 공부를 쉽게 응용 프로그램에 대 한 허용 2,3세포. 현재 사용할 수 있는 GEVIs 중 하나는 가속 센서의 활동 전위 1 (ASAP1)4입니다. 그것은 전압 과민 한 인산 가수분해 효소와 원형으로 배치 된 녹색 형광 단백질의 전압 감지 도메인의 extracellular 루프의 구성 됩니다. 따라서, ASAP1 세포 전기 잠재적인 변화의 시각화 수 (분극: 밝은 녹색; 도발은: 진한 녹색). ASAP1 속도 론 온 오프 2 ms, 있으며 subthreshold 잠재적인 변경4를 추적할 수 있습니다. 따라서,이 유전 도구 라이브 셀에 실시간 생체 모니터링에 효능의 새로운 수준에 대 한 수 있습니다. 배아 발달에 많은 인간 질병, 암, 등 전기의 역할의 더 이해 것입니다 창 고 기본 메커니즘에 새로운 빛이는 질병 치료 및 예방에 매우 중요.
Zebrafish 강력한 동물 모델 개발 생물학과 암5,6을 포함 하 여 인간의 질병을 입증 되었습니다. 인간, 70 %orthologous 유전자를 공유 하는 그들은 그리고 그들은 유사한 척 추가 있는 생물학7. Zebrafish는 비교적 쉽게 치료, 계란, 온순한 유전학, 쉬운 transgenesis, 그리고 투명 한 외부 배아 발달, 그들에 게 비보에 이미징5,6우수한 시스템의 큰 클러치 크기를 제공 합니다. 이미 존재 하는 돌연변이 물고기 선의 큰 소스와 완전히 시퀀스 게놈, zebrafish는 과학적 발견의 상대적으로 무제한 범위를 제공 합니다.
Vivo에서 실시간 전기 세포의 활동을 조사, 우리 활용 zebrafish 모델 시스템 및 ASAP1. 이 문서에서 우리는 형광 전압 바이오 센서 ASAP1 Tol2 transposon transgenesis를 사용 하 여 zebrafish 게놈으로 통합 하는 방법을 설명 하 고 배아 개발, 물고기 애벌레 움직임, 그리고 라이브 종양에서 세포 전기 활동을 시각화 .
있지만 세포와 조직 수준의 전기 활동 배아 개발 및 인간 질병 동안 오래 전에 발견 되었다, vivo에서 동적 전기 변화 및 그들의 생물학 역할 여전히 남아 크게 알 수 없는. 주요 과제 중 하나는 시각화 하 고 계량 전기 변화입니다. 단일 셀을 추적 하기 위한 휴식 통해 패치 클램프 기술 이다 하지만 그들은 많은 세포의 구성 되어 있기 때문에 척추 동물 배아의 응용 제한 됩니다. 현재 화학 전?…
The authors have nothing to disclose.
이 간행물에 보고 된 연구 작업에 의해 국립 연구소의 일반 의료 과학 수상 번호 R35GM124913, 퍼듀 대학 PI4D 인센티브 프로그램, 그리고 PVM 내부 경쟁에서 국립 보건원의 지원 기초 연구 자금 프로그램입니다. 내용은 전적으로 저자의 책임 이며 반드시 자금 에이전트의 공식 의견을 대표 하지 않는다. 우리 Tol2 구문, ASAP1 구문에 대 한 마이클 린 고이치 가와카미를 감사 하 고 레너드 Zon ubi 발기인에 대 한 Addgene를 통해 생성.
14mL cell culture tubes | VWR | 60818-725 | E.Coli culture |
Agarose electrophoresis tank | Thermo Scientific | Owl B2 | DNA eletrophoresis |
Agarose RA | Amresco | N605-500G | For making the injection gels |
Attb1-ASAP1-F primer | IDT DNA | GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCATGGAGACGACTGTGAGGTATGAACA | ASAP1 coding region amplification for subcloning |
Attb2-ASAP1-R primer | IDT DNA | GGGGACCACTTTGTACAAGAAAGCTGGGTCTTAGGTTACCACTTCAAGTTGTTTCTTCTGTGAAGCCA | ASAP1 coding region amplification for subcloning |
Bright field dissection scope | Nikon | SMZ 745 | Dechorionation, microinjection, mounting |
Color camera | Zeiss | AxioCam MRc | Fish embryo image recording |
Concave slide | VWR | 48336-001 | For holding fish embryos during imaging process |
Disposable transfer pipette 3.4 ml | Thermo Scientific | 13-711-9AM | Fish embryos and water transfer |
Endonuclease enzyme, Not I | NEB | R0189L | For linearizing plasmid DNA |
Epifuorescent compound scope | Zeiss | Axio Imager.A2 | Fish embryo imaging |
Epifuorescent stereo dissection scope | Zeiss | Stereo Discovery.V12 | Fish embryo imaging |
Fluorescent light source | Lumen dynamics | X-cite seris 120 | Light source for fluorescence microscopes |
Forceps #5 | WPI | 500342 | Dechorionation and needle breaking |
Gateway BP Clonase II Enzyme mix | Thermo Scientific | 11789020 | Gateway BP recombination cloning |
Gateway LR Clonase II Plus enzyme | Thermo Scientific | 12538120 | Gateway LR recombination cloning |
Gel DNA Recovery Kit | Zymo Research | D4002 | DNA gel purification |
Loading tip | Eppendorf | 930001007 | For loading injection solution into capilary needles |
Methylcellulose (1600cPs) | Alfa Aesar | 43146 | Fish embryo mounting |
Methylene blue | Sigma-Aldrich | M9140 | Suppresses fungal outbreaks in Petri dishes |
Microinjection mold | Adaptive Science Tools | TU-1 | To prepare agaorse mold tray for holding fish embryos during injection |
Microinjector | WPI | Pneumatic Picopump PV820 | Microinjection injector |
Micro-manipulator | WPI | Microinjector mm33 rechts | Microinjection operation |
Micropipette puller | Sutter instrument | P-1000 | For preparing capillary needle |
Mineral oil | Amresco | J217-500ml | For calibrating injection volume |
mMESSAGE mMACHINE SP6 Transcription Kit | Thermo Scientific | AM1340 | mRNA in vitro transcription |
Monocolor camera | Zeiss | AxioCam MRm | Fish embryo image recording |
Plasmid Miniprep Kit | Zymo Research | D4020 | Prepare small amount of plasmid DNA |
Plastic Petri dishes | VWR | 25384-088 | For holding fish or fish embryos during imaging process |
RNA Clean & Concentrator-5 | Zymo Research | R1015 | mRNA cleaning after in vitro transcription |
Spectrophotometer | Thermo Scientific | NanoDrop 2000 | For measuring DNA and RNA concentrations |
Stage Micrometer | Am Scope | MR100 | Microinjection volume calibration |
Thermocycler | Bio-Rad | T100 | DNA amplification for gene cloning |
Thin wall glass capillaries | WPI | TW100F-4 | Raw glass for making cappilary needle |
Tol2-exL1 primer | IDT DNA | GCACAACACCAGAAATGCCCTC | Tol2 excise assay |
Tol2-exR primer | IDT DNA | ACCCTCACTAAAGGGAACAAAAG | Tol2 excise assay |
TOP10 Chemically Competent E. coli | Thermo Scientific | C404006 | Used for transformation during gene cloning |
Tricaine mesylate | Sigma-Aldrich | A5040 | For anesthetizing fish or fish embryos |
UV trans-illuminator 302nm | UVP | M-20V | DNA visualization |
Water bath | Thermo Scientific | 2853 | For transformation process of gene cloning |