Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Developmental Biology

Periferik koku doku için geliştirme hazırlanıyor moleküler ve immunohistokimyasal Drosophila analizde

doi: 10.3791/57716 Published: June 13, 2018

Summary

Burada, sahne ve koku doku Drosophila türlerden geliştirme incelemek için bir protokol mevcut. Disseke doku daha sonra kantitatif RT-PCR (Ters transkripsiyon-polimeraz zincir reaksiyonu) veya (RNAseq), sıralama RNA gibi moleküler analizleri için in vivo analizleri immünhistokimya veya in situ gibi yanı sıra kullanılabilir hibridizasyon.

Abstract

Gelişimsel Nörobiyoloji, sistemleri neuroscience, yanı sıra Nörofizyoloji, davranış ve davranışsal evrim Drosophila koku alma sistemi yaygın olarak kullanılan bir sistemdir. Drosophila koku doku uçucu kimyasal cues hidro ve termo duyusal sinir hücreleri ek olarak algılayan koku reseptör nöronlar (ORNs) ev. Bu protokol için yetişkin Drosophila türlerin periferik koku doku geliştirme diseksiyon açıklar. İlk aşama ve Drosophila larva, antennal disk diseksiyon tarafından erken pupa aşamaları, orta-pupa aşamaları ve yetişkin anten diseksiyon tarafından takip ardından yaş nasıl açıklar. Ayrıca nerede hazırlıklar qRT-PCR, RNAseq veya immünhistokimya RNA ayıklama gibi moleküler teknikleri kullanılabilir yöntemleri gösterir. Bu yöntemler aynı zamanda diğer Drosophila türler species-specific pupa geliştirme sürelerinin ve ilgili aşamaları için uygun yaşlanma hesaplanır sonra uygulanabilir.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Gelişimsel Nörobiyoloji, sistemleri neuroscience, yanı sıra Nörofizyoloji, davranış çalışmalar ve davranışsal evrim1,2,3 Drosophila koku alma sistemi yaygın olarak kullanılan bir sistemdir, 4. Drosophila koku dokulara ek olarak hidro ve termo duyusal sinir hücreleri1,5,6uçucu kimyasal ipuçlarını bulmak koku reseptör nöronlar (ORNs) ev. Bu makale genel amacı nasıl sahne ve pupa ve yetişkin koku doku Drosophila türlerin geliştirme incelemek için göstermektir. Örnekleri farklı pupa aşamaları moleküler ve gelişimsel analizleri gibi RNAseq ve kantitatif RT-PCR, periferik koku sistem ayrıca teknikleri etiketleme vivo içinde doku oluşturmak için bu tekniği için mantığı olduğunu . Bu teknik özellikle gelişmekte olan yetişkin koku alma sistemi belirli hücre türünün tüm transgenik reaktifler var mı non -Drosophila melanogaster türlerden transkripsiyon profilleri dinamikleri tanımlamak yararlı olabilir etiketleme ve analizler. Bu makale, antennal diskler ve antenler pupa ve yetişkin Drosophila türlerden incelemek nasıl gösterir. İlk olarak, Drosophila puparium oluşumu (APF, beyaz pupa veya prepupae) gelişimsel evreleme ve species-specific yaşlanma için 0 h tanımlamak nasıl gösterir. Ardından, antennal diskler ve üçüncü antennal segment incelemek nasıl gösterir; Özellikle, nasıl onları göz disk ve ikinci antennal segment RNAseq veya RT-PCR için gereken doku saflık için ayırmak için. Bu protokol için kabaca açıklanan D. melanogaster aşamada önceden desenli antennal disk (prepupae) karşılık, öncüleri antennal üzerinden yelpazesi disk (8 h APF), ORNs (40 h APF), için terminal farklılaşma başlangıcı ve Yetişkin anten. Son olarak, örnek bir kantitatif RT-PCR için yetişkin anten istimal belgili tanımlık yöntem izole ve in vivo immünhistokimya için veriyoruz. Bu yöntem örnekleri bir RNA/DNA analizi ve koku dokulardan periferik Drosophila tür geliştirme immünhistokimya oluşturmak için kullanılabilir.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Aşağıdaki iletişim kuralı Duke Üniversitesi Araştırma Etik Komitesi tarafından kurulan etik kuralları ile tutarlıdır.

1. doku hazırlık ve Drosophila melanogaster Pupa gelişimsel evreleme

  1. İlk olarak, ne kadar çok sinek diseksiyon için gerekli olacaktır tanımlamak. RT-PCR ve RNAseq için 100-200 antennal diskler ve anten prepupal, 8 h APF, 40 h APF ve yetişkin aşamalarında gerekli olan bireyler toplamak. İmmünhistokimya için 10-20 kişi incelemek.
  2. Diseksiyon yastıkları ve forseps, % 70 ile mendil kullanarak da dahil olmak üzere tüm malzemeler temiz alkol. Eğer disseke malzeme RNA çekimi için kullanılan, RNase NÖTRALLEŞTİRİCİLER ile her şeyi temizlemek ve tüm çözümler nükleaz ücretsiz kullanarak yapmak için veya dietil pyrocarbonate (DEPC) su tedavi.
    Not: Bu protokol gruptakiler için cam yerine silikon diseksiyon yastıkları kullanır. Silikon yastıkları için ultra-ince forseps dostu olan ve hızlı ve yüksek kaliteli diseksiyonlarının teşvik.
  3. Pupa 0 h APF/prepupal sahne toplamak.
    1. En doğru evreleme, monitör larva 30 dk 1 h aralıklar sağlamak için.
      Not: Göçebe üçüncü INSTAR larva orta derecede kalabalık bir şişe büyük olasılıkla birkaç saat içinde YavruIar.
    2. Bir kez larvaları hareketsiz hale ve bir çok hafif (neredeyse beyaz) renkli pupa dava ile çevrili, onları içine bir küçük 2 - inç nemli bir filtre kağıdı ile Petri kabına aktarın.
    3. 1-2 h için zaman zaman izleme, belirlenmesi ve prepupae transfer etme, devam edin.
      Not: Alternatif olarak, tüm pupa bir şişe temizleyin ve larvalar için 2 h geliştirmek izin. 2 h 0 - 2 h APF Aralık içinde olacak sonra tüm pupa toplanan.
  4. Hemen 3.1 prepupal antennal disk 0 h APF sahne için incelemek için adımına. Prepupa yaşlı gerekiyorsa, onları bir tabak içine toplamak, çanak kapağı ve parafin film kuruluk etkisizleştirmek için kenarlarda yerleştirin ve 25 ° C'de Petri kabına yerleştirin
    Not: Pupa şimdi eclosion için yaşlı.
  5. Pupa değil emin olmak için prepupae 2 h istenen çağına için 2 h aralığında toplanan pupa için yaş fazlalığı.
  6. Çok küçük ve kırılgan doku olan Ultra-ince forseps (Dumont 55) kullanın.

2. doku hazırlık ve Pupa diğer Drosophila tür gelişimsel evreleme

  1. Diğer Drosophila türler pupa geliştirilmesinde uzunluğunu belirlemek için optimum sıcaklık örnekleri yer, kayıt tarihleri ne zaman prepupae gözlenir, taze bir şişe sıralamak ve prepupa gün yetişkinliğe kaydedin.
  2. Non -melanogaster türler ve melanogasterzaman pupa kalkınma oranı kaydedin. Melanogaster evreleme için non -melanogaster türler yaş için saat sayısı elde etmek için kullanılan saat sayısı gelişimsel zaman oranı ile çarpın.

3. D. melanogaster pupa Antennal disk diseksiyon

Not: İçin açıklanan tüm yaşlanma kez ve diseksiyon protokolleri Drosophila melanogaster. Tüm diğer türler için yukarıda açıklandığı gibi bir değişiklik species-specific gelişimsel zaman puan dayalı yaşlanma Protokolü'nün gerekli, olacaktır.

  1. Pupa antennal disk gruptakiler, 50-100 0 - 2 h veya 6-8 h eski pupa bir spatula kullanarak toplar ve bunları bir diseksiyon rampasında yer.
  2. RNA izolasyon çözüm 150 µL pipet bir RNase ücretsiz 1.5 mL microfuge 200-µL pipet kullanarak tüp ve tüp buza koyun içine.
  3. 1 x PBS (fosfat tamponlu tuz, nükleaz içermeyen) 150-200 µL içinde pupa incelemek. PBS (damlacık başına 150-200 µL) birden fazla damlacıkları diseksiyon altlığında yerleştirin.
  4. Diseksiyon altlığında birinde 1 x PBS damlacıkları disseke için 0 - 2 h veya 6-8 yaş arası h Pupa (damla başına bir pupa) yerleştirin. Forseps bir elinde vücut stabilize etmek için kullanın.
  5. 0 - 2 h pupa prepupa en ön bölümü (ağız kancalar) üzerinde öte yandan, tutun forseps kullanarak, Yaşlı ve hem zeki hem ön pupa gövdesine yapıştırılmış Imaginal diskler ortaya çıkarmak için çıkar.
  6. 8 h APF pupa için ilk yavaşça kafa vücut çevreleyen zar çuval içinde teşhir pupa, pupa olgusu en ön çeyreğinden akasındaki.
    Not: Vücut, bu aşamada bir degenerating larva gibi görünüyor.
  7. Boyun eklemi başında kaldırın.
    Not: Bu antennal diskleri kayıp, olmayacaktır sağlar ki bu aşamada için öncelikle optik loblar beyni bağlı olan.
  8. Başka bir 1 x Forseps veya 20 µL pipet kullanarak PBS damlacık doku beyin ve Imaginal diskler ile aktarın.
  9. Optik loblar, beyin bağlı göz antennal disk tanımlayın. Forseps kullanarak, göz antennal disk beyin ve pupa durumda çekin. Yeni bir 1 x Forseps veya 20 µL pipet kullanarak PBS damlacık aktarmak.
    Not: Prepupal göz antennal disk düz bir dokudur. Ancak, 8 h pupa tarafından göz diskler antennal diskler, çukurluğu hangi anterior merkezi beyin oturur döndürülür.
  10. Forseps kullanarak, doku ve göz antennal disk arasında bağlantı yerinde kesti. 20 µL pipet yavaşça disseke doku RNA izolasyon çözüm reaktif aktarmak için kullanın. Mümkün olduğu kadar küçük bir miktar pipetting tarafından aktarılan sıvı miktarını en aza indirmek.
  11. Tüm pupa disseke kadar yineleyin.

4. diseksiyon D. melanogaster orta-pupa ve yetişkin antenler

Not: APF 40 h tarafından metamorfoz çoğunluğu tamamlandıktan ve yetişkin yapıları belli oluyor ama hala beyaz ve tanımlanamaz. Bu gelişim zamanda noktada yetişkin anten son şeklini almıştır ama hala saydamdır ve birkaç dışında koku reseptörleri çoğunluğu ifade başlamış değil.

  1. Pupa antennal gruptakiler, 1. adımda açıklandığı gibi 50-100 prepupae toplar ve onları 25 ° C'de 40 h için yaş
  2. Damlalıklı 150 µL RNA izolasyon çözüm içine bir RNase free 1.5 mL microcentrifuge 200-µL damlalıklı kullanarak tüp ve tüp buza koyun.
  3. Diseksiyon altlığında içine bir PBS damlacıkları x 1'in disseke pupa yerleştirin. Forseps bir elinde vücut stabilize etmek için kullanın. Forseps diğer elinde kullanarak, yavaşça kafa vücut çevreleyen zar çuval içinde teşhir pupa, pupa olgusu en ön çeyreğinden akasındaki.
  4. Forseps kullanarak, dikkatle pupa vücudun geri kalanından kafasını forseps kümesi ile vücut tutarak ve kapalı kafa boyun forseps başka bir set ile ortak ripping kesin. Yavaşça başından başka bir 1 x forseps kullanarak PBS damlacık içine aktarın. Yukarı ve aşağı pipet (beyin, vb) gelişmekte olan Drosophila kafa çevrelemek için kullanılan açık bir membran elde etmek için baş içeriğini temizlemek için.
    Not: 40-50 h APF, anten membran en ön bölümüne bağlanır. Pipetting ile baş içeriğini kaldırıldığında onlar diseksiyon için belirgin hale gelecektir.
  5. Forseps kullanarak, pupa anten membran bağlantısını kesin. 3 anten 2nd parçasını kesmek sadece 3rd segment koku reseptör nöronlar evi olacak gibi forseps dilim için gelen bir segmental ortak kullanarakrd .
  6. 20 µL pipet yavaşça disseke doku RNA izolasyon çözüm reaktif aktarmak için kullanın. Mümkün olduğu kadar küçük bir miktar pipetting tarafından aktarılan sıvı miktarını en aza indirmek. Tüm pupa disseke kadar yineleyin.
  7. Yetişkin antennal gruptakiler, yaklaşık 50 Yetişkin toplar ve onları bir hafta sonrası eclosion için yaş.
    Not: Koku reseptör gen ifade ve diğer genler bir hafta eclosion sonra zirve. Yetişkinler algılama eşik yükselmeye düşük bereket tutanaklar ile biyolojik olarak ilgili gen emin olmak bir hafta boyunca büyükseniz.
  8. Onlar bir CO2 rampasında hala hayatta iken RNA çekimi için sinekler incelemek. CO2 yastık RNase inhibitörleri ile tedavi. Confocal görüntüleme için PBS veya PBS + % 0.2 x 1'deki bir diseksiyon yastık üzerinde sinekler teşrih Triton.
  9. İlk olarak, CO2 İstasyonu panelindeki diseksiyon kapsamı altında uyumak için yetişkin koymak. Vücut, stabilize etmek bir elinde forseps kullanarak CO2 istasyonu üzerinde forseps diğer elinde yavaşça çekin/ikinci üçüncü antennal segmentten dışarı çimdik için takımını kullanın.
  10. Antenler antenleri doğrudan sıvı içine yerleştirmek için forseps kullanarak bir RNA izolasyon çözüm içine aktarın. Tüm yetişkin disseke kadar yineleyin.
    Not: anten RNA izolasyon çözümde batık olun. Anten yan tarafındaki tüp kalmış olur. Bu artan bir bozulma, RNA, RNA kalite ve miktar azaltılması neden olur.
  11. Doğrudan RNA ayıklama devam etmek ya da uzun süreli depolama için-80 ° C'de tüpü yerleştirin.

5. RNA izolasyonu disseke dokular

  1. -80 ° C depolama biriminden tüm örneklerini kaldırmak ve onları buz çözme.
  2. Kısa bir süre (5-6 sn, ~ 6.000 x g) tüp alt malzeme toplamak için her örnek spin.
  3. Her örnek için 10 autoclaved bir plastik havaneli ve bir elektrik motoru kullanarak eziyet s buz üzerinde.
  4. 5.2 ve 5.3 4 numaralı adımları yineleyin.
  5. Piyasada kitleri kullanarak ve bir en iyi verim için üreticinin iletişim kuralları takip RNA çıkarma gerçekleştirin.
  6. QRT-PCR genler ilgi ve üreticinin iletişim kuralları aşağıdaki karşı belirli astar ve piyasada bulunan reaktifler kullanarak gerçekleştirin.
    1. Aşağıdaki koşullar kullanarak tüm PCR reaksiyonları taşımak: 95 ° C denatürasyon 10 dk ardından 40 devredir 15 95 ° c s, 30 55 ° C s ve 60 ° C 30 s.
      Not: Astar çift daldırma ile dpr gen için Tablo 1' de listelenen ve astar koku reseptör genleri için Hueston CE ve ark. içinde yer almaktadır 8.

6. Pupa Antennal diskler ve antenler immünhistokimya için fiksasyonu

Not: doku dokular için zaman aynı miktarda giderilen emin olmak için 10-20 kişilerden toplu olarak düzeltmek. Dokuların bütünlüğünü en üst düzeye çıkarmak için bir sabitleştirici aktarmadan önce PBT (PBS deterjan ile) örnekleri ikamet süresini en aza indirmek.

  1. Toplamak disseke antennal diskler veya %0,2 200 µL içeren 200-µL PCR tüp içinde pupa anten PBT buz üzerinde doku bütünlüğünü korumak ve örnek--dan 200-µL PCR duvarına yapışmasını önlemek için hangi-ecek götürmek için eksik bir fiksasyon tüpleri.
    Not: Pupa anten ve antennal diskler oldukça şeffaf oldukları gibi görmek zor olabilir. Doku kaybı önlemek için tüm çamaşır adımları için bir diseksiyon kapsam kullanılması önerilir. Alternatif olarak, 96-de Terasaki plakaları fiksasyon için kullanılır ve boyama doku en iyi izlemek için olabilir.
  2. Saptamak disseke antennal disk ve antennal örnekleri üzerinden yaklaşık 200 µL % 4'lük içinde pupa PFA (Paraformaldehyde), oda sıcaklığında 30 dakika. Bu ve sonraki adımları, devam örnekleri tüplerini çözüm örneklerinde mix düzgün bir nutator. Adım 6,7 ilerleme.
  3. Yetişkin anten için tüm başından önce incelemek ve içinde yaklaşık 200 µL % 4'lük tamir PFA (paraformaldehyde) Oda sıcaklığında 1 h için.
  4. 3 x 200 µL % 0,2 ile yıkayın PBT 10 dk için. Örnekleri üzerinde nutator kuluçka sırasında tutmak.
  5. Sabit başları diseksiyon mikroskop ikinci antennal segment bir ince diseksiyon için geri dön. Forseps kullanarak kafa dengelemek, yavaşça çekin/ikinci üçüncü antennal segmentten dışarı çimdik için.
  6. Disseke üçüncü antennal kesimleri yaklaşık 200 µL % 4'lük aktarım PFA (paraformaldehyde) ve oda sıcaklığında 30 dakika düzeltmek.
  7. 3 x 200 µL % 0,2 ile yıkayın PBT 10 dk için. Örnekleri üzerinde nutator kuluçka sırasında tutmak.
  8. Örnekleri 4 ° C'de depolayın veya doğrudan bütün Dağı immünhistokimya ile devam edin.
    Not: antikor kullanılıyor, boyama verimliliğini değişebilir. Bu yöntem daha az bol protein Etiketler için uygun veya zayıf antikorlar olmalıdır. Ancak, zaman zaman, (kimlik veya sabitleştirici miktarı veya fiksasyon saat) protokolü bir duruma getirilmesi gerekebilir.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Disseke gelişmekte olan koku doku RT-PCR tarafından takip RNA çıkarılması için gen ekspresyonu değerlendirmek için kullanılabilir veya onun ifade deseni ve genler alt hücrede yerleşimi belirlemek için immünhistokimya iletişim kuralları üzerinden alınan faiz. Bu bölümde, her iki protokolden temsilcisi sonuçları sunmak. Şekil 1 temsilcisi kantitatif RT-yüzey hücre reseptörü ve koku reseptör Gen transkripsiyonu vahşi-türü yetişkin anten gösterilen PCR var. Şekil 2 6-8 h gösterir ve 12 h APF antennal disk stainings Rn EGFP transgenik üzerinde uçar kullanarak anti-GFP (1: 1000) ve anti-okan antikorlar (1: 100) (Şekil 2A ve 2B). RN-EGFP antennal disk içindeki belirli bölgeleri pupa erken evrelerinde Etiketler. 40 h APF pupa antennal anti-GFP antikor Or67d-GAL4 UAS-CD8GFP transgenik uçar boyama ve yetişkin antennal anti-elav (1: 100) ORNs (Şekil 2) antikor boyama de gösterilir. Diğer örnekler edebiyat7,8,9,10' da bulunabilir.

Figure 1
Resim 1 . Kantitatif RT-PCR vahşi-türü yetişkin antennal RNA örneklerinden farklı genler için. Bu paneller (Aiçin) kantitatif RT-PCR sonuçları göster DIP-Alfa, DIP-eta, dpr5, dpr8, kug, beatIIIb (astar için ikili bkz. Tablo 1) ve (B) koku ve ionotropic reseptör (veya / IR) yetişkin genler antennal RNA örnekleri. Hata çubukları demek (SEM) bir standart hatasını gösterir. Veya / IR genler bulunmaktadır düşük bereket RNA'ların hala qRT-PCR tarafından tespit edilebilir. Her Gen ifadesinin nüsha analiz edildi. CT değerleri her gen için oluşturulan standart eğrileri dayalı her gen için seyreltme Etkenler hesaplamak için kullanılmıştır. Seyreltme faktörler sonra tüm genler8daha önce açıklandığı gibi ölçülen ortalama ifade için her gen için normalleştirilmiş. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 2
Resim 2 . Koku doku geliştirilmesi üzerinde farklı antikorları kullanarak immünhistokimya. Bu paneller anti-GFP (yeşil) ve anti-okan (kırmızı) göstermek antikor stainings (A) 6 h APF pupa antennal diskler ve ()B) 12 h APF pupa antennal diskler. (C) Bu panel anten Or67d GAL4 UAS-CD8GFP transgenics tavşan ile anti-GFP (yeşil) antikorları lekeli 40 h APF gösterir. (D) Bu panel yetişkin anten anti-CD2 antikorlar ile hangi etiket Or47b-CD2 olumlu ORNs (macenta) lekeli gösterir. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

İleri astar Ters astar Uzunluğu
CGGAGAGGAGGTTATGAGCA GGAAGTGCACAACTAGCGTT 143
CGCGAATCGTTGTGTCAGTA TGTCGATAGCGTGAACCTGA 129
AGGAGTGGACGTTGAGTTACA CAATCATGTCCTCGTGACCG 146
TAGAGTCCGAGCAGCAGATG GTCAGAATTCGAGTTGTCCGC 104
GGCGCTAAGTAGCAGGACG GGCCAAGTCTGTTTGTGAGG 215
TAAGACCCTAGCGCCCTCTT AGGGAGATGCGCTTTGAGAC 129

Tablo 1. PCR astar qRT-PCR içinde kullanılan listesi.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Bu iletişim kuralı labs Drosophila Drosophila koku doku, hem de karşılaştırmalı analizi, bu programların geliştirilmesinde çalışma genetik ve transkripsiyon programları belirlenmesinde baktılar için yararlı bir kaynaktır bir tür. Gelecekteki çalışmaları için bir astar olarak farklı gelişim aşamalarında sistemleri düzeyi transkripsiyon profillerden gerekirse özellikle yararlıdır. Burada açıklanan protokol sahne ve dört anahtar gelişimin koku alma sistemi üzerinden ön desenlendirme için kullanılmak üzere terminal farklılaşma örnekler almak için Drosophila koku dokusundan gelişen izole etmek gösterilmiştir Moleküler ve bağışıklık histolojik çalışmalar. Drosophila disseke antennal diskler ve farklı pupa aşamalarında antenler RNA-seq tarafından sistemleri düzeyinde veya tek tek gen düzeyinde koku alma sistemi geliştirme sırasında gen ifade profilleri tanımlamak için kullanılabilir kantitatif RT-PCR tarafından. Örnekleri de immünhistokimya ve in situ hibridizasyon için doku özel gen ekspresyonu vivo tanımlamak için kullanılabilir. Bu protokol ek bir avantaj disseke örnekleri olmak daha fazla olduğunu Disosiye standart yöntemlerle ve saf bir hücresel grubun (veya tek hücre) hücre türüne özgü moleküler analizleri için gibi elde etmek için FAC sıralanmış olduğunu nicel RT-PCR ya da RNAseq.

Protokol diseksiyonu antennal diskler ve anten üzerinden (0 h/prepupa, 8 h ve 40 h APF), pupa ve yetişkin aşamaları gösterse diğer pupa zaman puan için adapte edilebilir. Ayrıca bu gruptakiler öğrenme zaman ve pratik aldığını kayda değer olduğunu. Bir uzman saatte 50 örnekleri incelemek gerekir. Değil için fazlalık önemlidir pupa. Bu nedenle, diseksiyon, başlamadan önce bir saat hiçbir pupa istenilen yaş daha büyük olduğundan emin olun. Pratik bir süre her aşaması için deneyler başlatmadan önce gereklidir bu yüzden diseksiyonlarının öğrenmek için zaman alabilir. Gruptakiler 9-12 h APF morfolojik değişiklikler nedeniyle daha zor olur. Pupa yaşına sıralamak mümkündür prepupae (tarafından gövde rengi, koyu renkli büyük varlık) toplarken. Başlangıçta prepupae sıralama diseksiyon sırasına göre yaş overaging önlemek için sağlar.

Yukarıda açıklanan protokol diğer Drosophila türler için uygulanabilir. Diğer türlerin pupa gruptakiler için zamanlama hem 25 ° c D. melanogaster ile belirli bir türün pupa geliştirme oranı ve anten/antennal disk morfoloji karşılaştırmalı gözlemleri diseksiyonu sırasında ile temel alabilir bir öncelikli olarak aynı olması için için morfolojik konuları göz önüne alındığında. Drosophila melanogasteriçin yaklaşık 4 gün pupa sahne alıyor. D. sechellia ve D. erecta pupa gelişimsel yerleştirme D. melanogaster; için benzer Ancak, D. virilis pupa 1.3 x daha uzun11,12gelişmedir. Ne zaman diğer türler diseksiyon için hazırlanmıştır, düzeylendirme pupa dönemi zamanlaması ve sahne-özel anten/antennal disk morfoloji, karşılaştırmalı gözlemleri ile en yüksek öncelik olan morfolojik benzerlik dayanmalıdır. İlk olarak, sıcaklık, ilgilendiğiniz türler için işleme optimum tanımlayın. Birçok canlı türünün de 25 ° C'de büyümek ama bakım koşulları hakkında detaylı bilgi UC San Diego Drosophila tür stok Merkezi'nden temin edilebilir.

İletişim kuralı en kritik adım doğru evreleme ve ilgi yeterli sayıda farklı türlerden dokusunun uygun diseksiyon vardır. Bir kez bunlar yerde, protokol böyle analizler için doku koleksiyonunun verimli bir yöntem sağlar ve herhangi bir Drosophila türler içinde pupa aşamaları sırasında herhangi bir gelişmekte olan Imaginal disk dokusu ile hemen hemen adapte edilebilir.

Bu iletişim kuralı bir sınırlama hücre türüne özgü örnekleri sağlamaz var. Hücresel fonksiyon ve morfoloji daha ayrıntılı bir anlayış hücre türüne özgü transkripsiyon kantitatif RT-PCR veya immünhistokimya gibi standart moleküler yordamlar yanı sıra bir sistem düzeyinde profilleme gerektirir. Hücre türüne özgü profil oluşturma özellikle non -melanogaster türler hücre türüne özgü muhabir transgenics eksikliği göz önüne alındığında, zordu. Hücresel profil oluşturma güncel gelişmeler, genom içinde non -melanogaster tür düzenleme transgenics ve CRISPR-Cas9 aracılı, şimdi etiket ve transkripsiyon13profil ilgi tek hücreleri sıralamak mümkündür.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarlar ifşa gerek yok.

Acknowledgments

Bu çalışmada, Ulusal Bilim Vakfı Hibe için Pelin C. Volkan (DEB-1457690) tarafından desteklenmiştir.

Materials

Name Company Catalog Number Comments
10X Phosphate-buffered Saline Gibco 70011-044 Dilute to 1X in RNase free water
CO2 tank Air Gas CD R200
Two sharp forceps (Dumont #55) Fine Science Tools 11255-20
Trizol Invitrogen 15596-026 RNA isolation solutions
Dissecting Microscope
Small bucket with ice
P20 and P200 micropipettes and tips
1.7 mL Microfuge tubes Purchase nuclease free for best results
0.2 mL PCR tubes
Paraformaldehyde powder Polysciences 380
10% Triton X-100 Teknova T1105 Dilute to 0.2% v/v in 1X PBS
2" petri dishes
55mm filter paper Whatman 1001-055 Wet with water and place in a petri dish to keep pupae moist
25 C incubator
deionized H2O Purchase nuclease free or treat with DEPC
Sylgard 184 Silicone Elastomer Kit Dow Corning to be used for making dissection pads from Terizaki plate covers.
MicroWell Mini Trays with lids Nunc 438733 Lids can be used to make silicone dissection pads
Rabbit anti-GFP antibody MBL international corpor PM005 primary antibody
Mouse anti RAT CD2 AbD seroTec MCA154RHDL primary antibody
ADL195 (anti lamin, mouse) Dev studies hydoma ban ADL195-s primary antibody
Alexa Fluor® 488 goat anti-rabbit IgG (H+L) invitrogen A11008 Secondary antibody
Cy3 Goat Anti-Mouse IgG Jackson ImmunoResearch 115-166-003 Secondary antibody
Triton X-100, Protein Grade Detergent, 10% Solution, Sterile-Filtered CALBIOCHEM 648463 detergent
Lab Rotator Thermo scientific Rotator
Nuclease Free Water Growcells.com NUPW-0125 Water
Light-Duty Tissue Wipers VWR 82003-822 For cleaning dissection supplies
Superscript II invitrogen 18064014 Reverse Transcriptase 
QIAshredder (50) RNA extraction QIAGEN 79654
Oligo(dT)12-18 Primer RT life technologies 18418012
RNeasy MinElute Cleanup Kit (50) RNA extraction QIAGEN 74204
FASTSTART UNIV SG MASTER (5 ML)(500 RXN) qPCR Roche 04913850001
FASTSTART ESSENTIAL GREEN DNA MASTER  qPCR Roche 06402712001
LIGHTCYCLER 480 - MULTIWELL PLATE 96 qPCR Roche 04729692001
NEBNext High-Fidelity 2X PCR Master Mix qPCR NEB M0541S

DOWNLOAD MATERIALS LIST

References

  1. Barish, S., Volkan, P. C. Mechanisms of olfactory receptor neuron specification in Drosophila. Wiley Interdisciplinary Reviews. Developmental Biology. 4, (6), 609-621 (2015).
  2. Pan, J. W., Volkan, P. C. Mechanisms of development and evolution of the insect olfactory system. Cell and Developmental Biology. 2, 130 (2013).
  3. Ramdya, P., Benton, R. Evolving olfactory systems on the fly. Trends in Genetics. 26, (7), 307-316 (2010).
  4. Bellen, H. J., Tong, C., Tsuda, H. 100 years of Drosophila research and its impact on vertebrate neuroscience: a history lesson for the future. Nature Reviews Neuroscience. 11, (7), 514-522 (2010).
  5. Knecht, Z. A., et al. Distinct combinations of variant ionotropic glutamate receptors mediate thermosensation and hygrosensation in Drosophila. eLife. 5, 44-60 (2016).
  6. Enjin, A., et al. Humidity sensing in Drosophila. Current Biology. 26, (10), 1352-1358 (2016).
  7. Li, Q., Barish, S., Okuwa, S., Volkan, P. C. Examination of endogenous rotund expression and function in developing Drosophila. olfactory system using CRISPR-Cas9-mediated protein tagging. G3: Genes|Genomes|Genetics. 5, (12), 2809-2816 (2015).
  8. Hueston, C. E., et al. Chromatin modulatory proteins and olfactory receptor signaling in the refinement and maintenance of fruitless expression in olfactory receptor neurons. PLoS Biology. 14, (4), 1002443 (2016).
  9. Li, Q., et al. Combinatorial rules of precursor specification underlying olfactory neuron diversity. Current Biology. 23, (24), 2481-2490 (2013).
  10. Li, Q., et al. A functionally conserved gene regulatory network module governing olfactory neuron diversity. PLoS Genetics. 12, (1), 1005780 (2016).
  11. Pan, J. W., et al. Patterns of transcriptional parallelism and variation in the developing olfactory system of Drosophila species. Scientific Reports. 7, (1), 8804 (2017).
  12. Pan, J. W., et al. Comparative analysis of behavioral and transcriptional variation underlying CO2 sensory neuron function and development in Drosophila. Fly. 11, (4), 239-252 (2017).
  13. Stern, D. L., et al. Genetic and transgenic reagents for Drosophila simulans, D. mauritiana, D. yakuba, D. santomea, and D. virilis. G3: Genes|Genomes|Genetics. 7, (4), 1339-1347 (2017).
Periferik koku doku için geliştirme hazırlanıyor moleküler ve immunohistokimyasal <em>Drosophila</em> analizde
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Barish, S., Volkan, P. C. Preparing Developing Peripheral Olfactory Tissue for Molecular and Immunohistochemical Analysis in Drosophila. J. Vis. Exp. (136), e57716, doi:10.3791/57716 (2018).More

Barish, S., Volkan, P. C. Preparing Developing Peripheral Olfactory Tissue for Molecular and Immunohistochemical Analysis in Drosophila. J. Vis. Exp. (136), e57716, doi:10.3791/57716 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter