Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Developmental Biology

Vorbereitung, Entwicklung von peripheren olfaktorische Gewebe für Molekulare und immunhistochemische Analysen in Drosophila

doi: 10.3791/57716 Published: June 13, 2018

Summary

Hier präsentieren wir Ihnen ein Protokoll zur Bühne und sezieren, olfaktorische Gewebe von Drosophila -Arten zu entwickeln. Das sezierte Gewebe kann später für Molekulare Analysen, wie quantitative RT-PCR (Reverse Transkription-Polymerase Chain Reaction) oder RNA Sequenzierung (RNAseq), sowie in-Vivo -Analysen wie Immunohistochemistry oder in Situ verwendet werden Hybridisierung.

Abstract

Das olfaktorische System von Drosophila ist ein weit verbreitetes System in Entwicklungsneurobiologie, Systeme Neurowissenschaften sowie Neurophysiologie, Verhalten und Verhaltensstörungen Evolution. Drosophila olfaktorische Gewebe beherbergen die olfaktorischen Rezeptor Neuronen (ORNs), die flüchtigen chemischen Signale neben Hydro und Thermo-sensorischen Neuronen zu erkennen. In diesem Protokoll beschreiben wir die Zerlegung des peripheren olfaktorische Gewebe von Erwachsenen Drosophila -Arten zu entwickeln. Wir beschreiben zuerst zu inszenieren und Drosophila Larven, gefolgt von der Dissektion der riechzentrum Scheibe aus frühen pupal Stadien, gefolgt von der Dissektion der Antennen ab Mitte pupal Stadien und Erwachsene Alter. Wir zeigen auch Methoden wo Vorbereitungen können Molekulare Techniken, wie die RNA-Extraktion für qRT-PCR, RNAseq oder Immunhistochemie eingesetzt werden. Diese Methoden können auch auf andere Drosophila -Arten angewendet werden, nachdem artspezifische pupal Entwicklungszeiten bestimmt sind und jeweiligen Etappen sind für entsprechende Aging berechnet.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Das olfaktorische System der Drosophila ist verbreitetes System in Entwicklungsneurobiologie, Systeme Neurowissenschaften sowie Neurophysiologie Verhalten Studien und Verhaltensstörungen Evolution1,2,3, 4. Drosophila olfaktorische Gewebe beherbergen die olfaktorischen Rezeptor Neuronen (ORNs), die flüchtigen chemischen Signale neben Hydro und Thermo-sensorischen Neuronen1,5,6zu erkennen. Das übergeordnete Ziel dieser Handschrift soll veranschaulichen, wie Bühne und sezieren pupal und Erwachsenen olfaktorische Gewebe in Drosophila -Arten zu entwickeln. Die Gründe für diese Technik ist es, Proben von verschiedenen pupal Stadien für Entwicklungsbiologie und Molekulare Analysen des peripheren olfaktorischen Systems, wie RNAseq und quantitative RT-PCR, zusätzlich zu in Vivo Gewebe Kennzeichnung Techniken erzeugt . Diese Technik ist besonders hilfreich zur Dynamik der transcriptional Profile im entwickelnden Erwachsenen olfaktorischen System von nicht-Drosophila Melanogaster Spezies zu identifizieren, die nicht über die transgenen Reagenzien für Zelltyp spezifische verfügen Kennzeichnung und Analysen. In diesem Manuskript demonstrieren wir riechzentrum Scheiben und Antennen von pupal und Erwachsenen Drosophila -Arten zu sezieren. Zunächst zeigen wir wie Drosophila 0 h der puppenkammer Formation (APF, weißen Puppen oder Prepupae) für Entwicklungsstörungen Inszenierung und artspezifische Alterung zu identifizieren. Als Nächstes zeigen wir wie Sie riechzentrum Scheiben und das dritte riechzentrum Segment zergliedern; speziell, wie man sie von Auge Scheibe und zweite riechzentrum Segment für die Gewebe-Reinheit erforderlich für RNAseq oder RT-PCR zu distanzieren. Die Stadien in D. Melanogaster beschrieben in diesem Protokoll etwa entsprechen die Pre-gemusterten riechzentrum Scheibe (Prepupae), die Auswahl von Vorläufern aus dem riechzentrum disc (8 h APF), Beginn der terminal Differenzierung für ORNs (40 h APF), und Erwachsenen-Antenne. Zu guter Letzt geben wir Beispiele für eine quantitative RT-PCR von Erwachsenen Antennen isoliert mit der Methode und für in Vivo Immunohistochemistry. Diese Methode kann verwendet werden, um Proben für eine RNA/DNA-Analyse und Immunohistochemistry auf die Entwicklung von peripherer olfaktorischer Gewebes von Drosophila -Arten zu generieren.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Das folgende Protokoll steht im Einklang mit der Ethikrichtlinien von der Duke University Research Ethikkommission.

(1) Gewebe Vorbereitung und Entwicklungsstörungen Inszenierung von Drosophila Melanogaster Puppe

  1. Zunächst ermitteln Sie, wie viele fliegen die Dissektion erforderlich ist. Für RT-PCR und RNAseq sammeln Sie 100-200 riechzentrum Scheiben und Antennen von Einzelpersonen, die auf prepupal, 8 h APF, 40 h APF, und Erwachsenen Phasen notwendig sind. Immunohistochemistry sind 10 bis 20 einzelnen zu sezieren.
  2. Reinigen Sie alle Materialien, einschließlich Dissektion Pads und Zangen, mit Tüchern mit 70 % EtOH. Wenn das sezierte Material soll für RNA-Extraktion verwendet werden, sauber alles mit RNase Neutralisierer und machen alle Lösungen mit Hilfe einer Nuklease-frei oder Diethyl-Pyrocarbonate (DEPC) Wasser behandeltes.
    Hinweis: Dieses Protokoll verwendet Silikon-Dissektion-Pads anstelle von Glas für die Sektionen. Silikon-Pads sind freundlich zu Ultra-feine Pinzette und fördern schnelle und qualitativ hochwertige Sezierungen.
  3. Puppe um 0 Uhr APF/prepupal Bühne zu sammeln.
    1. Um die genauesten Inszenierung zu gewährleisten, überwachen Sie die Larven bei 30 min bis 1 h-Intervallen.
      Hinweis: Wandernde dritte Instar-Larven in einer mäßig voll Flasche werden wahrscheinlich innerhalb von ein paar Stunden verpuppen.
    2. Sobald die Larven unbeweglich und von einem sehr hellen (fast weiß) farbige pupal Fall umgeben sind, übertragen Sie sie in einer kleinen 2 - In Petrischale mit einem feuchtem Filterpapier.
    3. Fahren Sie für ca. 1-2 h, gelegentlich Überwachung, Ermittlung und Übertragung von Prepupae.
      Hinweis: Alternativ deaktivieren Sie eine Flasche alle Puppen und ermöglichen Sie die Larven für 2 h zu entwickeln. Alle Puppen gesammelt nach 2 h Reichweite 0 - 2 h APF werden.
  4. Sofort fahren Sie mit Schritt 3.1 prepupal riechzentrum Scheibe für 0 h APF Bühne zu sezieren. Soll die Prepupa Jahre alt sein, sammeln Sie sie in eine Schüssel, bedecken Sie die Schüssel und legen Sie einen Paraffin-Film an den Rändern zu Trockenheit hemmen und legen Sie die Petrischale bei 25 ° C.
    Hinweis: Die Puppen können jetzt bewegungsapparate gealtert werden.
  5. Die Prepupae für 2 h weniger als das gewünschte Alter Alter für Puppen gesammelt in einem 2 h-Bereich, um sicherzustellen, dass die Puppen nicht Überdosierung.
  6. Verwendung ultrafeiner Zange (Dumont 55) als das Gewebe ist sehr klein und zerbrechlich.

(2) Gewebe Vorbereitung und Entwicklungsstörungen Inszenierung der Puppe von anderen Drosophila -Arten

  1. Bestimmen Sie die Länge der pupal Entwicklung in anderen Drosophila -Arten, legen Sie die Proben bei der optimalen Temperatur, erfassen die Termine bei Prepupae beobachtet werden, Sortieren Sie sie in ein frisches Fläschchen und notieren Sie die Anzahl der Tage vom Prepupa bis zum Erwachsenenalter.
  2. Das Verhältnis von Zeit für pupal Entwicklung für nicht-Melanogaster Arten und Melanogasteraufzeichnen. Multiplizieren Sie das Verhältnis der Entwicklungszeit durch die Anzahl der Stunden für die Inszenierung Melanogaster verwendet, um die Anzahl der Stunden, die nicht-Melanogaster Arten Alter zu erhalten.

(3) sezieren von D. Melanogaster Pupal Riechzentrum Disc

Hinweis: Die Zeiten und Dissektion Protokolle sind beschrieben für Drosophila Melanogaster. Für alle anderen Arten wird eine Änderung des Protokolls Altern basierend auf artspezifische Entwicklungszeit Punkten erforderlich sein, wie oben beschrieben.

  1. Für pupal riechzentrum Scheibe Sezierungen sammeln Sie 50-100 0 - 2 h oder 6-8 h alten Puppen mit einem Spatel zu und legen Sie sie auf eine Dissektion Pad.
  2. Pipette 150 µL RNA-Isolierung-Lösung in eine RNase frei 1,5 mL Microfuge Rohr mit einer 200-µL Pipette und das Rohr auf Eis.
  3. Zerlegen Sie die Puppen in 150-200 µL 1 X PBS (Phosphat gepufferte Kochsalzlösung, Nuklease-frei). Legen Sie mehrere Tropfen von PBS (150-200 µL pro Tropfen) auf die Dissektion.
  4. Auf dem Pad Dissektion Ort 0 - 2 h oder 6-8 h im Alter Puppen (eine Puppe pro Tropfen), um in eines der 1 x PBS Tröpfchen zerlegt werden. Verwenden Sie Zange in der Hand, den Körper stabilisieren.
  5. Für 0 - 2 h im Alter von Puppen, mit Pinzette in der anderen Hand, halten auf, die am vorderen Teil (der Mund Haken) die Prepupa und ziehen Sie es heraus, das Gehirn und die imaginalen Scheiben befestigt auf den vorderen pupal Fall aussetzen.
  6. Für die 8 h-APF-Puppen zuerst sanft Abziehen der pupal Fall vom am vorderen Viertel der Puppe, Freilegung der Kopf innerhalb der Membran Plünderung, die den Körper umgibt.
    Hinweis: Der Körper sieht in diesem Stadium wie ein degenerierenden Larve.
  7. Entfernen Sie den Kopf auf dem Hals.
    Hinweis: Dadurch wird sichergestellt, dass die riechzentrum Scheiben nicht verloren gehen, werden die zu diesem Zeitpunkt in erster Linie auf die Sehlappen des Gehirns verbunden sind.
  8. Übertragen Sie das Gewebe mit den Gehirnen und die imaginalen Scheiben auf ein weiteres 1 x PBS Tröpfchen mit Zange oder einem 20-µL Pipette.
  9. Identifizieren Sie die Auge-riechzentrum Disc an das Gehirn an die Sehlappen angeschlossen. Mit Pinzette, die Auge-riechzentrum Scheibe trennen Sie das Gehirn und die pupal Fall. Auf einem neuen 1 x PBS Tröpfchen mit Zange oder einem 20-µL Pipette übertragen.
    Hinweis: Die prepupal Auge riechzentrum Disc ist ein flaches Gewebe. Jedoch werden durch die 8 h-Puppen, die Auge-Scheiben gedreht Schröpfen die riechzentrum Scheiben, die anterior das zentrale Gehirn sitzt.
  10. Schneiden Sie Zange das Gewebe an der Stelle der Verbindung zwischen dem Auge und das riechzentrum Scheibe. Mithilfe einer 20 µL Pipette vorsichtig sezierte Gewebe in der RNA Isolierung Lösung Reagenz übertragen. Die Menge der Flüssigkeit übertragen durch pipettieren einen Betrag so gering wie möglich zu minimieren.
  11. Wiederholen Sie, bis alle Puppen seziert worden.

4. Präparation der D. Melanogaster Mitte-pupal und Erwachsenen Antennen

Hinweis: Von 40 h APF, ist die Mehrheit der Metamorphose abgeschlossen, und die Erwachsenen Strukturen sichtbar sind, aber sind immer noch weiß und unscheinbar. An dieser Stelle Entwicklungszeit die Erwachsenen Antenne seine endgültige Gestalt angenommen hat aber nach wie vor ist transparent und die Mehrheit der olfaktorischen Rezeptoren, außer ein paar Ausdruck nicht angetreten.

  1. Für pupal riechzentrum Sezierungen sammeln Sie 50-100 Prepupae zu, wie in Schritt 1 beschrieben und Altern sie für 40 h bei 25 ° C.
  2. Pipettieren 150 µL RNA-Isolierung-Lösung in eine RNase frei 1,5 mL Microcentrifuge Schlauch mit einem 200-µL-pipettieren und das Rohr auf Eis.
  3. Legen Sie auf dem Pad Dissektion die Puppe sich in eines der 1 x PBS Tröpfchen seziert werden. Verwenden Sie Zange in der Hand, den Körper stabilisieren. Mit Pinzette in der anderen Hand, sanft Abziehen der pupal Fall vom am vorderen Viertel der Puppe, Freilegung der Kopf innerhalb der Membran Plünderung, die den Körper umgibt.
  4. Mit Pinzette, vorsichtig den Kopf schneiden Sie vom Rest des Körpers pupal indem der Körper mit einer Zange und abreißen der Kopf am Hals mit einem anderen Satz von Zangen ab. Übertragen Sie sanft den Kopf in ein anderes 1 x PBS Tröpfchen mit Pinzette. Pipette rauf und runter zum Reinigen Sie den Inhalt des Kopfes (Gehirn, etc.), eine klare Membran zu erhalten, mit denen die entwickelnden Drosophila Kopf umgeben.
    Hinweis: Bei 40-50 h APF, sind die Antennen zum Abschnitt anterior-die meisten der Membran verbunden. Sie werden für Dissektion ersichtlich werden, wenn der Inhalt des Kopfes mit pipettieren gelöscht werden.
  5. Trennen Sie die pupal Antennen mit Pinzette, die Membran. Trennen Sie die 2Nd -Segment der Antenne vom 3rd mit Pinzette Slice am segmentale Gelenk, da nur das Segment 3rd die olfaktorischen Rezeptor Neuronen beherbergen wird.
  6. Mithilfe einer 20 µL Pipette vorsichtig sezierte Gewebe in der RNA Isolierung Lösung Reagenz übertragen. Die Menge der Flüssigkeit übertragen durch pipettieren einen Betrag so gering wie möglich zu minimieren. Wiederholen Sie, bis alle Puppen seziert worden.
  7. Für Erwachsene riechzentrum Sezierungen sammeln Sie rund 50 Erwachsene und Altern sie für eine Woche nach dem bewegungsapparate.
    Hinweis: Der Ausdruck der olfaktorischen Rezeptor-Gene und andere Gene ihren Höhepunkt erreichen eine Woche nach bewegungsapparate. Die Erwachsenen sind für eine Woche, um biologisch relevante Gene mit niedrigen Fülle Protokolle oberhalb der Nachweisgrenze steigen sicher alt.
  8. Sezieren Sie für RNA-Extraktion fliegen während sie auf einen CO2 Pad noch lebendig sind. Behandeln Sie die CO2 -Pad mit RNase-Inhibitoren. Für die konfokale Bildgebung sezieren die fliegen auf eine Dissektion Pad 1 x PBS oder PBS + 0,2 % Triton.
  9. Legen Sie zuerst die Erwachsenen auf das CO2 Station Pad im Rahmen der Dissektion zu schlafen. Verwenden Sie auf dem CO2 Station Pad, mit Pinzette in der Hand, den Körper stabilisieren Zange in der anderen Hand, sanft ziehen/Kneifen Sie das dritte riechzentrum Segment aus der zweiten.
  10. Übertragen Sie die Antennen in einer RNA Isolierungslösung, mit der Pinzette auf die Antennen direkt in die Flüssigkeit legen. Wiederholen Sie, bis alle Erwachsenen seziert worden.
    Hinweis: Sicherstellen Sie, dass die Antennen in RNA Isolierungslösung untergetaucht sind. Die Antennen können auf der Seite der Röhre stecken bleiben. Dies bewirkt einen erhöhten Abbau der RNA, Verringerung der RNS-Qualität und Quantität.
  11. Direkt weiter zu den RNA-Extraktion oder platzieren Sie das Rohr bei-80 ° C für die Langzeitspeicherung.

(5) RNA Isolation aus seziert Gewebe

  1. Entfernen Sie alle Proben von-80 ° C Lagerung und tauen sie auf Eis.
  2. Kurz drehen Sie (5-6 s, ~ 6.000 x g) jede Probe um Material an der Unterseite des Rohres zu sammeln.
  3. Schleifen von jeder Probe mit einem autoklaviert Kunststoff Stößel und einem Elektromotor für 10 s auf dem Eis.
  4. Wiederholen Sie 5.2 und 5,3 4.
  5. Führen Sie die RNA-Extraktion mittels handelsüblichen Kits und des Herstellers-Protokolle für einen optimalen Ertrag.
  6. Führen Sie qRT-PCR mit im Handel erhältlichen Reagenzien und spezifische Primer gegen Gene des Interesses und des Herstellers Protokolle.
    1. Alle PCR Reaktionen mit den folgenden Bedingungen durchzuführen: Denaturierung 95 ° C für 10 min gefolgt von 40 Zyklen von 95 ° C für 15 s, 55 ° C für 30 s und 60 ° C für 30 s.
      Hinweis: Primer-Paaren für DIP und Dpr -Gene sind in Tabelle 1aufgeführten und Primer für olfaktorische Rezeptor-Gene sind in Hueston CE Et al. 8.

6. Fixierung des Pupal Riechzentrum Scheiben und Antennen für immunhistochemische

Hinweis: Beheben des Gewebes in Chargen von 10-20 Personen, um sicherzustellen, dass das Gewebe für die gleiche Menge an Zeit behoben werden. Minimieren Sie die Zeit, die die Proben in PBT (PBS mit Reinigungsmittel) zu bleiben, vor der Übertragung auf ein Fixiermittel, die Integrität des Gewebes zu maximieren.

  1. Sammeln-Röhren seziert riechzentrum Scheiben oder pupal Antennen in einer 200-µL-PCR-Röhrchen mit 200 µL 0,2 % PBT auf Eis, Gewebe Integrität zu wahren, und die Probe klebt an der Wand von 200 µL PCR zu vermeiden führt zu einem unvollständigen Fixierung.
    Hinweis: Pupal Antennen und riechzentrum Scheiben können schwierig sein, zu sehen, wie sie ziemlich durchscheinend sind. Es ist ratsam, einen Dissektion Bereich für alle Waschschritte verwenden, um den Verlust des Gewebes zu verhindern. Alternativ können 96-Well Terasaki Platten Färbung, das Gewebe am besten zu verfolgen und zur Fixierung verwendet werden.
  2. Befestigen Sie den seziert riechzentrum Scheibe und riechzentrum Proben von Puppen in etwa 200 µL von 4 % PFA (Paraformaldehyd) für 30 min bei Raumtemperatur. Für diese und die folgenden Schritte, halten Sie die Rohre mit den Proben auf eine Nutator, die Proben in die Lösung richtig zu mischen. Fortschritt zu Schritt 6,7.
  3. Für die Erwachsenen Antenne den ganzen Kopf zuerst zu sezieren und fix it in rund 200 µL 4 % PFA (Paraformaldehyd) für 1 h bei Raumtemperatur.
  4. Waschen 3 X mit 200 µL 0,2 % PBT für 10 Minuten. Halten Sie die Proben auf die Nutator während der Inkubation.
  5. Zurück zur Dissektion Mikroskop für eine feinere Zergliederung des zweiten riechzentrum aus den festen Köpfen. Verwendung von Zangen, stabilisieren den Kopf sanft ziehen/Kneifen Sie das dritte riechzentrum Segment aus der zweiten.
  6. Übertragen Sie seziert dritten riechzentrum Segmente in etwa 200 µL 4 % PFA (Paraformaldehyd) und für 30 min bei Raumtemperatur zu beheben.
  7. Waschen 3 X mit 200 µL 0,2 % PBT für 10 Minuten. Halten Sie die Proben auf die Nutator während der Inkubation.
  8. Lagern Sie die Proben bei 4 ° C oder fahren Sie direkt mit ganzen Berg Immunohistochemistry.
    Hinweis: Die Effizienz der Färbung möglicherweise ändern, wenn der Antikörper verwendet wird. Diese Methode sollte angemessen für weniger reichlich Protein Tags oder schwächere Antikörper. Erfordern jedoch möglicherweise manchmal es eine Optimierung des Protokolls (die Identität oder Menge an das Fixiermittel oder dem Zeitpunkt der Fixierung).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Die sezierte entwickelnde olfaktorische Gewebe kann für die RNA-Extraktion, gefolgt von RT-PCR verwendet werden, um die Genexpression zu beurteilen oder kann durch Immunohistochemistry Protokolle zu bestimmen, die Muster des Ausdrucks und der subzellulären Lokalisierung der Gene eingenommen werden Interesse. In diesem Abschnitt präsentieren wir Ihnen repräsentative Ergebnisse aus beiden Protokoll. Abbildung 1 ist der Vertreter quantitative RT-PCR die Transkription der Zelle Oberfläche Rezeptor und olfaktorischen Rezeptor-Gene in Wildtyp adult Antennen zeigen. Abbildung 2 zeigt die 6-8 h und 12 h APF riechzentrum Scheibe Färbungen auf Rn-EGFP transgenen fliegt mit Anti-GLP (1: 1000) und Anti-lamin Antikörper (1: 100) (Abb. 2A und 2 b). RN-EGFP Etiketten bestimmte Regionen in das riechzentrum Bandscheibe während frühen pupal Stadien. Wir zeigen auch 40 h APF pupal riechzentrum Anti-GFP Antikörper Färbung des Or67d-GAL4 UAS-CD8GFP transgene fliegen, und Erwachsene riechzentrum Anti-ilav (1: 100) Antikörper Färbung des ORNs (Abbildung 2). Weitere Beispiele finden auch in der Literatur7,8,9,10.

Figure 1
Abbildung 1 . Quantitative RT-PCR von Wildtyp adult riechzentrum RNA-Proben für verschiedene Gene. Diese Tafeln zeigen quantitative RT-PCR-Ergebnisse für (A) DIP-Alpha, dpr5, dpr8, Kug, DIP-Eta, BeatIIIb (Primer Paare siehe Tabelle 1), und (B) olfaktorische und Ionotropic Rezeptor (oder / Ir) Gene von Erwachsenen riechzentrum RNA-Proben. Die Fehlerbalken zeigen einen Standardfehler von Mittelwert (SEM). Oder / Ir Gene sind niedrige Fülle RNAs, die noch durch qRT-PCR nachgewiesen werden können. Der Ausdruck jedes Gen wurde in dreifacher Ausfertigung analysiert. CT-Werte wurden verwendet, um den Verdünnungsfaktoren für jedes Gen Standardkurven erstellt für jedes Gen auf der Grundlage zu berechnen. Die Verdünnungsfaktoren wurden dann für jedes Gen die durchschnittliche Ausdruck aller Gene gemessen wie vor8beschrieben normalisiert. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 2
Abbildung 2 . Mit verschiedenen Antikörpern auf die Entwicklung von olfaktorischen Gewebe Immunohistochemistry. Diese Tafeln zeigen Anti-GLP (grün) und Anti-lamin (rot) Antikörper Färbungen auf (A) 6 h APF pupal riechzentrum Scheiben und (B) 12 h APF pupal riechzentrum Scheiben. (C) dieses Panel zeigt einem 40 h APF Antenne aus Or67d GAL4 UAS-CD8GFP gentechnisch veränderten Pflanzen mit Kaninchen Antikörper Anti-GLP (grün) angefärbt. (D) zeigt dieses Panel Erwachsenen Antennen gebeizt mit Anti-CD2-Antikörpern, welche Label Or47b-CD2 positiven ORNs (Magenta). Bitte klicken Sie hier für eine größere Version dieser Figur.

Forward primer Rückwärts-primer Länge
CGGAGAGGAGGTTATGAGCA GGAAGTGCACAACTAGCGTT 143
CGCGAATCGTTGTGTCAGTA TGTCGATAGCGTGAACCTGA 129
AGGAGTGGACGTTGAGTTACA CAATCATGTCCTCGTGACCG 146
TAGAGTCCGAGCAGCAGATG GTCAGAATTCGAGTTGTCCGC 104
GGCGCTAAGTAGCAGGACG GGCCAAGTCTGTTTGTGAGG 215
TAAGACCCTAGCGCCCTCTT AGGGAGATGCGCTTTGAGAC 129

Tabelle 1. Liste der PCR Zündkapseln in qRT-PCR eingesetzt.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Dieses Protokoll ist eine nützliche Ressource für Labs interessiert bei der Identifizierung der genetischen und transkriptionelle Programme bei der Entwicklung von Drosophila olfaktorische Gewebe sowie eine vergleichende Analyse dieser Programme in Drosophila Spezies. Es ist besonders nützlich, wenn Systemebene transcriptional Profile aus verschiedenen Entwicklungsstadien als Grundierung für zukünftige Studien erforderlich sind. Das hier beschriebene Protokoll veranschaulicht zu inszenieren und zu isolieren, Entwicklung von olfaktorischen Gewebe von Drosophila Proben aus vier Hauptphasen des olfaktorischen Systementwicklung vom Pre-Musterung zum terminal Differenzierung zu verwendenden erhalten Molekulare und immun-histologische Untersuchungen. Seziert Drosophila riechzentrum Scheiben und Antennen in verschiedenen pupal Stadien können gen expressionsprofile während der Entwicklung des olfaktorischen Systems auf der Systemebene durch RNA-Seq oder auf der Ebene einzelner Gene identifizieren mittels quantitativer RT-PCR verwendet werden. Proben können auch für die Immunhistochemie und in Situ Hybridisierung verwendet werden, in Vivo Muster der Gewebespezifischer Genexpression zu erkennen. Ein weiterer Vorteil dieses Protokolls ist, dass sezierte Proben können weitere, dissoziierten mit Standardmethoden und FAC-sortiert zu einer gereinigten zellularen Bevölkerung (oder einzelne Zellen) für Zelle Typ-spezifische Molekulare Analysen, wie quantitative RT-PCR oder RNAseq.

Obwohl das Protokoll Sezierungen riechzentrum Scheiben und Antennen von pupal (bei 0 h/Prepupa, 8 h und 40 h APF) und Erwachsenen Stadien zeigt, kann es zu anderen pupal Zeitpunkten angepasst werden. Es ist auch erwähnenswert, dass lernen diese Sezierungen Zeit und Übung braucht. Ein Experte sollte 50 Proben pro Stunde zerlegen können. Es ist wichtig, keine Überdosierung der Puppen. Daher, sicherstellen Sie eine Stunde vor Beginn der Dissektion, dass keine Puppen älter als das gewünschte Alter sind. Dissektionen können lernen, dauern also eine Praxis für jede Stufe erforderlich ist vor Beginn der Experimente. Sezierungen von 9-12 Uhr APF aufgrund von morphologischen Veränderungen schwieriger geworden. Es ist möglich, Puppen nach Alter sortieren beim Prepupae (durch Körperfarbe mit dunkleren Farben älter) zu sammeln. Sortieren zunächst Prepupae ermöglicht Dissektion in Reihenfolge des Alters, Überalterung zu verhindern.

Das oben beschriebene Protokoll kann auf andere Drosophila -Arten angewendet werden. Das Timing für die pupal Sezierungen anderer Arten kann basieren sowohl auf das Verhältnis der pupal Entwicklung einer bestimmten Spezies bei 25 ° C, D. Melanogaster und vergleichende Beobachtungen der Antennen/riechzentrum Scheibe Morphologie während Dissektionen, mit einem Priorität, morphologische Überlegungen so identisch wie möglich sein. Für Drosophila Melanogasterdauert das Puppenstadium etwa 4 Tage. D. melanogaster und D. Erecta pupal Entwicklungsstörungen Inszenierung ist ähnlich wie D. Melanogaster; D. Virilis pupal Entwicklung ist jedoch 1,3 x länger11,12. Wenn andere Arten für Dissektion vorbereitet werden, sollte die Inszenierung mit der morphologischen Ähnlichkeit wird die höchste Priorität auf die zeitliche Planung der pupal Periode und vergleichende Beobachtungen der Bühne-spezifischen Antennen/riechzentrum Scheibe Morphologie beruhen. Ermitteln Sie zuerst die optimale Handhabung Temperatur für die Arten, die, denen Sie interessieren. Viele Arten wachsen gut bei 25 ° C, aber detaillierte Informationen über Haltungsbedingungen kann der UC San Diego Drosophila -Arten Lager Mitte entnommen werden.

Die wichtigsten Schritte im Protokoll sind die richtige Inszenierung und richtige Präparation des Gewebes von Interesse in ausreichender Anzahl verschiedener Arten. Sobald diese vorhanden sind, wird das Protokoll bietet eine effiziente Methode der Gewebe-Sammlung für solche Analysen und während der pupal Stadien in irgendeiner Sorte Drosophila praktisch an jeder dritten imaginalen bandscheibengewebe angepasst werden kann.

Eine Einschränkung dieses Protokolls ist, dass es keine typspezifische Zellproben anbietet. Ein genaueres Verständnis der zellulären Funktion und Morphologie erfordert Zelle typspezifische Profilierung der Transkription Ebene Systeme, neben der molekularen Standardverfahren wie quantitative RT-PCR oder Immunohistochemistry. Zelle typspezifische Profilierung schwierig, vor allem angesichts des Mangels an Zelle typspezifische Reporter gentechnisch veränderten Pflanzen in nicht -Melanogaster Spezies gewesen. Mit den aktuellen Fortschritten in zellulären Profilierung gentechnisch veränderten Pflanzen und CRISPR-Cas9 vermittelten Genom-Bearbeitung in nicht-Melanogaster Arten, es ist nun möglich, beschriften und sortieren Sie Einzelzellen für Transkription13Profil von Interesse.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren haben nichts preisgeben.

Acknowledgments

Diese Studie wurde unterstützt durch ein Stipendium der National Science Foundation, Pelin C. Volkan (DEB-1457690).

Materials

Name Company Catalog Number Comments
10X Phosphate-buffered Saline Gibco 70011-044 Dilute to 1X in RNase free water
CO2 tank Air Gas CD R200
Two sharp forceps (Dumont #55) Fine Science Tools 11255-20
Trizol Invitrogen 15596-026 RNA isolation solutions
Dissecting Microscope
Small bucket with ice
P20 and P200 micropipettes and tips
1.7 mL Microfuge tubes Purchase nuclease free for best results
0.2 mL PCR tubes
Paraformaldehyde powder Polysciences 380
10% Triton X-100 Teknova T1105 Dilute to 0.2% v/v in 1X PBS
2" petri dishes
55mm filter paper Whatman 1001-055 Wet with water and place in a petri dish to keep pupae moist
25 C incubator
deionized H2O Purchase nuclease free or treat with DEPC
Sylgard 184 Silicone Elastomer Kit Dow Corning to be used for making dissection pads from Terizaki plate covers.
MicroWell Mini Trays with lids Nunc 438733 Lids can be used to make silicone dissection pads
Rabbit anti-GFP antibody MBL international corpor PM005 primary antibody
Mouse anti RAT CD2 AbD seroTec MCA154RHDL primary antibody
ADL195 (anti lamin, mouse) Dev studies hydoma ban ADL195-s primary antibody
Alexa Fluor® 488 goat anti-rabbit IgG (H+L) invitrogen A11008 Secondary antibody
Cy3 Goat Anti-Mouse IgG Jackson ImmunoResearch 115-166-003 Secondary antibody
Triton X-100, Protein Grade Detergent, 10% Solution, Sterile-Filtered CALBIOCHEM 648463 detergent
Lab Rotator Thermo scientific Rotator
Nuclease Free Water Growcells.com NUPW-0125 Water
Light-Duty Tissue Wipers VWR 82003-822 For cleaning dissection supplies
Superscript II invitrogen 18064014 Reverse Transcriptase 
QIAshredder (50) RNA extraction QIAGEN 79654
Oligo(dT)12-18 Primer RT life technologies 18418012
RNeasy MinElute Cleanup Kit (50) RNA extraction QIAGEN 74204
FASTSTART UNIV SG MASTER (5 ML)(500 RXN) qPCR Roche 04913850001
FASTSTART ESSENTIAL GREEN DNA MASTER  qPCR Roche 06402712001
LIGHTCYCLER 480 - MULTIWELL PLATE 96 qPCR Roche 04729692001
NEBNext High-Fidelity 2X PCR Master Mix qPCR NEB M0541S

DOWNLOAD MATERIALS LIST

References

  1. Barish, S., Volkan, P. C. Mechanisms of olfactory receptor neuron specification in Drosophila. Wiley Interdisciplinary Reviews. Developmental Biology. 4, (6), 609-621 (2015).
  2. Pan, J. W., Volkan, P. C. Mechanisms of development and evolution of the insect olfactory system. Cell and Developmental Biology. 2, 130 (2013).
  3. Ramdya, P., Benton, R. Evolving olfactory systems on the fly. Trends in Genetics. 26, (7), 307-316 (2010).
  4. Bellen, H. J., Tong, C., Tsuda, H. 100 years of Drosophila research and its impact on vertebrate neuroscience: a history lesson for the future. Nature Reviews Neuroscience. 11, (7), 514-522 (2010).
  5. Knecht, Z. A., et al. Distinct combinations of variant ionotropic glutamate receptors mediate thermosensation and hygrosensation in Drosophila. eLife. 5, 44-60 (2016).
  6. Enjin, A., et al. Humidity sensing in Drosophila. Current Biology. 26, (10), 1352-1358 (2016).
  7. Li, Q., Barish, S., Okuwa, S., Volkan, P. C. Examination of endogenous rotund expression and function in developing Drosophila. olfactory system using CRISPR-Cas9-mediated protein tagging. G3: Genes|Genomes|Genetics. 5, (12), 2809-2816 (2015).
  8. Hueston, C. E., et al. Chromatin modulatory proteins and olfactory receptor signaling in the refinement and maintenance of fruitless expression in olfactory receptor neurons. PLoS Biology. 14, (4), 1002443 (2016).
  9. Li, Q., et al. Combinatorial rules of precursor specification underlying olfactory neuron diversity. Current Biology. 23, (24), 2481-2490 (2013).
  10. Li, Q., et al. A functionally conserved gene regulatory network module governing olfactory neuron diversity. PLoS Genetics. 12, (1), 1005780 (2016).
  11. Pan, J. W., et al. Patterns of transcriptional parallelism and variation in the developing olfactory system of Drosophila species. Scientific Reports. 7, (1), 8804 (2017).
  12. Pan, J. W., et al. Comparative analysis of behavioral and transcriptional variation underlying CO2 sensory neuron function and development in Drosophila. Fly. 11, (4), 239-252 (2017).
  13. Stern, D. L., et al. Genetic and transgenic reagents for Drosophila simulans, D. mauritiana, D. yakuba, D. santomea, and D. virilis. G3: Genes|Genomes|Genetics. 7, (4), 1339-1347 (2017).
Vorbereitung, Entwicklung von peripheren olfaktorische Gewebe für Molekulare und immunhistochemische Analysen in <em>Drosophila</em>
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Barish, S., Volkan, P. C. Preparing Developing Peripheral Olfactory Tissue for Molecular and Immunohistochemical Analysis in Drosophila. J. Vis. Exp. (136), e57716, doi:10.3791/57716 (2018).More

Barish, S., Volkan, P. C. Preparing Developing Peripheral Olfactory Tissue for Molecular and Immunohistochemical Analysis in Drosophila. J. Vis. Exp. (136), e57716, doi:10.3791/57716 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter