Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Developmental Biology

주변 후 각 조직에 대 한 개발 준비 분자와 초파리 의 Immunohistochemical 분석

doi: 10.3791/57716 Published: June 13, 2018

Summary

여기, 우리는 무대와 초파리 종에서 후 각 조직 개발 해 부 프로토콜을 제시. 있으 나 해 부 조직 immunohistochemistry 또는 제자리에서 같은 비보에 분석 뿐만 아니라 양적 RT-PCR (반전 전사-연쇄 반응) 또는 시퀀싱 (RNAseq), RNA와 같은 분자 분석에 대 한 나중에 사용할 수 있습니다. 교 잡입니다.

Abstract

초파리 의 후 각 시스템 발달 신경 생물학, 시스템 신경 과학으로 신경 생리학, 행동과 행동 진화에 널리 사용 되는 시스템이입니다. 초파리 의 후 각 조직 집 수압 및 온도 감각 신경 이외에 휘발성 화학 신호를 감지 하는 후 각 수용 체 신경 (ORNs). 이 프로토콜에서 우리는 성인 초파리 종의 주변 후 각 조직 개발의 해 부를 설명 합니다. 우리는 처음 무대 초파리 애벌레, 중순에 번데기 단계와 성인에서 안테나의 해 부에 의해 따라 초기 번데기 단계에서 더듬이 디스크의 해 부를 이어서 나이 하는 방법을 설명 합니다. 우리는 또한 어디 준비 qRT-PCR, RNAseq, 또는 immunohistochemistry RNA 추출 등 분자 기법에 활용할 수 있는 방법을 보여줍니다. 이러한 방법은 적용할 수 있습니다 또한 다른 초파리 종 종의 번데기 개발 시간, 결정 하 고 각 단계는 적절 한 노화에 대 한 계산 됩니다.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

발달 신경 생물학, 시스템 신경 과학으로 신경 생리학, 행동 연구, 그리고 행동 진화1,2,3, 초파리 의 후 각 시스템은 널리 사용 되는 시스템 4. 초파리 의 후 각 조직 집 수압 및 온도 감각 신경1,,56외 휘발성 화학 신호를 감지 하는 후 각 수용 체 신경 (ORNs). 이 원고의 전반적인 목표는 무대 초파리 종의 번데기 및 성인 후 각 조직 개발 해 부 하는 방법을 보여 줍니다. 이 기술에 대 한 근거 또한 vivo에서 조직 기술 라벨 샘플 RNAseq 등 정량적 RT-PCR, 주변 후 각 시스템의 분자 및 발달 분석에 대 한 다른 번데기 단계에서 생성 하는 . 이 기술은 특정 세포 유형에 대 한 모든 유전자 변형 시 약 하지 않은 비-초파리 melanogaster 종 개발 성인 후 각 시스템에 transcriptional 프로필의 역학을 식별 하기 위해 특히 유용할 수 있습니다. 표시 하 고 분석입니다. 이 원고, 더듬이 디스크와 번데기 및 성인 초파리 종에서 안테나를 해 부하는 방법을 보여 줍니다. 첫째, 우리 개발 준비 및 종의 노화에 대 한 puparium 형성 (APF, 흰색 pupae 또는 prepupae)의 0 h 초파리 를 식별 하는 방법을 보여 줍니다. 다음, 우리에 게 보여 더듬이 디스크와 제 3 더듬이 세그먼트; 해 부 특히, 눈 디스크 및 RNAseq 또는 RT PCRs에 필요한 조직 순도 대 한 두 번째 더듬이 세그먼트에서 그들을 분리 하는 방법. 미리 무늬 더듬이 디스크 (prepupae)에 해당 하는 단계 D. melanogaster 약이 프로토콜에서 설명에서 일어나는 더듬이에서 선택 디스크 (8 h APF), ORNs (40 h APF)에 대 한 터미널 차별화의 시작 하 고 성인 안테나입니다. 마지막으로, 우리 성인 안테나 메서드를 사용 하 여 고립에서 그리고 vivo에서 immunohistochemistry 양적 RT-PCR에 대 한 예제는 줄. 이 메서드는 RNA/DNA 분석 및 immunohistochemistry 초파리 종에서 주변 후 각 조직 개발에 대 한 샘플을 생성 하기 위해 사용할 수 있습니다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

다음 프로토콜은 듀크 대학 연구 윤리 위원회에 의해 설립 된 윤리 지침과 일치.

1. 조직 준비와 초파리 melanogaster 번데기의 개발 준비

  1. 첫째, 얼마나 많은 파리 해 부 할 것입니다 확인 합니다. RT-PCR 및 RNAseq, prepupal, 8 h APF, 40 h APF, 및 성인 단계에서 필요한는 개인에서 100-200 더듬이 디스크와 안테나를 수집 합니다. Immunohistochemistry, 10-20 개인을 해 부.
  2. 해 부 패드와 집게, 물티슈를 사용 하 여 70%를 포함 하 여 모든 물자를 청소 EtOH. 해 부 물자는 RNA 추출에 사용할 수, RNase neutralizers와 모든 것을 깨끗이 nuclease 무료 사용 하는 모든 솔루션을 경우 diethyl pyrocarbonate (DEPC) 물 처리.
    참고:이 프로토콜은 해에 대 한 유리 대신 실리콘 해 부 패드 사용합니다. 실리콘 패드 초 미세 집게를 친절 하 고 신속 하 고 높은 품질의 해를 홍보.
  3. 0 h APF/prepupal 단계에서 번데기를 수집 합니다.
    1. 가장 정확한 준비 되도록 30 분 1 시간 간격에서 애벌레를 모니터링 합니다.
      참고: 적당히 붐비는 병에서 방황 하 고 세 번째 탈피 애벌레 몇 시간 pupate 가능성이 것입니다.
    2. 일단 애벌레 움직이지 되 고 매우 가벼운 (거의 흰색) 색된 번데기 케이스에 의해 포위 된다는 작은 2-페 트리 접시에 촉촉한 필터 종이 그들을 전송.
    3. 1-2 h, 때때로 모니터링, 확인, 및 prepupae 전송에 대 한 계속.
      참고: 또는 모든 pupae의 병을 취소 하 고 2 시간에 대 한 개발에 애벌레를 허용. 모든 pupae 수집 후 2 h 0-2 h APF 범위 안에 있을 것입니다.
  4. 즉시 prepupal 더듬이 디스크 0 h APF 무대에 대 한 해 부 3.1 단계로 이동 합니다. prepupa 세 수 하는 경우, 접시에 그들을 수집, 접시 커버와 건조, 억제 하기 위해 가장자리 주위 파라핀 영화 놓고 25 ° c.에 페 트리 접시를 놓고
    참고: 번데기 이제 일수로 하 세 수 있습니다.
  5. 2 h 범위에서 수집 하는 번데기에 대 한 번데기 하지 할 수 있도록 원하는 나이 보다는 더 적은 2 시간에 대 한 prepupae을 나이 없 더군요.
  6. 아주 작고 연약한 조직으로 초 미세 집게 (Dumont 55)를 사용 합니다.

2. 조직 준비 및 다른 초파리 종에서 번데기의 개발 준비

  1. 다른 초파리 종의 번데기 개발의 길이 확인 하려면 샘플 최적의 온도에서 prepupae은 관찰 날짜를 기록, 신선한 유리병으로 그들을 정렬 놓고 성인 기에 prepupa에서 일 수를 기록 합니다.
  2. 시간 번데기 개발에 대 한 비-melanogastermelanogaster의 비율을 기록 합니다. Melanogaster 준비에 대 한 비-melanogaster 종 나이에 시간 수를 사용 하는 시간의 수에 의해 개발 시간의 비율을 곱하면 됩니다.

3. D. melanogaster 번데기 더듬이 디스크의 해 부

참고: 모든 노화 시간 및 해 부 프로토콜 설명에 대 한 초파리 melanogaster. 위에서 설명한 대로 다른 모든 종족에 대 한 종의 발달 시간 포인트에 따라 노화 프로토콜의 필요 있을 것입니다.

  1. 번데기 더듬이 디스크 해에 대 한 50-100 0-2 h 또는 주걱을 사용 하 여 6-8 h 오래 된 번데기를 수집 하 고 해 부 패드에 그들을 배치.
  2. 무료 1.5 mL microfuge 200 µ L 피 펫을 사용 하 여 튜브와 튜브를 얼음 위에 RNase에 RNA 격리 솔루션의 150 µ L 플라스틱.
  3. 1 x PBS (인산 염 버퍼 식 염 수, nuclease 무료)의 150-200 µ L에 번데기를 해 부. 해 부 패드에 PBS (방울 당 150-200 µ L)의 여러 방울을 배치 합니다.
  4. 해 부 패드에서 PBS 방울 x 1 중에서 해 부 수를 0-2 h 또는 세 6-8 h 번데기 (한 번데기 드롭 당)을 놓습니다. 한 손에 집게를 사용 하 여 신체를 안정.
  5. 0-2 h pupae를 사용 하 여 다른 손에 잡고 집게에는 prepupa의 가장 앞쪽 부분 (입 고리)를 세 고 두뇌와 앞쪽 번데기 케이스에 부착 된 imaginal 디스크를 밖으로 당겨.
  6. 8 h APF pupae에 대 한 먼저 부드럽게 껍질 번데기, 시체를 둘러싸는 막 자루 내 머리를 노출의 가장 앞쪽 분기에서 번데기 케이스에서.
    참고: 몸,이 단계에서 처럼 보인다 악화 애벌레.
  7. 목 관절에서 머리를 제거 합니다.
    참고: 이렇게 하면 더듬이 디스크 손실 되지 것입니다이 단계에는 주로 뇌의 시 돌출부에 연결 되어.
  8. 두뇌와 imaginal 디스크 조직을 다른 1x PBS 방울 집게 또는 20 µ L 피 펫을 사용 하 여 전송.
  9. 광 엽에서 뇌에 연결 된 눈 더듬이 디스크를 식별 합니다. 집게를 사용 하 여, 두뇌와 번데기 케이스에서 눈 더듬이 디스크를 분리 합니다. PBS 방울 집게 또는 20 µ L 피 펫을 사용 하 여 x 새 1에 그것을 전송.
    참고: prepupal 눈 더듬이 디스크는 평평한 조직 이다. 그러나, 8 h pupae로 눈 디스크는 회전 컵 더듬이 디스크는 중앙 뇌 앞쪽에 앉아.
  10. 집게를 사용 하 여 눈과 더듬이 디스크 사이의 연결의 사이트에서 조직을 잘라. 20 µ L 피 펫을 사용 하 여 부드럽게 RNA 격리 솔루션 시 약으로 해 부 조직을 전송. 가능한 금액 pipetting으로 전송 하는 액체의 양을 최소화 합니다.
  11. 모든 pupae 해 부 될 때까지 반복 합니다.

4. D. melanogaster 중반-번데기 및 성인 안테나의 해 부

참고: 40 h APF, 대부분의 변 태 완료 되 면, 그리고 성인 구조, 명백한 되고있다 하지만 여전히 흰색 하 고 표현할 수 있다. 이 개발 시간이 시점에서 성인 안테나는 그것의 마지막 모양 아직 여전히 투명은 고 몇을 제외한 후 각 수용 체의 대부분 식 시작 하지 않았습니다.

  1. 번데기 더듬이 해에 대 한 1 단계에서 설명한 대로 50-100 prepupae를 수집 하 고 40 h 25 ° c.에 대 한 그들을 나이
  2. 피펫으로 150 µ L RNase 무료 1.5 mL microcentrifuge에 RNA 격리 솔루션의 200 µ L 피펫으로 사용 하 여 튜브와 튜브를 얼음 위에.
  3. 해 부 패드에서 PBS 방울 x 1의 하나로 해 부에 번데기를 놓습니다. 한 손에 집게를 사용 하 여 신체를 안정. 번데기는 시체를 둘러싸는 막 자루 내 머리를 노출의 가장 앞쪽 분기에서 번데기 케이스 벗기다 집게를 사용 하 여 다른 손에서 부드럽게.
  4. 집게를 사용 하 여, 조심 스럽게 잘라 번데기 시체의 나머지 부분에서 머리 집게의 1 세트를 가진 시체를 벗는 머리 목에 집게의 또 다른 세트와 함께 공동 하 여. 부드럽게 PBS 방울 집게를 사용 하 여 다른 1x로 머리를 전송 합니다. 머리 (뇌, )를 분명 막 개발 초파리 머리를 포위 하는 데 사용의 내용을 밖으로 청소를 위아래로 플라스틱.
    참고: 40-50 h APF, 안테나 막의 앞쪽 대부분 섹션에 연결 됩니다. 그들은 머리의 내용을 pipetting으로 지워집니다 때 해 부에 대 한 명백한 될 것입니다.
  5. 집게를 사용 하 여 막에서 번데기 안테나를 분리 합니다. 3에서 안테나의 2nd 세그먼트를 분리rd 3rd 세그먼트만 후 각 수용 체 신경 세포를 들어설 예정으로 단편 관절에서 슬라이스를 집게를 사용 하 여.
  6. 20 µ L 피 펫을 사용 하 여 부드럽게 RNA 격리 솔루션 시 약으로 해 부 조직을 전송. 가능한 금액 pipetting으로 전송 하는 액체의 양을 최소화 합니다. 모든 pupae 해 부 될 때까지 반복 합니다.
  7. 성인 더듬이 해 약 50 성인 수집 및 주 후 일수로 대 한 그들을 나이.
    참고: 후 각 수용 체 유전자의 표현과 다른 유전자 일수로 후 주 피크. 어른은 생물학으로 관련 유전자 검출 임계값 이상 상승 낮은 풍부 증명서를 위해 1 주일에 대 한 세.
  8. RNA 추출에 대 한 그들은 CO2 패드에 아직도 살아 있는 동안 파리의 해 부. RNase 억제제와 CO2 패드를 취급 합니다. Confocal 영상에 대 한 해 부 해 부 패드 PBS 또는 PBS + 0.2% x 1에서에 파리 트리톤.
  9. 첫째, 성인 절 개 범위에서 CO2 역 패드에 잘 넣어. 신체를 안정 시키기 위해 한 손에 집게를 사용 하 여 CO2 역 패드, 다른 한편에서 포 셉을 사용 하 여 두 번째에서 세 번째 더듬이 세그먼트 밖으로 부드럽게 당겨/핀치에.
  10. 집게를 사용 하 여 액체에 직접 안테나를 배치 하는 RNA 격리 솔루션에 안테나를 전송 합니다. 모든 성인 해 부 될 때까지 반복 합니다.
    주: 안테나 RNA 격리 솔루션에 잠긴 것을 확인 하십시오. 안테나는 튜브의 측면에 갇혀 될 수 있습니다. 이 RNA 품질 및 수량 감소는 RNA의 증가 저하가 될 수 있습니다.
  11. 직접 RNA 추출을 진행 하거나 장기 저장을 위한-80 ° C에서 튜브를 놓습니다.

5. RNA 격리 해 부 조직에서

  1. -80 ° C 저장소에서 모든 샘플을 제거 하 고 얼음에 녹여.
  2. 짧게 스핀 (5-6 s, ~ 6000 x g) 튜브의 하단에 있는 자료를 수집 하는 각 샘플.
  3. 10는 압력가 플라스틱 유 봉과 전기 모터를 사용 하 여 각 샘플을 갈아 얼음에 s.
  4. 5.2와 5.3 4 단계를 반복 합니다.
  5. RNA 추출 상용 키트를 사용 하 고 최적의 생산량에 대 한 제조 업체의 프로토콜을 다음을 수행 합니다.
  6. QRT-PCR 상용 시 약 및 제조 업체의 프로토콜에 따라 관심의 유전자에 대 한 특정 뇌관을 사용 하 여 수행 합니다.
    1. 다음과 같은 조건을 사용 하 여 모든 PCR 반응을 수행: 10 분 동안 95 ° C 변성 뒤 15 95 ° C의 40 주기 s, 55 ° C 30에 대 한 s, 그리고 60 ° C 30에 대 한 s.
      참고: dpr 유전자를 위해 뇌관 쌍 표 1에 나열 된 및 Hueston CE 에 후 각 수용 체 유전자를 위한 뇌관 나열 8.

6. 번데기 더듬이 디스크와 Immunohistochemistry에 대 한 안테나의 고정

참고: 시간이 같은 금액에 대 한 조직 고정 되도록 10-20 개인 배치 조직 수정 했다. 샘플 조직의 무결성을 최대화 하기 위해 정착 액에 그들을 전송 하기 전에 PBT (세제 PBS)에 체류 하는 시간을 최소화 합니다.

  1. 수집 해 부 더듬이 디스크 또는 0.2%의 200 µ L을 포함 하는 200 µ L PCR 튜브에 번데기 안테나 조직의 무결성을 유지 하 고 200 µ L PCR의 벽에 튀어나와에서 샘플을 피하기 위해 얼음에 PBT 튜브는 불완전 한 고정으로 이어질 것입니다 합니다.
    참고: 번데기 안테나 및 더듬이 디스크 어려울 수 있습니다 그들은 꽤 반투명으로 보고입니다. 그것은 조직의 모든 손실을 방지 하기 위해 모든 세척 단계에 대 한 절 개 범위를 사용 하는 것이 좋습니다. 또는, 96-잘 Terasaki 플레이트 고정에 대 한 사용 하 고 최고의 조직을 추적 얼룩 있을 수 있습니다.
  2. 4%의 약 200 µ L에 번데기에서 수정 해 부 더듬이 디스크와 더듬이 샘플 PFA (Paraformaldehyde) 실 온에서 30 분. 이 고 후속 단계를 제대로 믹스 솔루션에서 샘플을 nutator에 샘플 튜브를 유지. 6.7 단계로 진행입니다.
  3. 성인 안테나에 대 한 전체 머리를 처음 해 부하 고 4%의 약 200 µ L에서 수정 PFA (paraformaldehyde) 실 온에서 1 h.
  4. 씻어 0.2%의 200 µ L 3 x PBT 10 분. 인큐베이션 기간 동안에 nutator 샘플을 유지.
  5. 고정 헤드에서 두 번째 더듬이 세그먼트의 미세한 절 개에 대 한 해 부 현미경을 다시 이동 합니다. 집게를 사용 하 여 머리를 안정, 두 번째에서 세 번째 더듬이 세그먼트 밖으로 부드럽게 당겨/핀치.
  6. 4%의 약 200 µ L로 해 부 제 3 더듬이 세그먼트를 전송 PFA (paraformaldehyde) 실 온에서 30 분 동안 그들을 수정 하 고.
  7. 씻어 0.2%의 200 µ L 3 x PBT 10 분. 인큐베이션 기간 동안에 nutator 샘플을 유지.
  8. 4 ° C에서 샘플을 저장 하거나 전체 마운트 immunohistochemistry 직접 계속.
    참고: 얼룩의 효율성 항 체 사용 되 고 변경할 수 있습니다. 이 메서드는 풍부한 단백질 태그 덜 적합 또는 약한 항 체 이어야 한다. 그러나, 때때로, 그것은 프로토콜 (정체성 또는 정착 액의 금액 또는 고정 시간)의 최적화가 필요할 수 있습니다.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

해 부 개발 후 각 조직의 RNA 추출 뒤에 RT-PCR 유전자 발현을 평가 하기 위해 사용할 수 있습니다. 또는 immunohistochemistry 프로토콜을 통해 식이 패턴, 그리고 하위 세포질 유전자의 지역화를 확인 하기 위해 취할 수 있습니다. 관심입니다. 이 섹션에서 우리는 어느 프로토콜에서 대표적인 결과 제시. 그림 1 은 대표적인 양적 RT-PCR 야생-타입 성인 안테나에 세포 표면 수용 체와 후 각 수용 체 유전자의 전사를 보여주는. 그림 2 는 6-8 h 고 Rn EGFP 유전자 변형에 12 h APF 더듬이 디스크 stainings를 사용 하 여 안티-GFP (1:1000)와 안티 lamin 항 체 (1: 100) (그림 2A2B). Rn EGFP 초기 번데기 단계 동안 더듬이 디스크 내의 특정 영역을 라벨. 우리는 또한 40 h APF 번데기 더듬이 안티-GFP 항 체 얼룩이 UAS-CD8GFP Or67d-GAL4 유전자 변형 파리, 그리고 성인 더듬이 안티-elav (1: 100) ORNs (그림 2)의 얼룩이 지는 항 체를 보여줍니다. 다른 예제는 또한 문학7,8,,910에서 찾을 수 있습니다.

Figure 1
그림 1 . 야생-타입 성인 더듬이 RNA의 샘플에서 다른 유전자에 대 한 양적 RT-PCR. 이 패널 (A)에 대 한 양적 RT-PCR 결과 보기 딥-알파, 딥-eta, dpr5, dpr8, 국선, beatIIIb (뇌관 쌍 참조 표 1), 그리고 (B) 후 각 및 ionotropic 수용 체 (또는 / Ir) 성인에서 유전자 더듬이 RNA 샘플. 오차 막대 표시 표준 오차 (SEM)의. 또는 / Ir 유전자는 낮은 풍부 RNAs qRT-PCR에 의해 아직도 검출 될 수 있는. 각 유전자의 표현 3 중에서 분석 했다. Ct 값은 각 유전자에 대 한 만든 표준 곡선에 따라 각 유전자에 대 한 희석 요소를 계산 하기 위해 사용 되었다. 희석 요인 측정8전에 설명한 대로 모든 유전자의 평균 식에 각 유전자에 대 한 다음 정규화 되었다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 2
그림 2 . 다른 항 체를 사용 하 여 개발 후 각 조직에 Immunohistochemistry. 이러한 패널 표시 안티-GFP (녹색)와 안티 lamin (레드) (A) 6 h APF 번데기 더듬이 디스크와 (B항 체 stainings) 12 h APF 번데기 더듬이 디스크. (C)이이 패널 안테나 Or67d GAL4 UAS-CD8GFP 제 닉에서 토끼와 안티-GFP (녹색) 항 체 얼룩이 40 h APF 보여줍니다. (D)이이 패널 어떤 라벨 Or47b-c d 2를 긍정적인 ORNs (마젠타) 안티-c d 2 항 체로 얼룩진 성인 안테나를 보여줍니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

앞으로 뇌관 반전 뇌관 길이
CGGAGAGGAGGTTATGAGCA GGAAGTGCACAACTAGCGTT 143
CGCGAATCGTTGTGTCAGTA TGTCGATAGCGTGAACCTGA 129
AGGAGTGGACGTTGAGTTACA CAATCATGTCCTCGTGACCG 146
TAGAGTCCGAGCAGCAGATG GTCAGAATTCGAGTTGTCCGC 104
GGCGCTAAGTAGCAGGACG GGCCAAGTCTGTTTGTGAGG 215
TAAGACCCTAGCGCCCTCTT AGGGAGATGCGCTTTGAGAC 129

표 1입니다. QRT-PCR에 사용 되는 PCR 뇌관의 목록입니다.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

이 프로토콜은 실험실 초파리 에 걸쳐이 프로그램의 비교 분석으로 초파리 의 후 각 조직 개발에서 유전과 transcriptional 프로그램을 식별 하는 데 관심이 대 한 유용한 리소스 종입니다. 다른 발달 단계에서 시스템 수준 transcriptional 프로필 미래 연구를 위한 뇌관으로 필요한 경우 특히 유용 합니다. 여기에 설명 된 프로토콜 단계 및 개발에 사용 될 터미널 차별화를 모방 하는 사전에서 후 각 시스템 개발의 4 가지 핵심 단계에서 샘플을 얻기 위해 초파리 에서 후 각 조직 분리 하는 방법을 보여 줍니다. 분자 및 면역 조직학 연구입니다. 초파리 해 부 더듬이 디스크와 다른 번데기 단계에서 안테나 양적 RT-PCR에 의해 RNA-seq 하 여 시스템 수준에서 또는 개별 유전자의 수준에 후 각 시스템 개발 중 유전자 식 프로필을 식별 하기 위해 사용할 수 있습니다. 샘플 조직-특정 유전자 발현의 vivo에서 패턴을 식별 하 immunohistochemistry와 제자리에서 교 잡에 대 한 사용할 수 있습니다. 이 프로토콜의 추가적인 이점은 표준 방법을 사용 하 여 천연 및 포워드 액티브 셀 형식 관련 분자 분석, 순화 된 세포 인구 (또는 단일 셀)를 같이 얻을 정렬 해 부 샘플에 추가 수은 정량 RT-PCR 또는 RNAseq입니다.

프로토콜 더듬이 디스크와 (0 h/prepupa에서 8 h 40 h APF) 번데기에서 안테나 및 성인 단계 해 보여, 비록 다른 번데기 시간 포인트를 적용할 수 있습니다. 그것은 또한이 해를 학습 시간과 연습이 필요 언급 가치입니다. 전문가 한 시간 50 샘플을 해 부를 수 있어야 합니다. 그건 중요 하지 넘는 번데기. 따라서, 해 부, 시작 하기 전에 한 시간 더 pupae 원하는 시대 보다 오래 된 인지 확인 합니다. 그래서 각 단계에 대 한 연습 기간은 실험을 시작 하기 전에 요구 해, 배우는 시간을 걸릴 수 있습니다. ╂ 형태학 변화 9-12 h APF에서에서 어렵게 될. 연령별 pupae 정렬 수 (체 색, 오래 되 고 어두운 색상)에 의해 prepupae를 수집 하는 때. 처음 prepupae를 정렬 overaging를 방지 하기 위해 나이의 순서 대로 해 부에 대 한 수 있습니다.

위에서 설명한 프로토콜 다른 초파리 종에 적용할 수 있습니다. 다른 종의 번데기 해에 대 한 타이밍 근거 할 수 있다 D. melanogaster 에 25 ° C에서 주어진 종의 번데기 개발의 비율에 및 안테나/더듬이 디스크 형태학의 비교 관찰에 모두 해, 시와 가능한 동일한 것으로 형태학 고려 주어진 우선 순위입니다. 초파리 melanogaster, 번데기 단계 약 4 일 소요. D. sechellia D. erecta 번데기 발달 준비 D. melanogaster; 와 비슷합니다. 그러나, 디 virilis 번데기 개발 더 이상11,12x 1.3 이다. 다른 종 절 개에 대 한 준비가 때 가장 높은 우선 순위가 되 고 형태학 적 유사성과 준비 번데기 기간 타이밍 및 무대 관련 안테나/더듬이 디스크 형태학의 비교 관찰에 근거 한다. 첫째, 최적 온도에 관심이 있다면 종족에 대 한 처리를 식별 합니다. 많은 종 25 ° C에서 잘 성장 하지만 UC 샌디에고 초파리 종 재고 센터에서 유지 관리 조건에 대 한 자세한 정보를 얻을 수 있습니다.

프로토콜의 가장 중요 한 단계는 올바른 준비 및 다른 종에서 적절 한 숫자에 관심의 조직의 적절 한 해 부. 이 자리에는, 일단 프로토콜 같은 분석에 대 한 조직의 컬렉션의 효율적인 방법을 제공 한다 고 어떤 초파리 종의 번데기 단계 동안 실질적으로 어떤 개발 imaginal 디스크 조직에 적용할 수 있습니다.

이 프로토콜의 한계가 셀 형식 관련 샘플을 제공 하지 않는다는 것 이다. 세포질 기능 및 형태에 대 한 자세한 이해 셀을 형식별 immunohistochemistry 양적 RT-PCR 등 분자 표준 절차 뿐 아니라 시스템 수준에서 전사의 프로 파일링이 필요 합니다. 셀 형식 관련 프로 파일링 어려운 되었습니다, 특히 비-melanogaster 종에서 셀 형식 관련 기자 제 닉의 부족을 부여. 셀룰러 프로 파일링은 현재 발전, 제 닉, 그리고 CRISPR Cas9 중재 게놈 비-melanogaster 종에서 편집, 라벨 전사13프로 파일링에 대 한 관심의 단일 세포 밖으로 정렬 하는 지금.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자는 공개 없다.

Acknowledgments

이 연구는 즐겼다 C. 볼 칸 (뎁-1457690)에 국립 과학 재단에서 교부 금에 의해 지원 되었다.

Materials

Name Company Catalog Number Comments
10X Phosphate-buffered Saline Gibco 70011-044 Dilute to 1X in RNase free water
CO2 tank Air Gas CD R200
Two sharp forceps (Dumont #55) Fine Science Tools 11255-20
Trizol Invitrogen 15596-026 RNA isolation solutions
Dissecting Microscope
Small bucket with ice
P20 and P200 micropipettes and tips
1.7 mL Microfuge tubes Purchase nuclease free for best results
0.2 mL PCR tubes
Paraformaldehyde powder Polysciences 380
10% Triton X-100 Teknova T1105 Dilute to 0.2% v/v in 1X PBS
2" petri dishes
55mm filter paper Whatman 1001-055 Wet with water and place in a petri dish to keep pupae moist
25 C incubator
deionized H2O Purchase nuclease free or treat with DEPC
Sylgard 184 Silicone Elastomer Kit Dow Corning to be used for making dissection pads from Terizaki plate covers.
MicroWell Mini Trays with lids Nunc 438733 Lids can be used to make silicone dissection pads
Rabbit anti-GFP antibody MBL international corpor PM005 primary antibody
Mouse anti RAT CD2 AbD seroTec MCA154RHDL primary antibody
ADL195 (anti lamin, mouse) Dev studies hydoma ban ADL195-s primary antibody
Alexa Fluor® 488 goat anti-rabbit IgG (H+L) invitrogen A11008 Secondary antibody
Cy3 Goat Anti-Mouse IgG Jackson ImmunoResearch 115-166-003 Secondary antibody
Triton X-100, Protein Grade Detergent, 10% Solution, Sterile-Filtered CALBIOCHEM 648463 detergent
Lab Rotator Thermo scientific Rotator
Nuclease Free Water Growcells.com NUPW-0125 Water
Light-Duty Tissue Wipers VWR 82003-822 For cleaning dissection supplies
Superscript II invitrogen 18064014 Reverse Transcriptase 
QIAshredder (50) RNA extraction QIAGEN 79654
Oligo(dT)12-18 Primer RT life technologies 18418012
RNeasy MinElute Cleanup Kit (50) RNA extraction QIAGEN 74204
FASTSTART UNIV SG MASTER (5 ML)(500 RXN) qPCR Roche 04913850001
FASTSTART ESSENTIAL GREEN DNA MASTER  qPCR Roche 06402712001
LIGHTCYCLER 480 - MULTIWELL PLATE 96 qPCR Roche 04729692001
NEBNext High-Fidelity 2X PCR Master Mix qPCR NEB M0541S

DOWNLOAD MATERIALS LIST

References

  1. Barish, S., Volkan, P. C. Mechanisms of olfactory receptor neuron specification in Drosophila. Wiley Interdisciplinary Reviews. Developmental Biology. 4, (6), 609-621 (2015).
  2. Pan, J. W., Volkan, P. C. Mechanisms of development and evolution of the insect olfactory system. Cell and Developmental Biology. 2, 130 (2013).
  3. Ramdya, P., Benton, R. Evolving olfactory systems on the fly. Trends in Genetics. 26, (7), 307-316 (2010).
  4. Bellen, H. J., Tong, C., Tsuda, H. 100 years of Drosophila research and its impact on vertebrate neuroscience: a history lesson for the future. Nature Reviews Neuroscience. 11, (7), 514-522 (2010).
  5. Knecht, Z. A., et al. Distinct combinations of variant ionotropic glutamate receptors mediate thermosensation and hygrosensation in Drosophila. eLife. 5, 44-60 (2016).
  6. Enjin, A., et al. Humidity sensing in Drosophila. Current Biology. 26, (10), 1352-1358 (2016).
  7. Li, Q., Barish, S., Okuwa, S., Volkan, P. C. Examination of endogenous rotund expression and function in developing Drosophila. olfactory system using CRISPR-Cas9-mediated protein tagging. G3: Genes|Genomes|Genetics. 5, (12), 2809-2816 (2015).
  8. Hueston, C. E., et al. Chromatin modulatory proteins and olfactory receptor signaling in the refinement and maintenance of fruitless expression in olfactory receptor neurons. PLoS Biology. 14, (4), 1002443 (2016).
  9. Li, Q., et al. Combinatorial rules of precursor specification underlying olfactory neuron diversity. Current Biology. 23, (24), 2481-2490 (2013).
  10. Li, Q., et al. A functionally conserved gene regulatory network module governing olfactory neuron diversity. PLoS Genetics. 12, (1), 1005780 (2016).
  11. Pan, J. W., et al. Patterns of transcriptional parallelism and variation in the developing olfactory system of Drosophila species. Scientific Reports. 7, (1), 8804 (2017).
  12. Pan, J. W., et al. Comparative analysis of behavioral and transcriptional variation underlying CO2 sensory neuron function and development in Drosophila. Fly. 11, (4), 239-252 (2017).
  13. Stern, D. L., et al. Genetic and transgenic reagents for Drosophila simulans, D. mauritiana, D. yakuba, D. santomea, and D. virilis. G3: Genes|Genomes|Genetics. 7, (4), 1339-1347 (2017).
주변 후 각 조직에 대 한 개발 준비 분자와 <em>초파리</em> 의 Immunohistochemical 분석
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Barish, S., Volkan, P. C. Preparing Developing Peripheral Olfactory Tissue for Molecular and Immunohistochemical Analysis in Drosophila. J. Vis. Exp. (136), e57716, doi:10.3791/57716 (2018).More

Barish, S., Volkan, P. C. Preparing Developing Peripheral Olfactory Tissue for Molecular and Immunohistochemical Analysis in Drosophila. J. Vis. Exp. (136), e57716, doi:10.3791/57716 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter