여기에 우리가 현재 낮은 셀 chromatin immunoprecipitation (칩)를 수행 하 여 분석 하는 게놈 넓은의 바인딩을 oligodendrocyte 녹음 방송 요인 2 (Olig2) 심하게 정화 뇌 oligodendrocyte 선구자 세포 (OPCs) 하도록 설계 된 프로토콜 도서관 준비, 높은 처리량 시퀀싱 및 bioinformatic 데이터 분석.
포유류 세포에서 유전자 전사 genomic dna transcriptional 요인의 상호 작용에 의해 세포 유형 특정 방식으로 통제 된다. 계보 특정 녹음 방송 요인은 셀 사양 및 분화 개발 과정에 필수적인 역할을 간주 됩니다. 높은 처리량 DNA 연속 (칩 seq)와 결합 하는 칩은 genomic dna 녹음 방송 요인 (또는 그것의 관련 된 복잡 한)의 게놈 넓은 바인딩 사이트를 분석 하 널리 이용 된다. 그러나, 많은 세포는 하나의 표준 칩 반응, 어려운 고립 된 1 차 셀 또는 희귀 세포 인구 제한 수를 공부 하는 필요 합니다. Oligodendrocyte 계보 관련 전사의 규제 메커니즘을 이해 하기 위해서는 요소 Olig2 심하게 순화 마우스 OPCs Olig2 (또는 Olig2 복잡 한)의 게놈 넓은 바인딩 사이트 식별 칩 seq를 사용 하 여 상세한 방법에에서 표시 됩니다. 프로토콜 혈소판 파생 된 성장 인자 수용 체 알파 (PDGFRα)를 정화 하는 방법을 설명 하는 첫째, 긍정적인 OPCs 마우스 두뇌에서. 다음, Olig2 항 체 칩을 중재 하 고 도서관 건설 수행 됩니다. 마지막 부분 bioinformatic 소프트웨어 및 Olig2 칩 seq 분석에 사용 되는 절차에 설명 합니다. 요약 하자면,이 종이 심하게 정화 뇌 OPCs transcriptional 요소 Olig2의 게놈 넓은 바인딩 분석 하는 방법을 보고 합니다.
단백질 (또는 복잡 한 단백질)을 공부 하는 것이 중요 하다 DNA 바인딩 및 후 성적인 부호 다양 한 생물학 과정에서 포함 된 transcriptional 규제 네트워크 구축. 특히, 게놈 dna 녹음 방송 요인의 바인딩 유전자 규칙, 세포 분화와 조직 개발에 중요 한 역할을 재생할 수 있습니다. 공부는 transcriptional 규칙 및 epigenetic 메커니즘에 대 한 강력한 도구 chromatin immunoprecipitation (칩)입니다. 차세대 시퀀싱 기술에 있는 급속 한 전진 때문 칩 (칩 seq) 연속 높 처리량 DNA와 결합 하 여 단백질-DNA 바인딩 및 epigenetic 마크1의 분석에 사용 됩니다. 그러나, 표준 칩 seq 프로토콜 셀 수는 고립 된 1 차 셀 등 희귀 세포 인구 제한 때이 기술의 응용 프로그램 어려운 반응 당 약 20 백만 셀을 필요 합니다.
Oligodendrocyte 계보 세포 oligodendrocyte 선구자 세포 (OPCs)와 oligodendrocytes를 포함 하 여 두뇌를 통해 널리 배포 하 고 개발 및 뇌의 기능에 필수적인. 선구자 세포의 유형으로 OPCs 자체 갱신와 차별화 할 수 있다. OPCs는 창시자 oligodendrocytes에 대 한 역할 뿐만 아니라 또한 뇌 세포2의 다른 종류와 통신 함으로써 신경 신호의 전파에 중요 한 역할. 이전 연구는 oligodendrocyte 개발 Olig2와 Sox103,4같은 계보 특정 녹음 방송 요인에 의해 통제 된다 제안 했다. 이 녹음 방송 요인 oligodendrocyte 사양과 차별화 하는 동안 그들의 표정에 영향을 몇 가지 중요 한 유전자의 발기인 또는 증강 인자 영역에 바인딩할 발견 됐다. 그러나, DNA 바인딩 단백질 (또는 복잡 한 단백질) 심하게 정화 기본 OPCs 셀의 매우 제한 된 수의 식별 하는 도전입니다.
이 프로토콜 Olig2 순화 마우스 OPCs 칩 seq 기술을 사용 하 여 게놈 넓은 규모에 의해 게놈 DNA immunoprecipitated를 체계적으로 조사 하는 방법을 설명 합니다. 마우스 두뇌에서 OPCs 심하게 immunopanning에 의해 정화 되었고 확산 체 외없이 칩 실험에 사용. 제한 된 수의 OPCs immunopanning에 의해 얻어질 수 있다 그리고 표준 칩 seq 실험에 대 한 충분 하지 않습니다. 여기, 낮은 셀 칩 seq 프로토콜은 낮은 녹음 방송 요인에 대 한 칩 반응 당 20 천 셀으로 설명 되어 있습니다. 간단히, 교차 연결 된 셀 lysed 되었고 sonicated 쥡니다 장치는 chromatin를 전단 하 여. 깎인된 chromatin Olig2 바인딩된 항 체 게놈 DNA를 침전 하는 코팅 구슬 Olig2 항 체와 단백질 incubated 했다. 단백질 A 코팅 구슬 및 역방향 cross-linking에서 차입, 후 genomic DNA Olig2 항 체에 의해 시 켰 던 페 놀-클로 프롬 적 출에 의해 순화 되었다. 결과 제품 계량은 T-미행을 복종, 뇌관 어 닐 링 템플릿 전환 및 확장, 어댑터 및 증폭, 라이브러리 크기 선택 및 정화의 추가 칩 seq 도서관 건축을 위한 단계.
시퀀싱, 후 샘플 Olig2 전사 인자 항 체와 준비와 컨트롤 샘플에서 원시 읽기의 품질 분석 했다. 낮은 품질의 기본적인 쌍 어댑터 포함 된 읽기 조각 손질 했다. 다음, 트림 읽기 마우스 참조 게놈에 정렬 했다. 컨트롤 샘플에 비해 칩 읽기 봉우리로 검색을 위한 농축 크게 했다 게놈 영역입니다. 중요 한 봉우리, 대표 하는 잠재적인 전사 인자 바인딩 사이트 필터링 되었고 게놈 브라우저에 시각.
특히,이 프로토콜에서 설명 하는 방법은 모든 셀 종류 제한 된 숫자의 다른 녹음 방송 요인의 칩 seq에 광범위 하 게 사용할 수 있습니다.
포유류 유전자 조절 네트워크는 매우 복잡 합니다. 칩 seq 게놈 넓은 단백질 DNA 상호 작용을 조사 하는 강력한 방법입니다. 이 프로토콜 Olig2 칩 seq (반응 당 20 천 셀 낮은) 마우스 두뇌에서 순화 OPCs의 낮은 수를 사용 하 여 수행 하는 방법을 포함 합니다. 이 프로토콜에 대 한 첫 번째 주요 단계에서 PDGFRα 항 체와 immunopanning에 의해 마우스 두뇌 OPCs의 정화 이다. PDGFRα 코팅 접시 OPCs의 긍정적인 선택 O…
The authors have nothing to disclose.
JQW, XD, RCDD, 그리고 YY는 국립 연구소의 건강 R01 NS088353;에서 교부 금에 의해 지원 되었다 NIH 그랜트 1R21AR071583-01; Staman Ogilvie 기금-기념 헤르만 재단; UTHealth 뇌 이니셔티브와 CTSA UL1 TR000371; 그리고 텍사스 시스템 신경 과학 대학 Neurotechnology 연구소 (부여 #362469)에서 부여.
Reagent/ Equipment | |||
Banderiaea simplicifolia lectin 1 | Vector Laboratories | # L-1100 | |
Rat anti-PDGFRa antibody | BD Bioscience | # 558774 | |
Neural tissue dissociation Kit (P) | MACS Miltenyi Biotec | # 130-092-628 | |
Accutase | STEMCELL technologies | # 07920 | |
TRIzol | Thermo Fisher | # 15596026 | |
Anti-NG2 Chondroitin Sulfate Proteoglycan Antibody | Millipore | # AB5320 | |
Bioruptor Pico sonication device | Diagenode | # B01060001 | |
True MicroChIP kit | Diagenode | # C01010130 | |
Phenol:Chloroform:Isoamyl Alcohol (25:24:1, v/v) | Thermo Fisher | # 15593031 | |
NucleoSpin Gel and PCR Clean-Up kit | MACHEREY-NAGEL | # 740609 | |
Quant-iT PicoGreen dsDNA Assay Kit | Thermo Fisher | # P11496 | |
DNA SMART ChIP-Seq kit | Clontech Laboratories | # 634865 | |
Agencourt AMPure XP | Beckman Voulter | # A63880 | |
GlycoBlue | Thermo Fisher | # AM9516 | |
pico-green | Thermo Fisher | # P11496 | |
D-PBS | Thermo Fisher | # 14190-144 | |
SYBR Green master mix | Bio-Rad Laboratories | # 1725124 | |
DMEM/F12 | Fisher Scientific | # 11-320-033 | |
Penicillin-Streptomycin (P/S) | Fisher Scientific | # 15140122 | |
N-2 Supplement | Fisher Scientific | # 17502048 | |
B-27 Supplement | Fisher Scientific | # 17504044 | |
insulin | Sigma | # I6634 | Prepare 0.5 mg/ml insulin solution by dissolving 5 mg insulin in 10 ml water and 50 μl of 1 N HCl. |
Bovine Serum Albumin, suitable for cell culture (BSA) | Sigma | # A4161 | Prepare 4% BSA solution by dissolving 4 g BSA in 100 ml D-PBS and adjust the pH to 7.4 |
Fibroblast Growth Factor basic Protein, Human recombinant (bFGF) | EMD Millipore | # GF003 | |
HUMAN PDGF-AA | VWR | # 102061-188 | |
poly-D-lysine | VWR | # IC15017510 | Prepare 1 mg/ml poly-D-lysine solution by dissolving 10 mg poly-D-lysine in 10 ml water and dilute 100 times when using. |
Falcon Disposable Petri Dishes, Sterile, Corning, 100x15mm | VWR | # 25373-100 | |
Falcon Disposable Petri Dishes, Sterile, Corning, 150x15mm | VWR | # 25373-187 | |
HBSS, 10X, no Calcium, no Magnesium, no Phenol Red | Fisher Scientific | # 14185-052 | |
Trypan Blue | Stemcell Technologies | # 07050 | |
protease inhibitor cocktail | Sigma | # 11697498001 | |
Software | |||
FastQC | [10] http://www.bioinformatics.babraham.ac.uk/projects/fastqc/ | Obtaining quality control metrics of raw and trimmed reads | |
Trimmomatic 0.33 | [11] http://www.usadellab.org/cms/?page=trimmomatic | Trimming and filtering raw reads | |
GENCODE mm10 | ftp://ftp.sanger.ac.uk/pub/gencode/Gencode_mouse/release_M15/GRCm38.primary_assembly.genome.fa.gz | Mouse reference genome | |
Bowtie2 2.2.4 | [12] http://bowtie-bio.sourceforge.net/bowtie2/index.shtml | Aligning reads to a reference genome | |
SAMTools 1.5 | [13] http://samtools.sourceforge.net/ | Converting SAM file into BAM format | |
HOMER 4.9.1 | [14] http://homer.ucsd.edu/homer/ | Creating a tag directory and annotating enriched genomic regions with gene symbols | |
R 3.2.2 | [15] https://www.R-project.org/ | Programming scripts and running functions | |
SPP 1.13 | [16] https://github.com/hms-dbmi/spp | Creating a strand cross-correlation plot | |
MACS2 2.2.4 | [17] https://github.com/taoliu/MACS | Finding regions of ChIP enrichment over control | |
BEDTools 2.25 | [18] http://bedtools.readthedocs.io/en/latest/ | Genome arithmetics | |
bedGraphToBigWig | http://hgdownload.cse.ucsc.edu/admin/exe/ | Converting bedGraph file into bigwig | |
IGV browser 2.3.58 | [19] http://software.broadinstitute.org/software/igv/ | Visualization and browsing of significant ChIP-seq peaks | |
Microsoft Excel | Spreasheet program | ||
ENCODE's blacklist | https://sites.google.com/site/anshulkundaje/projects/blacklists | Filtering peaks | |
mm10.chrom.sizes | http://hgdownload.cse.ucsc.edu/goldenPath/mm10/bigZips/mm10.chrom.sizes. | Converting bedGraph file into bigwig | |
ENCODE's motif database | [25] http://compbio.mit.edu/encode-motifs/ | Comprehensive motif database required for motif enrichment | |
MEME-ChIP | [20] http://meme-suite.org/index.html | Motif enrichment analysis and motif discovery | |
Primer names used for qPCR | Primer sequences used for qPCR | ||
Mbp-F: | CTATAAATCGGCTCACAAGG | ||
Mbp-R: | AGGCGGTTATATTAAGAAGC | ||
Iba1-F: | ACTGCCAGCCTAAGACAACC | ||
Iba1-R: | GCTTTTCCTCCCTGCAAATCC | ||
Mog-F: | GGCTTCTTGGAGGAAGGGAC | ||
Mog-R: | TGAATTGTCCTGCATAGCTGC | ||
GAPDH-F | ATGACATCAAGAAGGTGGTG | ||
GAPDH-R | CATACCAGGAAATGAGCTTG | ||
Tuj1-F | TTTTCGTCTCTAGCCGCGTG | ||
Tuj1-R | GATGACCTCCCAGAACTTGGC | ||
PDGFRα-F | AGAGTTACACGTTTGAGCTGTC | ||
PDGFRα-R | GTCCCTCCACGGTACTCCT |