تحديد مواقع النسخ Olig2 عامل ربط الجينوم في حدة تنقية PDGFRα + الخلايا من الكروماتين خلية منخفض إيمونوبريسيبيتيشن تسلسل التحليل
Summary
هنا نقدم بروتوكول الذي يهدف إلى تحليل ملزمة على نطاق الجينوم عامل النسخ oligodendrocyte 2 (Olig2) في الدماغ تنقية حادة oligodendrocyte خلايا السلائف (OPCs) بأداء منخفضة خلايا الكروماتين إيمونوبريسيبيتيشن (شريحة) ، إعداد مكتبة والتسلسل الفائق وتحليل البيانات بيوينفورماتيك.
Abstract
في خلايا الثدييات، ينظم التفاعلات بين العوامل النسخي مع الحمض النووي الجينات النسخ بطريقة محددة نوع خلية. وتعتبر عوامل النسخ الخاصة بالنسب القيام بأدوار أساسية في مواصفات الخلية والتمايز من خلال التنمية. رقاقة مقترنة بتسلسل الحمض النووي الفائق (الرقائق-seq) يستخدم على نطاق واسع لتحليل مواقع على نطاق الجينوم ربط عوامل النسخ (أو المعقدة المرتبطة به) للحمض النووي. ومع ذلك، عدد كبير من الخلايا مطلوبة من أجل رد رقاقة قياسي واحد، مما يجعل من الصعب على دراسة عدد محدود من الخلايا الأولية المعزولة أو خلية نادرة السكان. من أجل فهم الآلية التنظيمية للنسخ الخاصة بالنسب oligodendrocyte يظهر عامل Olig2 في الماوس المنقي حادة المعاونة، طريقة مفصلة باستخدام رقاقة seq لتحديد المواقع على نطاق الجينوم ملزمة Olig2 (أو Olig2 المعقدة). أولاً، البروتوكول يوضح كيفية تنقية ألفا مستقبلات عامل النمو المشتقة من الصفيحات (PDGFRα) المعاونة الإيجابية من العقول الماوس. المقبل، بوساطة جسم Olig2 رقاقة وتتم بناء مكتبة. ويصف الجزء الأخير بيوينفورماتيك البرامج والإجراءات المستخدمة لتحليل Olig2 رقاقة-seq. وباختصار، تقارير هذه الورقة أسلوباً لتحليل الارتباطات على نطاق الجينوم النسخي عامل Olig2 في الدماغ تنقية حادة المعاونة.
Introduction
من المهم دراسة البروتين (أو البروتين المعقدة) ربط الحمض النووي وعلامات جينية لبناء الشبكات التنظيمية النسخي الضالعة في العمليات البيولوجية المختلفة. خاصة، ارتباطات عوامل النسخ إلى الحمض النووي يمكن أن تلعب دوراً هاما في تنظيم الجينات، والتفريق بين الخلية، وتطوير الأنسجة. أداة قوية لدراسة تنظيم النسخي والآليات جينية الكروماتين إيمونوبريسيبيتيشن (رقاقة). نظراً للتقدم السريع في تكنولوجيا الجيل القادم على التسلسل، يستخدم رقاقة مقترنة بتسلسل الحمض النووي الفائق (الرقائق-seq) لتحليل روابط البروتين-الحمض النووي وعلامات جينية1. ومع ذلك، تتطلب بروتوكول seq رقاقة قياسي الخلايا حوالي 20 مليون كل رد فعل، الأمر الذي يجعل تطبيق هذه التقنية صعبة عندما يقتصر عدد الخلايا، مثل الخلايا الأولية المعزولة وخلية نادرة السكان.
وتوزع على نطاق واسع في جميع أنحاء الدماغ oligodendrocyte خلايا النسب بما في ذلك الخلايا السليفة oligodendrocyte (OPCs) و oligodendrocytes وضرورية للتنمية ووظيفة المخ. كنوع من خلايا السلائف، قادرون على المعاونة للتجديد الذاتي والتمايز. المعاونة ليس فقط بمثابة المتكفل ل oligodendrocytes ولكن أيضا تلعب دوراً هاما في نشر الإشارات العصبية بالتواصل مع أنواع أخرى من خلايا الدماغ2. وأشارت الدراسات السابقة أن التنمية أوليجوديندروسيتي يخضع لعوامل النسخ الخاصة بالنسب مثل Olig2 و Sox103،4. تم العثور على هذه العوامل النسخ لربط مناطق المروج أو محسن لبعض الجينات الحاسمة للتأثير على التعبير عنها أثناء أوليجوديندروسيتي مواصفات وتفرقة. ومع ذلك، أنها صعبة لتحديد ربط الحمض النووي للبروتين (أو البروتين المعقدة) الاهتمام بالمعاونة الأولية النقية حادة مع عدد محدود جداً من الخلايا.
هذا البروتوكول وصف كيفية التحقيق بشكل منهجي إيمونوبريسيبيتاتيد الحمض النووي الجينوم ب Olig2 في الماوس المنقي المعاونة في نطاق الجينوم باستخدام تقنية رقاقة seq. المعاونة من العقول الماوس حادة تنقيته من إيمونوبانينج والمستخدمة في تجربة رقاقة دون الانتشار في المختبر. عدد محدود من المعاونة يمكن الحصول عليها من إيمونوبانينج وهو غير كاف لإجراء التجارب على رقاقة seq القياسية. هنا، أن بروتوكول seq رقاقة خلية منخفض مع منخفضة تصل إلى 20 ألف الخلايا كل رقاقة رد فعل لعوامل النسخ وصف. وباختصار، تفكيك خلايا cross-linked وسونيكاتيد بجهاز سونيكيشن القص في الكروماتين. كان المحتضنة الكروماتين المنفصمة مع الأجسام المضادة Olig2، فضلا عن البروتين الخرز المغلفة يعجل بالحمض النووي Olig2 جسم ملزمة. بعد شطف من البروتينات المغلفة بالخرز والعابرة للربط العكسي، تمت تنقية الحمض النووي عجلت بجسم Olig2 باستخراج الفينول كلوروفورم. وناتج كمياً وتعرض لتراجع تي، التمهيدي الصلب القالب التبديل والتمديد، إضافة محولات والتضخيم، واختيار حجم المكتبة وتنقية خطوات لبناء مكتبة شرائح seq.
بعد التسلسل، وقد تم تحليل النوعية من الخام على ما يلي من العينة أعد مع جسم عامل النسخ Olig2 ونموذج عنصر تحكم. زوج قاعدي منخفض الجودة والتي تحتوي على محول قراءة أجزاء تم اقتطاعها. كانت محاذاة القراءات القادمة، قلصت إلى الجينوم إشارة الماوس. مناطق الجينوم التي كانت أثرت إلى حد كبير على رقاقة على ما يلي، بالمقارنة إلى نموذج عنصر تحكم، تم الكشف عنها كقمم. تم تصفية قمم كبيرة، تمثل مواقع الربط عامل النسخ المحتملة، وتصور في مستعرض جينوم.
جدير بالذكر أن الطريقة الموصوفة في هذا البروتوكول يمكن استخدامها على نطاق واسع ل seq رقاقة من عوامل النسخ الأخرى مع أي نوع من الخلايا لعدد محدود.
Protocol
Representative Results
Discussion
شبكات تنظيم الجينات الثدييات معقدة جداً. رقاقة-seq وسيلة قوية للتحقيق في تفاعلات البروتين على نطاق الجينوم الحمض النووي. ويشمل هذا البروتوكول كيفية أداء رقاقة-seq Olig2 باستخدام عدد قليل من المعاونة المنقي من العقول الماوس (منخفضة كخلايا 20 ألف كل رد فعل). الخطوة الرئيسية الأولى لهذا البروتوكول …
Disclosures
The authors have nothing to disclose.
Acknowledgements
جقو XD، ركد و YY كانت تدعمها المنح المقدمة من المعاهد الوطنية من NS088353 R01 على الصحة؛ منح المعهد الوطني للصحة 1R21AR071583-01؛ مؤسسة هيرمان اوغيلفي الصندوق-النصب التذكاري ستمان؛ مبادرة المخ أوثيالث وكتسا UL1 TR000371؛ ومنحة من جامعة تكساس نظام علم الأعصاب، ومعهد بحوث الأعصاب (منحة #362469).
Materials
| Reagent/ Equipment | |||
| Banderiaea simplicifolia lectin 1 | Vector Laboratories | # L-1100 | |
| Rat anti-PDGFRa antibody | BD Bioscience | # 558774 | |
| Neural tissue dissociation Kit (P) | MACS Miltenyi Biotec | # 130-092-628 | |
| Accutase | STEMCELL technologies | # 07920 | |
| TRIzol | Thermo Fisher | # 15596026 | |
| Anti-NG2 Chondroitin Sulfate Proteoglycan Antibody | Millipore | # AB5320 | |
| Bioruptor Pico sonication device | Diagenode | # B01060001 | |
| True MicroChIP kit | Diagenode | # C01010130 | |
| Phenol:Chloroform:Isoamyl Alcohol (25:24:1, v/v) | Thermo Fisher | # 15593031 | |
| NucleoSpin Gel and PCR Clean-Up kit | MACHEREY-NAGEL | # 740609 | |
| Quant-iT PicoGreen dsDNA Assay Kit | Thermo Fisher | # P11496 | |
| DNA SMART ChIP-Seq kit | Clontech Laboratories | # 634865 | |
| Agencourt AMPure XP | Beckman Voulter | # A63880 | |
| GlycoBlue | Thermo Fisher | # AM9516 | |
| pico-green | Thermo Fisher | # P11496 | |
| D-PBS | Thermo Fisher | # 14190-144 | |
| SYBR Green master mix | Bio-Rad Laboratories | # 1725124 | |
| DMEM/F12 | Fisher Scientific | # 11-320-033 | |
| Penicillin-Streptomycin (P/S) | Fisher Scientific | # 15140122 | |
| N-2 Supplement | Fisher Scientific | # 17502048 | |
| B-27 Supplement | Fisher Scientific | # 17504044 | |
| insulin | Sigma | # I6634 | Prepare 0.5 mg/ml insulin solution by dissolving 5 mg insulin in 10 ml water and 50 μl of 1 N HCl. |
| Bovine Serum Albumin, suitable for cell culture (BSA) | Sigma | # A4161 | Prepare 4% BSA solution by dissolving 4 g BSA in 100 ml D-PBS and adjust the pH to 7.4 |
| Fibroblast Growth Factor basic Protein, Human recombinant (bFGF) | EMD Millipore | # GF003 | |
| HUMAN PDGF-AA | VWR | # 102061-188 | |
| poly-D-lysine | VWR | # IC15017510 | Prepare 1 mg/ml poly-D-lysine solution by dissolving 10 mg poly-D-lysine in 10 ml water and dilute 100 times when using. |
| Falcon Disposable Petri Dishes, Sterile, Corning, 100x15mm | VWR | # 25373-100 | |
| Falcon Disposable Petri Dishes, Sterile, Corning, 150x15mm | VWR | # 25373-187 | |
| HBSS, 10X, no Calcium, no Magnesium, no Phenol Red | Fisher Scientific | # 14185-052 | |
| Trypan Blue | Stemcell Technologies | # 07050 | |
| protease inhibitor cocktail | Sigma | # 11697498001 | |
| Software | |||
| FastQC | [10] http://www.bioinformatics.babraham.ac.uk/projects/fastqc/ | Obtaining quality control metrics of raw and trimmed reads | |
| Trimmomatic 0.33 | [11] http://www.usadellab.org/cms/?page=trimmomatic | Trimming and filtering raw reads | |
| GENCODE mm10 | ftp://ftp.sanger.ac.uk/pub/gencode/Gencode_mouse/release_M15/GRCm38.primary_assembly.genome.fa.gz | Mouse reference genome | |
| Bowtie2 2.2.4 | [12] http://bowtie-bio.sourceforge.net/bowtie2/index.shtml | Aligning reads to a reference genome | |
| SAMTools 1.5 | [13] http://samtools.sourceforge.net/ | Converting SAM file into BAM format | |
| HOMER 4.9.1 | [14] http://homer.ucsd.edu/homer/ | Creating a tag directory and annotating enriched genomic regions with gene symbols | |
| R 3.2.2 | [15] https://www.R-project.org/ | Programming scripts and running functions | |
| SPP 1.13 | [16] https://github.com/hms-dbmi/spp | Creating a strand cross-correlation plot | |
| MACS2 2.2.4 | [17] https://github.com/taoliu/MACS | Finding regions of ChIP enrichment over control | |
| BEDTools 2.25 | [18] http://bedtools.readthedocs.io/en/latest/ | Genome arithmetics | |
| bedGraphToBigWig | http://hgdownload.cse.ucsc.edu/admin/exe/ | Converting bedGraph file into bigwig | |
| IGV browser 2.3.58 | [19] http://software.broadinstitute.org/software/igv/ | Visualization and browsing of significant ChIP-seq peaks | |
| Microsoft Excel | Spreasheet program | ||
| ENCODE's blacklist | https://sites.google.com/site/anshulkundaje/projects/blacklists | Filtering peaks | |
| mm10.chrom.sizes | http://hgdownload.cse.ucsc.edu/goldenPath/mm10/bigZips/mm10.chrom.sizes. | Converting bedGraph file into bigwig | |
| ENCODE's motif database | [25] http://compbio.mit.edu/encode-motifs/ | Comprehensive motif database required for motif enrichment | |
| MEME-ChIP | [20] http://meme-suite.org/index.html | Motif enrichment analysis and motif discovery | |
| Primer names used for qPCR | Primer sequences used for qPCR | ||
| Mbp-F: | CTATAAATCGGCTCACAAGG | ||
| Mbp-R: | AGGCGGTTATATTAAGAAGC | ||
| Iba1-F: | ACTGCCAGCCTAAGACAACC | ||
| Iba1-R: | GCTTTTCCTCCCTGCAAATCC | ||
| Mog-F: | GGCTTCTTGGAGGAAGGGAC | ||
| Mog-R: | TGAATTGTCCTGCATAGCTGC | ||
| GAPDH-F | ATGACATCAAGAAGGTGGTG | ||
| GAPDH-R | CATACCAGGAAATGAGCTTG | ||
| Tuj1-F | TTTTCGTCTCTAGCCGCGTG | ||
| Tuj1-R | GATGACCTCCCAGAACTTGGC | ||
| PDGFRα-F | AGAGTTACACGTTTGAGCTGTC | ||
| PDGFRα-R | GTCCCTCCACGGTACTCCT |
References
- Wu, J. Q., et al. Tcf7 is an important regulator of the switch of self-renewal and differentiation in a multipotential hematopoietic cell line. PLoS Genet. 8 (3), e1002565 (2012).
- Zuchero, J. B., Barres, B. A. Intrinsic and extrinsic control of oligodendrocyte development. Curr Opin Neurobiol. 23 (6), 914-920 (2013).
- Liu, Z., et al. Induction of oligodendrocyte differentiation by Olig2 and Sox10: evidence for reciprocal interactions and dosage-dependent mechanisms. Dev Biol. 302 (2), 683-693 (2007).
- Dong, X., et al. Comprehensive Identification of Long Non-coding RNAs in Purified Cell Types from the Brain Reveals Functional LncRNA in OPC Fate Determination. PLoS Genet. 11 (12), e1005669 (2015).
- Hilgenberg, L. G., Smith, M. A. Preparation of dissociated mouse cortical neuron cultures. J Vis Exp. (10), e562 (2007).
- Emery, B., Dugas, J. C. Purification of oligodendrocyte lineage cells from mouse cortices by immunopanning. Cold Spring Harb Protoc. 2013 (9), 854-868 (2013).
- Cahoy, J. D., et al. A transcriptome database for astrocytes, neurons, and oligodendrocytes: a new resource for understanding brain development and function. J Neurosci. 28 (1), 264-278 (2008).
- Zhang, Y., et al. An RNA-sequencing transcriptome and splicing database of glia, neurons, and vascular cells of the cerebral cortex. J Neurosci. 34 (36), 11929-11947 (2014).
- Cheng, X., et al. Bone morphogenetic protein signaling and olig1/2 interact to regulate the differentiation and maturation of adult oligodendrocyte precursor cells. Stem Cells. 25 (12), 3204-3214 (2007).
- Bolger, A. M., Lohse, M., Usadel, B. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics. 30 (15), 2114-2120 (2014).
- Langmead, B., Salzberg, S. L. Fast gapped-read alignment with Bowtie 2. Nat Methods. 9 (4), 357-359 (2012).
- Li, H., et al. The Sequence Alignment/Map format and SAMtools. Bioinformatics. 25 (16), 2078-2079 (2009).
- Heinz, S., et al. Simple combinations of lineage-determining transcription factors prime cis-regulatory elements required for macrophage and B cell identities. Mol Cell. 38 (4), 576-589 (2010).
- Team, R. C. A language and environment for statistical computing. R Foundation for Statistical Computing. , (2015).
- Kharchenko, P. V., Tolstorukov, M. Y., Park, P. J. Design and analysis of ChIP-seq experiments for DNA-binding proteins. Nat Biotechnol. 26 (12), 1351-1359 (2008).
- Zhang, Y., et al. Model-based analysis of ChIP-Seq (MACS). Genome Biol. 9 (9), R137 (2008).
- Quinlan, A. R., Hall, I. M. BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics. 26 (6), 841-842 (2010).
- Robinson, J. T., et al. Integrative genomics viewer. Nat Biotechnol. 29 (1), 24-26 (2011).
- Bailey, T. L., et al. MEME SUITE: tools for motif discovery and searching. Nucleic Acids Res. 37 (Web Server issue), W202-W208 (2009).
- Sims, D., Sudbery, I., Ilott, N. E., Heger, A., Ponting, C. P. Sequencing depth and coverage: key considerations in genomic analyses. Nat Rev Genet. 15 (2), 121-132 (2014).
- Landt, S. G., et al. ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia. Genome Res. 22 (9), 1813-1831 (2012).
- Consortium, E. P. An integrated encyclopedia of DNA elements in the human genome. Nature. 489 (7414), 57-74 (2012).
- Mazzoni, E. O., et al. Embryonic stem cell-based mapping of developmental transcriptional programs. Nat Methods. 8 (12), 1056-1058 (2011).
- Kheradpour, P., Kellis, M. Systematic discovery and characterization of regulatory motifs in ENCODE TF binding experiments. Nucleic Acids Res. 42 (5), 2976-2987 (2014).
- Dugas, J. C., Tai, Y. C., Speed, T. P., Ngai, J., Barres, B. A. Functional genomic analysis of oligodendrocyte differentiation. J Neurosci. 26 (43), 10967-10983 (2006).
- Gilfillan, G. D., et al. Limitations and possibilities of low cell number ChIP-seq. BMC Genomics. 13, 645 (2012).
- Raskatov, J. A., et al. Modulation of NF-kappaB-dependent gene transcription using programmable DNA minor groove binders. Proc Natl Acad Sci U S A. 109 (4), 1023-1028 (2012).
- Cheneby, J., Gheorghe, M., Artufel, M., Mathelier, A., Ballester, B. ReMap 2018: an updated atlas of regulatory regions from an integrative analysis of DNA-binding ChIP-seq experiments. Nucleic Acids Res. , (2017).
- Yevshin, I., Sharipov, R., Valeev, T., Kel, A., Kolpakov, F. GTRD: a database of transcription factor binding sites identified by ChIP-seq experiments. Nucleic Acids Res. 45 (D1), D61-D67 (2017).
- Kulakovskiy, I. V., et al. HOCOMOCO: a comprehensive collection of human transcription factor binding sites models. Nucleic Acids Res. 41 (Database issue), D195-D202 (2013).
- Jain, D., Baldi, S., Zabel, A., Straub, T., Becker, P. B. Active promoters give rise to false positive ‘Phantom Peaks’ in ChIP-seq experiments. Nucleic Acids Res. 43 (14), 6959-6968 (2015).
- Gerstein, M. B., et al. Architecture of the human regulatory network derived from ENCODE data. Nature. 489 (7414), 91-100 (2012).
