यहाँ हम एक प्रोटोकॉल जो कम सेल क्रोमेटिन immunoprecipitation (चिप) प्रदर्शन द्वारा तीव्र रूप से शुद्ध मस्तिष्क oligodendrocyte अग्रदूत कोशिकाओं (OPCs) में oligodendrocyte प्रतिलेखन कारक 2 (Olig2) के जीनोम व्यापक बंधन का विश्लेषण करने के लिए डिज़ाइन किया गया है मौजूद , पुस्तकालय तैयारी, उच्च प्रवाह अनुक्रमण और bioinformatic डेटा विश्लेषण ।
स्तनधारी कोशिकाओं में, जीन प्रतिलेखन जीनोमिक डीएनए के साथ transcriptional कारकों की बातचीत द्वारा एक कोशिका प्रकार विशिष्ट तरीके से विनियमित है । वंश-विशिष्ट प्रतिलेखन कारकों के लिए सेल विनिर्देश और विकास के दौरान भेदभाव में आवश्यक भूमिका निभाने के लिए माना जाता है । उच्च प्रवाह डीएनए अनुक्रमण (चिप seq) के साथ युग्मित चिप व्यापक रूप से जीनोमिक डीएनए के लिए प्रतिलेखन कारकों (या उसके जुड़े जटिल) के जीनोम व्यापक बाध्यकारी साइटों का विश्लेषण करने के लिए प्रयोग किया जाता है । हालांकि, कोशिकाओं की एक बड़ी संख्या एक मानक चिप प्रतिक्रिया है, जो यह मुश्किल अलग प्राथमिक कोशिकाओं या दुर्लभ कोशिका आबादी की सीमित संख्या का अध्ययन करने के लिए बनाता है के लिए आवश्यक हैं । आदेश में oligodendrocyte वंश के विनियामक तंत्र को समझने के लिए विशिष्ट प्रतिलेखन कारक Olig2 तीव्र शुद्ध माउस OPCs में, एक विस्तृत चिप seq का उपयोग करने के लिए Olig2 (या Olig2 परिसर) के जीनोम व्यापक बाध्यकारी साइटों की पहचान विधि दिखाया गया है । सबसे पहले, प्रोटोकॉल बताते हैं कि कैसे प्लेटलेट को शुद्ध करने के लिए-व्युत्पंन वृद्धि कारक रिसेप्टर अल्फा (PDGFRα) सकारात्मक OPCs माउस दिमाग से. अगले, Olig2 एंटीबॉडी मध्यस्थता चिप और पुस्तकालय निर्माण किया जाता है । पिछले भाग bioinformatic सॉफ्टवेयर और Olig2 चिप seq विश्लेषण के लिए इस्तेमाल किया प्रक्रियाओं का वर्णन । संक्षेप में, इस कागज एक विधि को तीव्र रूप से शुद्ध मस्तिष्क OPCs में transcriptional कारक Olig2 के जीनोम व्यापक bindings विश्लेषण की रिपोर्ट ।
यह प्रोटीन (या प्रोटीन जटिल) डीएनए bindings और epigenetic मार्क्स विभिंन जैविक प्रक्रियाओं में शामिल transcriptional विनियामक नेटवर्क का निर्माण करने के लिए अध्ययन करने के लिए महत्वपूर्ण है । विशेष रूप से, जीनोमिक डीएनए के लिए प्रतिलेखन कारकों की bindings जीन विनियमन में एक महत्वपूर्ण भूमिका निभा सकते हैं, सेल भेदभाव, और ऊतक के विकास । transcriptional विनियमन और epigenetic तंत्र का अध्ययन करने के लिए एक शक्तिशाली उपकरण क्रोमेटिन immunoprecipitation (चिप) है । अगली पीढ़ी अनुक्रमण प्रौद्योगिकी में तेजी से प्रगति के कारण, उच्च प्रवाह डीएनए अनुक्रमण (चिप seq) के साथ युग्मित चिप प्रोटीन डीएनए bindings और epigenetic के निशान के विश्लेषण के लिए प्रयोग किया जाता है1। हालांकि, एक मानक चिप seq प्रोटोकॉल की प्रतिक्रिया के बारे में २०,०००,००० कोशिकाओं की आवश्यकता है, जो इस तकनीक के आवेदन मुश्किल जब कोशिका संख्या सीमित है, जैसे पृथक प्राथमिक कोशिकाओं और दुर्लभ कोशिका आबादी के रूप में बनाता है ।
Oligodendrocyte अग्रदूत कोशिकाओं (OPCs) और oligodendrocytes सहित Oligodendrocyte वंश कोशिकाओं व्यापक रूप से मस्तिष्क भर में वितरित कर रहे हैं और विकास और मस्तिष्क के समारोह के लिए आवश्यक हैं । अग्रदूत कोशिकाओं के एक प्रकार के रूप में, OPCs दोनों आत्म नवीकरण और भेदभाव करने में सक्षम हैं । OPCs न केवल oligodendrocytes के लिए progenitors के रूप में सेवा, लेकिन यह भी मस्तिष्क की कोशिकाओं के अंय प्रकार के साथ संचार द्वारा ंयूरॉन संकेतन के प्रचार में एक महत्वपूर्ण भूमिका निभाते है2। पिछले अध्ययनों का सुझाव दिया है कि oligodendrocyte विकास वंश द्वारा विनियमित है विशिष्ट प्रतिलेखन कारकों जैसे Olig2 और Sox103,4। इन प्रतिलेखन कारकों को प्रवर्तक या कुछ महत्वपूर्ण जीन के बढ़ाने के क्षेत्रों को oligodendrocyte विनिर्देश और भेदभाव के दौरान अपनी अभिव्यक्ति को प्रभावित करने के लिए बाध्य पाया गया । हालांकि, यह कोशिकाओं की एक बहुत ही सीमित संख्या के साथ तीव्रता से शुद्ध प्राथमिक OPCs में प्रोटीन (या प्रोटीन परिसर) ब्याज की डीएनए बाइंडिंग की पहचान करने के लिए चुनौतीपूर्ण है ।
इस प्रोटोकॉल का वर्णन कैसे व्यवस्थित करने के जीनोम में शुद्ध माउस OPCs में Olig2 द्वारा जीनोमिक डीएनए immunoprecipitated जांच करने के लिए व्यापक पैमाने चिप-seq तकनीक का उपयोग कर । माउस दिमाग से OPCs तीव्रता से immunopanning द्वारा शुद्ध और एक चिप प्रयोग में प्रसार के बिना इस्तेमाल किया गया इन विट्रो में। OPCs की एक सीमित संख्या immunopanning द्वारा प्राप्त किया जा सकता है और मानक चिप-seq प्रयोगों के लिए अपर्याप्त है । इस के साथ साथ, एक कम सेल चिप-प्रतिलेखन कारकों के लिए चिप प्रतिक्रिया प्रति २०००० कोशिकाओं के रूप में कम के साथ seq प्रोटोकॉल का वर्णन किया है । संक्षेप में, पार से जुड़े कोशिकाओं लीजड ड और क्रोमेटिन कतरनी करने के लिए एक sonication डिवाइस द्वारा sonicated थे । कतरनी क्रोमेटिन Olig2 एंटीबॉडी के साथ के रूप में अच्छी तरह से प्रोटीन एक लेपित मोती Olig2 एंटीबॉडी बाध्य जीनोमिक डीएनए हाला करने के लिए मशीन था । प्रोटीन से रेफरेंस के बाद एक लेपित मोतियों और रिवर्स पार जोड़ने, जीनोमिक डीएनए Olig2 एंटीबॉडी द्वारा उपजी phenol-क्लोरोफॉर्म निष्कर्षण द्वारा शुद्ध किया गया था । परिणामस्वरूप उत्पाद quantified और टी के अधीन था, पूंछ, प्राइमर एनीलिंग टेंपलेट स्विचन और विस्तार, एडेप्टर और प्रवर्धन, पुस्तकालय का आकार चयन और चिप seq पुस्तकालय निर्माण के लिए शुद्धि कदम के अलावा ।
अनुक्रमण के बाद, कच्चे दोनों Olig2 प्रतिलेखन फैक्टर एंटीबॉडी और नियंत्रण के नमूने के साथ तैयार नमूना से पढ़ता की गुणवत्ता का विश्लेषण किया गया था. कम गुणवत्ता वाले आधार जोड़े और एडाप्टर को पढ़ने के टुकड़े युक्त छंटनी की गई । अगले, ट्रिम किए गए पढ़ता माउस संदर्भ जीनोम के लिए गठबंधन किया गया । जीनोमिक क्षेत्रों है कि काफी चिप के लिए समृद्ध थे पढ़ता है, नियंत्रण नमूने की तुलना में, चोटियों के रूप में पता लगाया गया । महत्वपूर्ण चोटियों, संभावित प्रतिलेखन कारक बंधन साइटों का प्रतिनिधित्व, फ़िल्टर और एक जीनोम ब्राउज़र में visualized थे ।
विशेष रूप से, इस प्रोटोकॉल में वर्णित विधि मोटे तौर पर सीमित संख्या के किसी भी सेल प्रकार के साथ अंय प्रतिलेखन कारकों की चिप seq के लिए इस्तेमाल किया जा सकता है ।
स्तनधारी जीन विनियमन नेटवर्क बहुत जटिल हैं । चिप-seq एक शक्तिशाली जीनोम-वाइड प्रोटीन-डीएनए बातचीत की जांच विधि है । इस प्रोटोकॉल शामिल कैसे माउस दिमाग से शुद्ध OPCs की एक कम संख्या का उपयोग करके Olig2 चिप-seq प्र?…
The authors have nothing to disclose.
JQW, XD, RCDD, और वव स्वास्थ्य R01 NS088353 के राष्ट्रीय संस्थानों से अनुदान द्वारा समर्थित थे; NIH अनुदान 1R21AR071583-01; Staman Ogilvie फंड-मेमोरियल हरमन फाउंडेशन; UTHealth मस्तिष्क पहल र CTSA UL1 TR000371; और टेक्सास प्रणाली तंत्रिका विज्ञान और Neurotechnology अनुसंधान संस्थान (अनुदान #362469) के विश्वविद्यालय से एक अनुदान ।
Reagent/ Equipment | |||
Banderiaea simplicifolia lectin 1 | Vector Laboratories | # L-1100 | |
Rat anti-PDGFRa antibody | BD Bioscience | # 558774 | |
Neural tissue dissociation Kit (P) | MACS Miltenyi Biotec | # 130-092-628 | |
Accutase | STEMCELL technologies | # 07920 | |
TRIzol | Thermo Fisher | # 15596026 | |
Anti-NG2 Chondroitin Sulfate Proteoglycan Antibody | Millipore | # AB5320 | |
Bioruptor Pico sonication device | Diagenode | # B01060001 | |
True MicroChIP kit | Diagenode | # C01010130 | |
Phenol:Chloroform:Isoamyl Alcohol (25:24:1, v/v) | Thermo Fisher | # 15593031 | |
NucleoSpin Gel and PCR Clean-Up kit | MACHEREY-NAGEL | # 740609 | |
Quant-iT PicoGreen dsDNA Assay Kit | Thermo Fisher | # P11496 | |
DNA SMART ChIP-Seq kit | Clontech Laboratories | # 634865 | |
Agencourt AMPure XP | Beckman Voulter | # A63880 | |
GlycoBlue | Thermo Fisher | # AM9516 | |
pico-green | Thermo Fisher | # P11496 | |
D-PBS | Thermo Fisher | # 14190-144 | |
SYBR Green master mix | Bio-Rad Laboratories | # 1725124 | |
DMEM/F12 | Fisher Scientific | # 11-320-033 | |
Penicillin-Streptomycin (P/S) | Fisher Scientific | # 15140122 | |
N-2 Supplement | Fisher Scientific | # 17502048 | |
B-27 Supplement | Fisher Scientific | # 17504044 | |
insulin | Sigma | # I6634 | Prepare 0.5 mg/ml insulin solution by dissolving 5 mg insulin in 10 ml water and 50 μl of 1 N HCl. |
Bovine Serum Albumin, suitable for cell culture (BSA) | Sigma | # A4161 | Prepare 4% BSA solution by dissolving 4 g BSA in 100 ml D-PBS and adjust the pH to 7.4 |
Fibroblast Growth Factor basic Protein, Human recombinant (bFGF) | EMD Millipore | # GF003 | |
HUMAN PDGF-AA | VWR | # 102061-188 | |
poly-D-lysine | VWR | # IC15017510 | Prepare 1 mg/ml poly-D-lysine solution by dissolving 10 mg poly-D-lysine in 10 ml water and dilute 100 times when using. |
Falcon Disposable Petri Dishes, Sterile, Corning, 100x15mm | VWR | # 25373-100 | |
Falcon Disposable Petri Dishes, Sterile, Corning, 150x15mm | VWR | # 25373-187 | |
HBSS, 10X, no Calcium, no Magnesium, no Phenol Red | Fisher Scientific | # 14185-052 | |
Trypan Blue | Stemcell Technologies | # 07050 | |
protease inhibitor cocktail | Sigma | # 11697498001 | |
Software | |||
FastQC | [10] http://www.bioinformatics.babraham.ac.uk/projects/fastqc/ | Obtaining quality control metrics of raw and trimmed reads | |
Trimmomatic 0.33 | [11] http://www.usadellab.org/cms/?page=trimmomatic | Trimming and filtering raw reads | |
GENCODE mm10 | ftp://ftp.sanger.ac.uk/pub/gencode/Gencode_mouse/release_M15/GRCm38.primary_assembly.genome.fa.gz | Mouse reference genome | |
Bowtie2 2.2.4 | [12] http://bowtie-bio.sourceforge.net/bowtie2/index.shtml | Aligning reads to a reference genome | |
SAMTools 1.5 | [13] http://samtools.sourceforge.net/ | Converting SAM file into BAM format | |
HOMER 4.9.1 | [14] http://homer.ucsd.edu/homer/ | Creating a tag directory and annotating enriched genomic regions with gene symbols | |
R 3.2.2 | [15] https://www.R-project.org/ | Programming scripts and running functions | |
SPP 1.13 | [16] https://github.com/hms-dbmi/spp | Creating a strand cross-correlation plot | |
MACS2 2.2.4 | [17] https://github.com/taoliu/MACS | Finding regions of ChIP enrichment over control | |
BEDTools 2.25 | [18] http://bedtools.readthedocs.io/en/latest/ | Genome arithmetics | |
bedGraphToBigWig | http://hgdownload.cse.ucsc.edu/admin/exe/ | Converting bedGraph file into bigwig | |
IGV browser 2.3.58 | [19] http://software.broadinstitute.org/software/igv/ | Visualization and browsing of significant ChIP-seq peaks | |
Microsoft Excel | Spreasheet program | ||
ENCODE's blacklist | https://sites.google.com/site/anshulkundaje/projects/blacklists | Filtering peaks | |
mm10.chrom.sizes | http://hgdownload.cse.ucsc.edu/goldenPath/mm10/bigZips/mm10.chrom.sizes. | Converting bedGraph file into bigwig | |
ENCODE's motif database | [25] http://compbio.mit.edu/encode-motifs/ | Comprehensive motif database required for motif enrichment | |
MEME-ChIP | [20] http://meme-suite.org/index.html | Motif enrichment analysis and motif discovery | |
Primer names used for qPCR | Primer sequences used for qPCR | ||
Mbp-F: | CTATAAATCGGCTCACAAGG | ||
Mbp-R: | AGGCGGTTATATTAAGAAGC | ||
Iba1-F: | ACTGCCAGCCTAAGACAACC | ||
Iba1-R: | GCTTTTCCTCCCTGCAAATCC | ||
Mog-F: | GGCTTCTTGGAGGAAGGGAC | ||
Mog-R: | TGAATTGTCCTGCATAGCTGC | ||
GAPDH-F | ATGACATCAAGAAGGTGGTG | ||
GAPDH-R | CATACCAGGAAATGAGCTTG | ||
Tuj1-F | TTTTCGTCTCTAGCCGCGTG | ||
Tuj1-R | GATGACCTCCCAGAACTTGGC | ||
PDGFRα-F | AGAGTTACACGTTTGAGCTGTC | ||
PDGFRα-R | GTCCCTCCACGGTACTCCT |