Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Developmental Biology

Подготовка, развитие периферийных обонятельных ткани для молекулярной и Иммуногистохимический анализ у дрозофилы

doi: 10.3791/57716 Published: June 13, 2018

Summary

Здесь мы представляем протокол к сцене и проанализируем развитие обоняния ткани от дрозофилы видов. Иссеченную ткань могут затем использоваться для молекулярного анализа, например количественного RT-PCR (обратный транскрипции-полимеразной цепной реакции) или РНК последовательности (RNAseq), а также в естественных условиях анализ таких иммуногистохимия или на месте гибридизации.

Abstract

Обонятельная сенсорная система дрозофилы является широко используемой системой развития нейробиологии, систем неврологии, а также нейрофизиологии, поведения и поведенческих эволюции. Дрозофилы обонятельных тканей дом обонятельных рецепторов нейронов (ORNs), которые обнаруживают летучие химические сигналы наряду с гидро - и термо сенсорных нейронов. В этом протоколе мы описываем рассечение развития периферической обонятельных ткани взрослых видов дрозофилы . Мы сначала описывается этап и возраста личинок дрозофилы , следуют рассечение усиков диска от ранней стадии куколки, следуют рассечение антенн от середины куколки этапов и взрослых. Мы также показать методы, где препараты могут быть использованы в молекулярные методы, такие как извлечение RNA qRT-PCR, RNAseq или иммуногистохимия. Эти методы могут также применяться другие Drosophila видов после раз вегетационных куколки развития определяются, и соответствующих этапов рассчитывается для соответствующего старения.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Обонятельная сенсорная система дрозофилы является широко используемой системой развития нейробиологии, неврологии систем, а также нейрофизиологии, исследования поведения и поведенческих эволюция1,2,3, 4. Дрозофилы обонятельных тканей дом обонятельных рецепторов нейронов (ORNs), которые обнаруживают летучие химические сигналы наряду с гидро - и термо Сенсорные нейроны1,5,6. Общая цель этой рукописи должна продемонстрировать как этап и вскрыть развивающихся куколки и взрослых обонятельных ткани у дрозофилы видов. Обоснование этой техники заключается в создании образцов из различных куколки этапов для молекулярной и развития анализ периферической обонятельной системы, такие как RNAseq и количественного RT-PCR, кроме в vivo ткани маркировки методы . Этот метод может быть особенно полезно для выявления динамики транскрипционный анализ профиля в системе развивающихся взрослых обонятельных от не -melanogaster Drosophila видов, которые не имеют всех трансгенных реагенты для определенного типа клеток маркировка и анализы. В этой рукописи мы продемонстрируем вскрыть усиков дисков и антенн от видов дрозофилы куколки и взрослых. Во-первых мы покажем, как определить 0 h формирования puparium (АТФ, белые куколки или prepupae) для развития промежуточной и поставляемому старения дрозофилы . Далее мы покажем, как вскрыть усиков диски и третий усиков сегмент; в частности как отделить их от глаз диска и второй усиков сегмент для чистоты ткани, необходимые для RNAseq или RT-PCR. Этапы в D. melanogaster , указанных в настоящем Протоколе примерно соответствуют предварительно узорной усиков диск (prepupae), выбор прекурсоров из усиков диск (8 h НФА), начало дифференцировки терминала для ORNs (40 h НФА), и Взрослый антенна. Наконец мы даем примеры для количественного RT-PCR от взрослых антенн, изоляции с помощью метода, а для иммуногистохимии в естественных условиях . Этот метод может использоваться для создания образцов для анализа РНК/ДНК и иммуногистохимии на развитие периферийных обонятельных тканей из различных видов дрозофилы .

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Следующий протокол в соответствии с руководящими принципами этики Комитет по этике исследований университета Duke.

1. Подготовка тканей и развития постановка Drosophila melanogaster куколки

  1. Во-первых определите, как много мух, будет необходимо для рассечения. RT-PCR и RNAseq Соберите 100-200 усиков дисков и антенн от лиц, которые необходимы на этапах prepupal, 8 h НФА, 40 h НФА и взрослого. Для иммуногистохимии вскрыть 10-20 человек.
  2. Очистить все материалы, включая рассечение колодки и щипцы, с помощью салфетки с 70% EtOH. Если расчлененных материал является использоваться для извлечения РНК, очистить все РНКазы нейтрализаторами и сделать все решения с помощью свободной от нуклеиназы или диэтиловым pyrocarbonate (DEPC) очищенной воды.
    Примечание: Этот протокол использует силиконовые подушечки рассечение вместо стекла для вскрытия. Силиконовые накладки являются дружественными для сверхтонкого щипцами и способствовать быстрое и высокое качество вскрытия.
  3. Собирайте куколки в 0 ч НФА/prepupal стадии.
    1. Чтобы обеспечить наиболее точную постановку, контролировать личинки в 30 мин с интервалом 1 ч.
      Примечание: Блуждающих третьего instar личинок в умеренно переполненном бутылка будет скорее всего окукливаются в течение нескольких часов.
    2. Как только личинки становятся неподвижными и окружены очень легкий (почти белый) цветные куколки случай, перенести их в небольшой 2 - в Петри с влажной бумагой фильтра.
    3. Продолжаться в течение 1-2 ч, иногда мониторинга, выявления и перевода prepupae.
      Примечание: в качестве альтернативы, ясно бутылка всех куколок и позволяют личинки развивать за 2 ч. Все куколки собранных после 2 h будет в диапазон 0 - 2 h НФА.
  4. Сразу перейти к шагу 3.1 вскрыть prepupal усиков диск для этапа 0 h НФА. Если prepupa должен быть в возрасте, собрать их в блюдо, Обложка блюдо и место парафин фильм по краям подавляют сухости и место Петри при 25 ° C.
    Примечание: Куколки могут теперь быть в возрасте до eclosion.
  5. Для куколок, собранных в диапазоне 2 h, возраст prepupae на 2 часа меньше, чем требуемый возраст для того, чтобы обеспечить, что куколки не излишек.
  6. Используйте ультра-тонкой щипцы (Дюмон 55) ткани очень мелкие и хрупкие.

2. Подготовка тканей и развития стадии куколки от других видов дрозофилы

  1. Для определения длины куколки развития других видов дрозофилы , поместите образцы при оптимальной температуре, записывать даты, когда наблюдаются prepupae, сортировать их в свежий флакон и записывать количество дней от prepupa до совершеннолетия.
  2. Запишите отношение времени куколки развития для не -melanogaster видов и melanogaster. Умножьте коэффициент развития времени на количество часов, используемых для постановки melanogaster чтобы получить количество часов, чтобы возраст не -melanogaster видов.

3. рассечение D. melanogaster куколки усиков диска

Примечание: Все раз старения и протоколы вскрытия описаны для Drosophila melanogaster. Для всех других видов изменение протокола старения на основе вегетационных развития время точек будет необходимо, как описано выше.

  1. Для вскрытия куколки усиков диск собирать 50-100 0 - 2 h или 6-8 ч старый куколок, с помощью шпателя и разместить их на площадку рассечение.
  2. Пипетка 150 мкл раствора изоляции РНК в РНКазы бесплатно отцентрифугировать 1,5 мл трубки с помощью пипетки 200 мкл и поместить трубку на льду.
  3. Вскрыть куколки в 150-200 мкл ПБС (фосфатный буфер, нуклеиназы бесплатно). Место несколько капель PBS (150-200 мкл на капельки) на клавиатуре рассечение.
  4. На площадку рассечение место 0 - 2 h или куколки в возрасте 6-8 ч (одна куколка на каплю) расчлененный в одном из 1 x PBS капельки. Используйте щипцы в одной руке для стабилизации тела.
  5. Для 0 - 2 h возрасте куколок, используя пинцет с другой стороны, провести на наиболее передней части (рот крючки) prepupa и вытащите его подвергать мозги и имагинальных дисков, прилагается к делу передней куколки.
  6. Для 8 h НФА куколок сначала осторожно слезает куколки случай от наиболее передней четверти куколки, обнажая головку в мешок мембраны, которая окружает тело.
    Примечание: Тело, на данном этапе, выглядит как вырождающихся личинки.
  7. Удалите головы на шее сустав.
    Примечание: Это гарантирует, что усиков диски не будут потеряны, которые на данном этапе связаны главным образом с оптической долей головного мозга.
  8. Ткани с мозги и имагинальных дисков передать еще 1 x капелька PBS с помощью щипцов или 20 мкл пипетки.
  9. Идентифицировать глаз усиков диск подключен к мозга на оптические лопастями. С помощью щипцов, отключите глаз усиков диск от мозга и куколки дела. Передача его в новый 1 x капелька PBS с помощью щипцов или 20 мкл пипетки.
    Примечание: Prepupal глаз усиков диск является плоской ткани. Однако по 8 h куколок, глаз диски вращаются купирования усиков диски, который сидит впереди центральной мозга.
  10. С помощью щипцов, сократить ткани в месте соединения между глаз и усиков диск. Использование пипетки 20 мкл мягко переводить Иссеченную ткань на РНК изоляции раствора реагента. Минимизируйте количество жидкости, переданные закупорить сумму как можно меньше.
  11. Повторяйте, пока все куколки были расчленены.

4. рассечение D. melanogaster середине куколки и взрослых антенн

Примечание: По 40 h НФА, большинство метаморфоза является полным, и взрослый структуры становятся очевидными, но по-прежнему белый и невзрачный. В этот момент времени развития взрослых антенна приняло свою окончательную форму, но по-прежнему является прозрачным и большинство обонятельные рецепторы, за исключением нескольких, не начали выражение.

  1. Для куколки усиков Анатомирование собирать 50-100 prepupae, как описано в шаге 1 и их возраст за 40 ч при 25 ° C.
  2. Накапайте 150 мкл раствора изоляции РНК в РНКазы бесплатно microcentrifuge 1,5 мл трубки с помощью пипетки 200 мкл и поместить трубку на льду.
  3. На площадку рассечение место куколки расчлененный в одну из 1 x PBS капельки. Используйте щипцы в одной руке для стабилизации тела. С помощью щипцов с другой стороны, осторожно слезает куколки случай от наиболее передней четверти куколки, обнажая головку в мешок мембраны, которая окружает тело.
  4. С помощью щипцов, тщательно Отрежьте голову от остальной части тела куколки, удерживая тела с одним набором щипцами и сорвал голову на шею совместно с другой набор щипцов. Аккуратно перенесите голову в другой 1 x капелька PBS с помощью щипцов. Пипетка вверх и вниз, чтобы очистить содержимое головы (мозга и т.д.) чтобы получить четкие мембраны, которая используется для окружают развивающихся дрозофилы головы.
    Примечание: В 40-50 h НФА, усики соединены в секцию передней большинстве мембраны. Они станут очевидными для вскрытия, когда содержимое головы очищается с закупорить.
  5. С помощью щипцов, отключите куколки антенн от мембраны. Отключить сегмента 2nd антенны от 3rd с помощью щипцов кусочек на сегментные сустава, как только 3rd сегмент будет дом обонятельных рецепторов нейронов.
  6. Использование пипетки 20 мкл мягко переводить Иссеченную ткань на РНК изоляции раствора реагента. Минимизируйте количество жидкости, переданные закупорить сумму как можно меньше. Повторяйте, пока все куколки были расчленены.
  7. Для взрослых усиков Анатомирование собирают около 50 взрослых и возраст их за неделю после eclosion.
    Примечание: Экспрессии генов, обонятельных рецепторов и других генов пик через неделю после eclosion. Взрослые выдерживаются в неделю, чтобы обеспечить биологически соответствующих генов с низкой изобилие стенограммы подняться выше порога обнаружения.
  8. Для извлечения РНК вскрыть мух, пока они еще живы на площадку CO2 . Лечить CO2 pad с битор РНКазы. Для конфокальная томография, вскрыть мух на площадку рассечение в 1 x PBS или PBS + 0,2% Тритон.
  9. Во-первых поставьте взрослых спать на CO2 станции площадку под область рассечение. На площадку CO2 станции, используя пинцет в одной руке для стабилизации тела Используйте щипцы в другой аккуратно вытащить/щепотку третьего усиков сегмент от второго.
  10. Передача антенн в РНК изоляции решение, используя пинцет для размещения антенн непосредственно в жидкости. Повторяйте, пока все взрослые были расчленены.
    Примечание: Убедитесь, что антенн погружен в раствор РНК изоляции. Антенны могут стать застрял на стороне трубки. Это приведет к увеличению деградации мРНК, снижение количества и качества РНК.
  11. Непосредственно перейти к извлечение RNA или поместить трубку на-80 ° C для длительного хранения.

5. РНК изоляции от расчлененных тканей

  1. Удалите все образцы от-80 ° C хранения и размораживать их на льду.
  2. Кратко спина (5-6 s, ~ 6000 x g) каждый образец для сбора материала в нижней части трубки.
  3. Шлифуют каждый образец, используя газобетона пластиковые пестик и электромотором для 10 s на льду.
  4. Повторите шаги 5.2 и 5.3 4.
  5. Выполните извлечение RNA, используя имеющиеся наборы и следующие протоколы производителя для оптимальной урожайности.
  6. Выполните qRT ПЦР использование коммерчески доступных реагентов и конкретных грунтовки против гены интереса и после производителя протоколы.
    1. Выполнять все ПЦР-реакции, с помощью следующих условий: денатурации 95 ° C за 10 мин, после чего 40 циклов 95 ° c 15 s, 55 ° C за 30 s и 60 ° C за 30 s.
      Примечание: Грунтовка пар для DIP и dpr генов, перечислены в таблице 1, и грунты для обонятельных рецепторов генов, перечислены в CE сказал et al. 8.

6. Фиксация куколки усиков дисков и антенн для иммуногистохимии

Примечание: Исправьте тканей в пакетах из 10-20 лиц, чтобы убедиться, что ткани фиксируются на такое же количество времени. Свести к минимуму количество времени пребывания образцы в PBT (PBS с моющим средством) до их передачи на фиксатор, чтобы максимизировать целостности тканей.

  1. Собирать расчлененных усиков дисков или куколки антенн в 200 мкл ПЦР-пробирки, содержащие 200 мкл 0,2% PBT на льду для поддержания целостности тканей и чтобы избежать образца от прилипания к стене 200 мкл ПЦР трубы которая приведет к неполной фиксации.
    Примечание: Куколки антенн и усиков дисков может быть трудно понять, как они довольно полупрозрачные. Рекомендуется использовать рассечение область для всех стиральных шаги для предотвращения потери ткани. Кроме того 96-луночных Terasaki пластины могут быть используется для фиксации и окраски лучше отслеживать ткани.
  2. Исправить расчлененных усиков диска и усиков образцы из куколки в приблизительно 200 мкл 4% PFA (параформальдегида) за 30 мин при комнатной температуре. Для этого и последующих шагов, держите трубы с образцами на nutator правильно смешивать образцов в растворе. Прогресс к шагу 6.7.
  3. Для взрослых антенны, вскрыть всю голову сначала и исправить ее в приблизительно 200 мкл 4% PFA (параформальдегида) за 1 ч при комнатной температуре.
  4. Вымойте 3 x с 200 мкл 0,2% PBT за 10 мин. Держите образцы на nutator во время инкубации.
  5. Вернуться к Микроскоп диссекции для тонкой рассечение второго сегмента усиков от фиксированной головки. С помощью щипцов для стабилизации головы, аккуратно вытащить/щепотку третьего усиков сегмент от второго.
  6. Перевести расчлененных третьего усиков сегментов в приблизительно 200 мкл 4% PFA (параформальдегида) и исправить их на 30 минут при комнатной температуре.
  7. Вымойте 3 x с 200 мкл 0,2% PBT за 10 мин. Держите образцы на nutator во время инкубации.
  8. Хранить образцы на 4 ° C, или продолжить непосредственно с вся гора иммуногистохимия.
    Примечание: Эффективность пятнать может измениться при использовании антител. Этот метод должен быть подходящим для менее обильные белка теги или слабее антител. Однако время от времени, может потребоваться оптимизация протокола (личность или количество фиксатором или время фиксации).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Иссеченную ткань развивающимися обонятельную может использоваться для извлечения РНК, следуют RT-PCR для оценки экспрессии генов или могут быть приняты через иммуногистохимия протоколы для определения его выражения и субклеточном локализация генов интерес. В этом разделе мы представляем представитель результаты из любой протокол. Рисунок 1 является представитель количественного RT-PCR показаны транскрипции поверхности рецепторами клеток и обонятельных рецепторов генов в одичал тип взрослых антенн. Рисунок 2 показывает, 6-8 ч и 12 h НФА усиков диск stainings на Rn-EGFP трансгенных мух с помощью анти GFP (1: 1000) и антитела анти Ламин (1: 100) (рис. 2A и 2B). RN-EGFP этикетки конкретных регионов в пределах усиков диск во время ранней стадии куколки. Мы также показывают 40 h НФА куколки усиков анти GFP Пятнать антитела Or67d-GAL4 бас-CD8GFP трансгенных мух и Пятнать антитела взрослых усиков анти elav (1: 100) от ORNs (рис. 2). Другие примеры можно также найти в литературе-7,-8,9,10.

Figure 1
Рисунок 1 . Количественная ПЦР-от взрослых усиков образцов РНК одичал типа для различных генов. Эти панели показывают результаты количественного RT-PCR для (A) DIP-альфа, DIP-ЕТА, dpr5, dpr8, kug, beatIIIb (для грунтовки пар см. таблицу 1) и (B) обонятельные и ИОНОТРОПНЫХ рецептор (или / Ir) гены от взрослого усиков РНК образцы. Планки погрешностей показывают стандартная ошибка среднего (SEM). Или / Ir гены являются низкие изобилии РНК, которые все еще могут быть обнаружены qRT-ПЦР. Выражение каждого гена был проанализирован в трех экземплярах. CT значения были использованы для расчета разбавления факторов для каждого гена, основанные на стандартных кривых, созданных для каждого гена. Разбавление факторы были затем нормализовано для каждого гена в среднем выражение всех генов, измеренная как описано до8. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 2
Рисунок 2 . Иммуногистохимии, с использованием различных антител на разработке обонятельных тканей. Эти панели показывают анти GFP (зеленый) и анти Ламин (красный) stainings антитела на (A) 6 h НФА куколки усиков дисков и ()B) 12 h НФА куколки усиков диски. (C) Эта группа показывает 40 h НФА антенны от Or67d GAL4 бла-CD8GFP мутация витражи с кроликом антител анти GFP (зеленый). (D) группа показывает взрослых антенн, окрашенных с антител анти CD2, какой лейбл Or47b-CD2 положительные ORNs (пурпурный). Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Форвард грунтовка Обратный грунтовка Длина
CGGAGAGGAGGTTATGAGCA GGAAGTGCACAACTAGCGTT 143
CGCGAATCGTTGTGTCAGTA TGTCGATAGCGTGAACCTGA 129
AGGAGTGGACGTTGAGTTACA CAATCATGTCCTCGTGACCG 146
TAGAGTCCGAGCAGCAGATG GTCAGAATTCGAGTTGTCCGC 104
GGCGCTAAGTAGCAGGACG GGCCAAGTCTGTTTGTGAGG 215
TAAGACCCTAGCGCCCTCTT AGGGAGATGCGCTTTGAGAC 129

Таблица 1. Список используемых в qRT ПЦР праймеры PCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Этот протокол является полезным ресурсом для лабораторий, заинтересованных в поиске генетические и транскрипционный анализ программ, действующих в развивающихся дрозофилы обонятельных ткани, а также сравнительный анализ этих программ через дрозофилы видов. Это особенно полезно, если уровне систем транскрипционный анализ профилей из различные этапы развития необходимы как праймер для будущих исследований. Протокол, описанные здесь демонстрируется этап и изолировать развивающихся обонятельных ткани от дрозофилы до получения образцов с четырех ключевых этапов развития обонятельной системы от предварительно патронирования терминала дифференциации, которые будут использоваться в молекулярные и иммунной гистологические исследования. Расчлененный Drosophila усиков дисков и антенн на разных этапах куколки может использоваться для определения профилей выражение гена при разработке обонятельной системы на уровне системы РНК seq, или на уровне отдельных генов путем количественного RT-PCR. Образцы могут также использоваться для иммуногистохимии и в situ гибридизация для определения закономерностей в vivo экспрессии генов ткани конкретных. Дополнительным преимуществом этого протокола является, что расчлененных образцы можно далее диссоциированных с использованием стандартных методов и КВС Сортировка для получения очищенного клеточной популяции (или отдельные клетки) для определенного типа клеток молекулярного анализа, такие как количественные RT-PCR или RNAseq.

Даже несмотря на то, что протокол демонстрирует Анатомирование усиков дисков и антенн от куколки (в 0 ч/prepupa, 8 h и 40 h НФА) и взрослой стадии, она может быть адаптирована к другим точкам куколки время. Стоит также отметить, что изучение этих Анатомирование требует времени и практики. Эксперт должен иметь возможность анализировать 50 проб в час. Важно, чтобы не переросший куколок. Таким образом за час до начала рассечение, убедитесь, что не куколок старше, чем требуемый возраст. Анатомирование может занять время, чтобы узнать, поэтому до начала экспериментов требуется период практики для каждого этапа. Анатомирование становится все труднее с 9-12 h НФА морфологических изменений. Это позволяет сортировать куколок по возрасту при сборе prepupae (в цвет кузова, с темными цветами, будучи старше). Первоначально сортировка prepupae позволяет для рассечения в порядке возраста для предотвращения overaging.

Протокол, в описанный выше могут применяться другие Drosophila видов. Сроки для куколки Анатомирование других видов может основываться как на отношение куколки развития данного вида при 25 ° C до D. melanogaster и сравнительного наблюдения Морфология усиков/усиков диск во время вскрытия, с приоритетное внимание, уделяемое морфологические аспекты идентичными, насколько это возможно. Для Drosophila melanogasterстадия куколки занимает около 4 дней. D. sechellia и D. прямостоячая куколки развития промежуточной похож на D. melanogaster; Однако D. virilis куколки развитие является 1.3 x больше11,12. Когда другие виды готовятся для вскрытия, постановка должно основываться на обоих сроков периода куколки и сравнительного наблюдения стадии конкретных антенн/усиков диск морфологии, с морфологическое сходство, будучи наивысший приоритет. Во-первых определите оптимальную обработку температура для видов, которые вас интересуют. Многие виды растут хорошо при 25 ° C, но можно получить подробную информацию об условиях обслуживания из центра запасов видов UC Сан-Диего дрозофилы .

Наиболее важные шаги в протоколе являются правильной постановки и надлежащего рассечение ткани интерес в достаточном количестве из разных видов. После того, как они находятся в месте, протокол предоставляет эффективный метод коллекции тканей для таких анализов и может быть практически адаптирована к любой развивающейся ткани имагинальных дисков во время стадии куколки в любых видов дрозофилы .

Одно ограничение этого протокола является, что она не предоставляет образцы определенного типа клетки. Более глубокое понимание клеточную функцию и морфология требует ячейки профилирование транскрипции на уровне систем, помимо стандартных молекулярных процедур, таких как количественного RT-PCR или иммуногистохимия конкретного типа. Профилирование конкретного типа клеток был трудным, особенно учитывая отсутствие клеток конкретного типа репортер мутация в не -melanogaster видов. С текущих достижений в клеточных профилирование мутация и ТРИФОСФАТЫ-Cas9 при посредничестве изменения генома в не -melanogaster видов, это теперь можно маркировать и разобраться в отдельные ячейки, представляющих интерес для профилирования транскрипции13.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторы не имеют ничего сообщать.

Acknowledgments

Это исследование было поддержано грант от национального научного фонда для Pelin C. Volkan (DEB-1457690).

Materials

Name Company Catalog Number Comments
10X Phosphate-buffered Saline Gibco 70011-044 Dilute to 1X in RNase free water
CO2 tank Air Gas CD R200
Two sharp forceps (Dumont #55) Fine Science Tools 11255-20
Trizol Invitrogen 15596-026 RNA isolation solutions
Dissecting Microscope
Small bucket with ice
P20 and P200 micropipettes and tips
1.7 mL Microfuge tubes Purchase nuclease free for best results
0.2 mL PCR tubes
Paraformaldehyde powder Polysciences 380
10% Triton X-100 Teknova T1105 Dilute to 0.2% v/v in 1X PBS
2" petri dishes
55mm filter paper Whatman 1001-055 Wet with water and place in a petri dish to keep pupae moist
25 C incubator
deionized H2O Purchase nuclease free or treat with DEPC
Sylgard 184 Silicone Elastomer Kit Dow Corning to be used for making dissection pads from Terizaki plate covers.
MicroWell Mini Trays with lids Nunc 438733 Lids can be used to make silicone dissection pads
Rabbit anti-GFP antibody MBL international corpor PM005 primary antibody
Mouse anti RAT CD2 AbD seroTec MCA154RHDL primary antibody
ADL195 (anti lamin, mouse) Dev studies hydoma ban ADL195-s primary antibody
Alexa Fluor® 488 goat anti-rabbit IgG (H+L) invitrogen A11008 Secondary antibody
Cy3 Goat Anti-Mouse IgG Jackson ImmunoResearch 115-166-003 Secondary antibody
Triton X-100, Protein Grade Detergent, 10% Solution, Sterile-Filtered CALBIOCHEM 648463 detergent
Lab Rotator Thermo scientific Rotator
Nuclease Free Water Growcells.com NUPW-0125 Water
Light-Duty Tissue Wipers VWR 82003-822 For cleaning dissection supplies
Superscript II invitrogen 18064014 Reverse Transcriptase 
QIAshredder (50) RNA extraction QIAGEN 79654
Oligo(dT)12-18 Primer RT life technologies 18418012
RNeasy MinElute Cleanup Kit (50) RNA extraction QIAGEN 74204
FASTSTART UNIV SG MASTER (5 ML)(500 RXN) qPCR Roche 04913850001
FASTSTART ESSENTIAL GREEN DNA MASTER  qPCR Roche 06402712001
LIGHTCYCLER 480 - MULTIWELL PLATE 96 qPCR Roche 04729692001
NEBNext High-Fidelity 2X PCR Master Mix qPCR NEB M0541S

DOWNLOAD MATERIALS LIST

References

  1. Barish, S., Volkan, P. C. Mechanisms of olfactory receptor neuron specification in Drosophila. Wiley Interdisciplinary Reviews. Developmental Biology. 4, (6), 609-621 (2015).
  2. Pan, J. W., Volkan, P. C. Mechanisms of development and evolution of the insect olfactory system. Cell and Developmental Biology. 2, 130 (2013).
  3. Ramdya, P., Benton, R. Evolving olfactory systems on the fly. Trends in Genetics. 26, (7), 307-316 (2010).
  4. Bellen, H. J., Tong, C., Tsuda, H. 100 years of Drosophila research and its impact on vertebrate neuroscience: a history lesson for the future. Nature Reviews Neuroscience. 11, (7), 514-522 (2010).
  5. Knecht, Z. A., et al. Distinct combinations of variant ionotropic glutamate receptors mediate thermosensation and hygrosensation in Drosophila. eLife. 5, 44-60 (2016).
  6. Enjin, A., et al. Humidity sensing in Drosophila. Current Biology. 26, (10), 1352-1358 (2016).
  7. Li, Q., Barish, S., Okuwa, S., Volkan, P. C. Examination of endogenous rotund expression and function in developing Drosophila. olfactory system using CRISPR-Cas9-mediated protein tagging. G3: Genes|Genomes|Genetics. 5, (12), 2809-2816 (2015).
  8. Hueston, C. E., et al. Chromatin modulatory proteins and olfactory receptor signaling in the refinement and maintenance of fruitless expression in olfactory receptor neurons. PLoS Biology. 14, (4), 1002443 (2016).
  9. Li, Q., et al. Combinatorial rules of precursor specification underlying olfactory neuron diversity. Current Biology. 23, (24), 2481-2490 (2013).
  10. Li, Q., et al. A functionally conserved gene regulatory network module governing olfactory neuron diversity. PLoS Genetics. 12, (1), 1005780 (2016).
  11. Pan, J. W., et al. Patterns of transcriptional parallelism and variation in the developing olfactory system of Drosophila species. Scientific Reports. 7, (1), 8804 (2017).
  12. Pan, J. W., et al. Comparative analysis of behavioral and transcriptional variation underlying CO2 sensory neuron function and development in Drosophila. Fly. 11, (4), 239-252 (2017).
  13. Stern, D. L., et al. Genetic and transgenic reagents for Drosophila simulans, D. mauritiana, D. yakuba, D. santomea, and D. virilis. G3: Genes|Genomes|Genetics. 7, (4), 1339-1347 (2017).
Подготовка, развитие периферийных обонятельных ткани для молекулярной и Иммуногистохимический анализ у <em>дрозофилы</em>
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Barish, S., Volkan, P. C. Preparing Developing Peripheral Olfactory Tissue for Molecular and Immunohistochemical Analysis in Drosophila. J. Vis. Exp. (136), e57716, doi:10.3791/57716 (2018).More

Barish, S., Volkan, P. C. Preparing Developing Peripheral Olfactory Tissue for Molecular and Immunohistochemical Analysis in Drosophila. J. Vis. Exp. (136), e57716, doi:10.3791/57716 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter