Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Kvantifiering av antikroppsberoende förbättring av zikaviruset i primära mänskliga celler

doi: 10.3791/58691 Published: January 18, 2019

Summary

Vi beskriver en metod för att utvärdera effekten av redan existerande immunitet mot denguefeber virus på Zika virusinfektion med humant serum, primära mänskliga celler och infektion kvantifiering genom kvantitativ realtids polymeras-kedjereaktion.

Abstract

Senaste uppkomsten av flavivirus Zika och neurologiska komplikationer, såsom Guillain-Barrés syndrom och mikrocefali hos spädbarn, har medfört allvarliga offentliga säkerhetsproblem. Bland riskfaktorerna utgör antikroppsberoende enhancement (ADE) den mest betydande hot, som nyligen re-framväxten av zikaviruset (ZIKV) är främst i områden där befolkningen har varit utsatt och är i ett tillstånd av före immunitet mot andra närbesläktade flavivirus, särskilt denguefeber virus (DENV). Här beskriver vi ett protokoll för att kvantifiera effekten av humant serumantikroppar mot DENV på ZIKV infektion i primära mänskliga celler eller cellinjer.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Bland de myggor-burna virussjukdomar är Zika infektion en av den mest kliniskt viktigt1. Infektionen orsakas av flavivirus ZIKV som, i de flesta fall använder Aedes aegypti som dess primära vector1,2. Det finns dock studier som rapporterat Aedes albopictus som en primär vektor i vissa ZIKV utbrott3. Även om infektionen är asymtomatiska i många fall, är de vanligaste symtomen feber, huvudvärk och muskel smärta2. Det finns inget botemedel eller vaccin för ZIKV infektion och behandling är mestadels stödjande. Senaste utbrott av ZIKV i södra Amerika ledde till svåra fall av sjukdomen och en cirka 20-fold ökning neurologiska sjukdomen hos foster heter mikrocefali2. Sydamerika är ett område som är endemisk till flera arboviruses såsom DENV och West Nile virus, är det viktigt att undersöka om tidigare immunitet mot andra flavivirus(es) spelar en roll i svårighetsgraden av ZIKV infektioner och sjukdomar.

Genom tiderna har har virus utvecklats olika strategier för att öka deras chans att smittsamhet för att ta över den mottagande cellen maskinen och undertrycka antivirala responsen. En av de mest fascinerande av alla är användningen av värd pre immunförsvaret antikroppar av virus för att förbättra deras replikering med fenomenet ADE4. ADE över alla fyra serotyper av DENV har varit väl studerade och visat att öka viral titrar och sjukdom resultatet5,6,7. I en tidigare in vitro-studie, har vi visat betydande förbättring av ZIKV replikering på grund av befintlig DENV immunitet i primära mänskliga immunceller8. Vi visade också en relevant in vitro-metod för att kvantifiera DENV befintliga antikroppar förmåga att förbättra ZIKV replikering i primära celler.

Det protokoll som vi har utvecklat använder humant serumprover som är testade för DENV neutralisering TCID-50 eller plack minskning neutraliseringstest (PRNT) analyser, tillsammans med ZIKV i biologiskt relevanta celler eller celler som härrör från vävnader som ZIKV kan infektera.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Serumprov som används i denna studie erhölls från mänskliga deltagare av en kohort från Columbia. Provsamling godkändes av intern omprövning board (IRB) vid Universidad de Pamplona (Columbia, Sydamerika) och Los Potios sjukhus8. Proverna lämnades anonymt och utredarna hade ingen åtkomst till patientinformation. Serumprover kontrollerades för DENV serotypen. Proverna var bekräftat för att neutralisera DENV infektion in vitro-. För kontroll användes serumprover från friska individer (HC) från USA.

Obs: Detta protokoll kan användas för att undersöka ADE av ZIKV replikering i någon mänsklig celltyp uttrycker Fcγ receptorn. Protokollet består av tre delar (figur 1).

1. cell sådd och infektion Setup

Obs: För denna särskilda studier, människans primära makrofager eller U937 myelomonocytär cellinje (ATCC-CRL-1593.2) användes. Cellerna upprätthölls i RPMI odlingsmedium kompletteras med 10% fetalt bovint serum (FBS) på en 37 ° C inkubator med 5% koldioxid (CO2). Alla stegen genomfördes i en biosäkerhet nivå 2 (BSL-2) biosäkerhet skåp i sterila förhållanden.

  1. Seed 3 x 104 celler per väl i en steril platt-96 brunnar bottenplatta tillsammans med 100 µL av medium och placera dem i 37 ° C inkubator med 5% CO2.
  2. Efter sådd cellerna, Tina serumprover i rumstemperatur och gör 10-faldig seriespädningar (dvs.1/10, 1/100, 1/1 000, 1/10 000) genom att blanda proverna i serumfritt medium. Alikvotens spädningarna i en steril plattan med 96 brunnar. Använda viruset utan serum som en ytterligare kontroll.
  3. Tina ZIKV beståndet vid 37 ° C i ett vattenbad för 1-2 min och snabbt överföra dem till is för framtida bruk.
  4. Lägga till en 0.1 multiplicity av infektion (MOI) motsvarande mängd ZIKV stam MR766 i serum alikvoter.
    Obs: Kontrollera att utspädningsfaktorn förblir konstant och totalvolymen är ~ 200 µL; Det är nog för exemplar av varje behandling. Behåll tre brunnar infekterade för att använda som negativ kontroll för efterföljande analys.
  5. Inkubera serumspädningarna med extra virus i 37 ° C inkubator med 5% CO2 för 1 h för att möjliggöra DENV antikroppar att bilda komplex med de Zika virioner (för bekvämlighet, nedan kallad ”immunkomplex”).
  6. Aspirera media från de celler som var seedad i platt-bottenplattan 96 brunnar. Tvätta cellerna med steril 1 x fosfatbuffrad koksaltlösning (1 x PBS).
  7. Tillsätt 50 µL av immunkomplex i varje brunn och inkubera dem i 37 ° C inkubator med 5% CO2 för 2 h.
  8. Efter 2 h för inkubation, aspirera i mediet som innehåller immunkomplex från celler, använder en flerkanalig pipett och tvätta cellerna 2 x med 1 x PBS att helt ta bort immunkomplex och någon lös virioner.
  9. Tillsätt 100 µL av färska komplett media kompletteras med 10% FBS till varje väl och inkubera cellerna i 37 ° C inkubatorn med 5% CO2 för 48 h.

2. RNA-extraktion

  1. Ta bort plattan med 96 brunnar från inkubatorn och överföra den till biosäkerhet skåp.
  2. Aspirera media, tvätta cellerna 2 x med 1 x PBS, och fortsätt att RNA-extraktion.
    Obs: RNA kan utvinnas av någon metod för val (se Tabell för material).
  3. Tillsätt 250 µL cell lyseringsbuffert med 10% β-merkaptoetanol per brunn. Pipettera bufferten upp och ned minst 5 x tillsammans med skrapa cellerna med pipettspetsen att påskynda förfarandet lysis.
  4. Överföra den cell lysates till ny, märkt, steril 1,5 mL rör.
  5. Lägga till en lika stor mängd 70% etanol (250 µL). Pipettera upp och ner 4 x - 5 x tills blandningen är klar.
  6. Överför blandningen (~ 500 µL) till märkt kiseldioxid-baserade kolumner i 2 mL samling rör och centrifugera 15 000 x g i 30 s. kasta flödet genom och hålla kolumnerna i samma samling rören.
  7. Tillsätt 700 µL tvättlösning 1 i varje kolumn och centrifugera 15 000 x g i 30 s. kasta flödet genom och hålla kolumnerna i samma samling rören.
  8. Tillsätt 500 µL av tvättbuffert 2 till varje kolumn och centrifugera vid 15 000 x g för 30 s. Kassera supernatanten. Upprepa detta steg 2 x.
  9. Överföring kolumnerna till nya 2 mL samling rör och centrifugera vid 15000 x g under 2 min. Kontrollera att kisel-baserade kolumner blir helt torr och det finns ingen etanol kvar från tvättbuffert 2.
  10. Kassera de 2 mL tuberna och placera kolumnerna i nya, steril, märkt, 1,5 mL återhämtning rör.
  11. Tillsätt förvärmd (42 ° C) 30 µL RNase-fritt vatten i mitten av varje kolumn och centrifugera vid 15000 x g i 1 min.
  12. Återställa de eluerade RNA och kvantifiera urvalen, med en spektrofotometer vid en 260 nm våglängd.
    Obs: Idealiskt, bestämma renheten av RNA genom att beräkna förhållandet mellan absorbansvärdena på 260 nm och 280 nm. Renat RNA'S 260/280 förhållandet är idealiskt mellan 1.8-2.0.

3. kvantitativa realtid Polymerase Chain Reaction

Obs: Kvantitativ realtids polymeras-kedjereaktion (qRT-PCR) kan utföras genom att använda någon SYBR green mix som vanligtvis består av SYBR Green jag färga, Taq-DNA-polymeras, deoxynucleotide trifosfater (dNTP) och en passiv färgämne. Någon qPCR-maskin som kan påvisande av SYBR green kan användas att utföra reaktionen och förvärva data. För detta experiment, en one-step RT-PCR kit användes som hade en cocktail av SYBR Green I, ROX färgämne, Taq-DNA-polymeras, dNTP och en ytterligare blandning av omvänt transkriptas (se Tabell för material). Primers utformats mot regionen kuvert och används i denna studie för att kvantifiera ZIKV genomisk nivåer är CCGCTGCCCAACACAAG för ZIKV-qF och CCACTAACGTTCTTTTGCAGACAT för ZIKV-qR. Som en kontroll, var mänskliga β-2-mikroglobulin (B2M) mätt och används för att normalisera ett uttryck för ZIKV (städning genen). Primer sekvenser att kvantifiera B2M genuttrycket används i denna studie är CTCCGTGGCCTTAGCTGTG för B2M-qF och TTTGGAGTACGCTGGATAGCCT för B2M qR. Se till att sätta tre tekniska replikat för varje prov för både ZIKV och B2M generna. Inställningen av RT-PCR beskrivs kortfattat nedan.

  1. RT-PCR-setup
    1. Använd 100 ng av RNA per prov.
    2. Tillsätt 1 µL från 10 µM bestånd av både framåt och bakåt primers av en särskild gen för varje reaktion.
    3. Tillsätt 0,25 µL av omvänt transkriptas mix per prov.
    4. För varje individuell reaktion, lägga till 12,5 µL av SYBR Green mix.
    5. Lägg till upp till 25 µL av vatten. Göra en master blanda alla ovannämnda reagenser utom RNA, alikvotens i 96 brunnar PCR-plattan, och lägga till RNA senast.
    6. Försegla plattan med transparent tejp.
    7. Centrifugera plattan vid 1 000 x g för 1 min att blanda reagenserna.
    8. Satte plattan i qPCR maskinen.
  2. RT-PCR profil
    Obs: Använd den RT-PCR-profilen visas i tabell 1.
    1. Inkubera proverna vid 50 ° C i 10 min för att säkerställa syntesen av kompletterande DNA (cDNA).
    2. Efter cDNA syntesen, aktivera Taq-DNA-polymerasen vid 95 ° C i 5 min.
    3. Utföra 40 cykler av denaturering vid 95 ° C för 10 s och primer glödgning och förlängning vid 60 ° C i 30 s.
    4. Sätta det ytterligare smälta kurva steget (65° C) i slutet.
  3. Analys av data
    1. Övervaka smälta kurvan genom att klicka på fliken smälta kurva i programmet används för att köra qPCR maskinen, som helst visar en enkel topp i alla prover för en särskild gen att bekräfta förekomsten av endast en amplikon och en förstärkning värde mer än 1,6 om algori THM anser 2 som värdet 100% förstärkning (förstärkning värdet varierar enligt den algoritm som används av qPCR maskinen). Se till att använda 0,5 ° C temperatur steg mellan trappan och minst hålla tiden för 10 s i protokollet smälta kurva, för optimalt resultat.
    2. Efter att se till att det finns Klicka en enda amplikon och bra förstärkning värde, först på fliken kvantifiering data att få en kvantitativ cykel (Ct/Cq värde) av varje prov och exportera till Microsoft Excel.
    3. Använder ett kalkylblad, beräkna medelvärdet för varje prov med hjälp av Ct-värdet. Nästa, klicka i formlerna och välj genomsnittet. De genomsnittliga CT-värdena för varje prov (replikera) används för ytterligare analys.
    4. Därefter beräkna den ΔCt använda den formel ΔCt = genomsnittliga Ct av målgenen - medelvärdet Ct av kontroll genen (i detta fall, ΔCt = genomsnittliga Ct av den ZIKV genen - medelvärdet Ct av B2M genen).
    5. Beräkna ΔΔCt för att normalisera data (i detta fall, ΔΔCt = ΔCt ZIKV prover - B2M prover).
    6. Beräkna luckan öka genuttryck genom att skriva den formeln 2^-(ΔΔCt) för varje enskild ΔΔCt normaliserade värde. Resultaten av den faldig ökningen att utföra statistiska tester kan erhållas enligt beskrivningen i tidigare studier9,10.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

I figur 1finns det en stegvisa Schematisk illustration av alla stegen att genomföra protokollet ADE. Det är en schematisk bild som visar hela förfarandet i ADE av ZIKV på grund av redan existerande immunitet till DENV. Figur 2 visar hur humant serum prover var kategoriseras i tre olika grupper: DENV infektion-bekräftade prover kallas gruppen DENV-infekterade, DENV antikropp-bekräftade prover är avses som gruppen DENV-exponerade och friska individers sera utan DENV-neutraliserande antikroppar eller RNA kallas den friska kontrollgruppen (HC). (Figur 2).

Alla serumprover var tillåten att göra komplex med ZIKV och användes sedan för att infektera makrofagceller. Efter 48 h angripen, var RNA extraherade och underkastas qRT-PCR. Representativa experimentet i figur 3 visar att de flesta av sera som innehåller DENV serotyp 1 till 4 antikroppar skulle kunna förbättra ZIKV replikering på olika nivåer. Den högsta ökningen av ZIKV titrar hittades i makrofager behandlas med sera som innehåller DENV serotyp 2 och 4 antikroppar jämfört med serotyp 1 och 3, som visade en relativt mindre induktion av ZIKV.

Figure 1
Figur 1 : Schematisk illustration av protokollet ADE. En steg för steg illustration visar alla steg involverade i hela protokollet. Klicka här för att se en större version av denna siffra.

Figure 2
Figur 2 : Schematisk av experimentella förfarandet. Tre typer av sera inkuberades med zikavirus. Gruppen jag bestod av DENV-RNA positiva (DENV-infekterade) prover. Grupp II bestod av DENV-antikropp positiva (DENV-exponerade) prover. Grupp III bestod av prover utan DENV RNA eller antikropp (friska kontroller). Virus-sera blandningen lades till mänskliga makrofager och infektionen kvantifieras. Denna siffra har ändrats från Londono-Renteria et al.8. Klicka här för att se en större version av denna siffra.

Figure 3
Figur 3 : DENV Immunsera förbättrar ZIKV infektion i primära mänskliga makrofager. Humansera som innehåller DENV antikroppar (DENV1-4 är serotyp bekräftade, Col är serotyp okänd) eller från friska kontroller var utspädd 1:10 till 1:10,000 och inkuberas med ZIKV. Sera beskrivs i tabell 1. Primära isolerade mänskliga makrofager var infekterade med ZIKV ensam eller med ZIKV-sera blandningar. (en) DENV1 antikropp-innehållande sera. (b), DENV2 antikropp-innehållande sera. (c), DENV3 antikropp-innehållande sera. (d), DENV4 antikropp-innehållande sera. (e), DENV-antikropp sera från colombianska enskilda 1. (f), DENV-antikropp sera från colombianska enskilda 2. Infektionen mättes av qRT-PCR-analys på 48 h angripen. Tekniska och biologiska replikat utfördes i tre exemplar. Data sammanförs och felstaplarna visar standardavvikelsen. Student's t-test och ANOVA användes för statistisk analys. P < 0,001. Denna siffra har ändrats från Londono-Renteria et al.8. Klicka här för att se en större version av denna siffra.

Table 1
Tabell 1: Termisk profil av qRT-PCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Korsreaktivitet DENV antikroppar leder till ADE av andra DENV serotyperna har hindrat utvecklingen av ett effektivt vaccin11. ZIKV tillhör samma familj, flavivirus, och har en avsevärd homologi med andra flavivirus, särskilt DENV12. Det främsta målet för neutraliserande antikroppar för både ZIKV och DENV är kuvertet protein, som delar en mycket hög strukturella och Kvartära sekvenshomologi mellan två virus13,14,15. Det har visats att före immunitet mot antingen DENV eller ZIKV kan förbättra infektionen av andra virus8,16.

Det finns ett antal olika metoder som används för att kvantifiera den virala smittsamheten i ADE experiment, allt från plack analyser17, intracellulära virusantigen färgning med antikroppar konjugerat med fluorescerande färgämnen och flödescytometri18 ,19. Dessa analyser är tidskrävande och inte lätt att anpassa för den hög genomströmningen av flera prov samtidigt. Ännu viktigare, de flesta studier används DENV-specifika monoklonala antikroppar för att kontrollera deras effekt på ZIKV och undersökte ADE i cell linjer endast20,21. I detta protokoll beskriver vi en enkel men effektiv metod där vi använde mänskliga pre immun serumprov som har en neutraliserande förmåga mot DENV, tillsammans med primära mänskliga immunceller, att undersöka effekten av patientens serum på ZIKV replikering genom att anställa qRT-PCR. Denna metod är robust, relevanta och kan fyllas i tre dagar. Men de representativa resultat i detta manuskript visar sin ansökan om ZIKV, kan detta protokoll ändras enkelt och används för andra flavivirus, som gula febern, dengue-virus, och West Nile-virus. En viktig faktor att beakta är att detta protokoll har en begränsning i att skilja mellan mogna och omogna viral RNA.

Under protokollet, det är viktigt att noga betänka när du utför de RNA extraktioner, att säkerställa att miljön är RNase-gratis under alla RNA hantering steg. Dessutom bör viral bestånd tinade vid 37 ° C i ett vattenbad för 1-2 min och omedelbart sätta på is. Viruset bör dock inte hållas på is, för länge, då, det kan förlora sin smittsamhet.

Tidigare resultat har visat att detta protokoll är mycket bekvämt och anpassningsbar att hantera ett stort antal prover och kan fyllas i relativt mindre tid än andra metoder. Detta protokoll har potential att användas som en användbar analys för framtida ADE studier.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna har inget att deklarera.

Acknowledgments

Detta arbete var generöst stöds av 1R21AI129881-01 (till T.M.C.), start-up medel från de nationella framväxande smittsamma sjukdomar laboratorier, och Boston University School of Medicine.

Materials

Name Company Catalog Number Comments
Fetal Bovine Serum  GEMINI 100-106
iCycler  BioRad 785BR02188 Model No. CFX96 Optics Module
Microfuge 18 Centrifuge Beckman Coulter  367160
Nanodrop-1000 Thermoscientific  1072
Quantifast SYBR-One step RT-PCR kit  Qiagen  204154 Used for 1 step RT-qPCR
RNeasy RNA Isolation Kit  Qiagen  74106 Used for RNA extraction
RPMI-medium  Gibco 11875093

DOWNLOAD MATERIALS LIST

References

  1. Hayes, E. B. Zika virus outside Africa. Emerging Infectious Diseases. 15, 1347-1350 (2009).
  2. Grard, G., et al. Zika virus in Gabon (Central Africa) - 2007: a new threat from Aedes albopictus. PLoS Neglected Tropical Diseases. 8, (2), 2681 (2014).
  3. Fauci, A. S., Morens, D. M. Zika Virus in the Americas--Yet Another Arbovirus Threat. New England Journal of Medicine. 374, (7), 601-604 (2016).
  4. Hawkes, R. A. Enhancement of the Infectivity of Arboviruses by Specific Antisera Produced in Domestic Fowls. Australian Journal of Experimental Biology and Medical Science. 42, 465-482 (1964).
  5. Musso, D., Gubler, D. J. Zika Virus. Clinical Microbiology Reviews. 29, (3), 487-524 (2016).
  6. Vaughn, D. W., et al. Dengue viremia titer, antibody response pattern, and virus serotype correlate with disease severity. The Journal of Infectious Diseases. 181, (1), 2-9 (2000).
  7. Khandia, R., et al. Modulation of Dengue/Zika Virus Pathogenicity by Antibody-Dependent Enhancement and Strategies to Protect Against Enhancement in Zika Virus Infection. Frontiers of Immunology. 9, 597 (2018).
  8. Londono-Renteria, B., et al. A relevant in vitro human model for the study of Zika virus antibody-dependent enhancement. Journal of General Virology. 98, (7), 1702-1712 (2017).
  9. Ganger, M. T., Dietz, G. D., Ewing, S. J. A common base method for analysis of qPCR data and the application of simple blocking in qPCR experiments. BMC Bioinformatics. 18, (1), 534 (2017).
  10. Renn, L. A., et al. High-throughput quantitative real-time RT-PCR assay for determining expression profiles of types I and III interferon subtypes. Journal of Visualized Experiments. (97), e52650 (2015).
  11. McArthur, M. A., et al. Dengue vaccines: recent developments, ongoing challenges and current candidates. Expert Review of Vaccines. 12, (8), 933-953 (2013).
  12. Priyamvada, L., et al. Humoral cross-reactivity between Zika and dengue viruses: implications for protection and pathology. Emerging Microbes and Infections. 6, (5), 33 (2017).
  13. Dai, L., et al. Molecular basis of antibody-mediated neutralization and protection against flavivirus. IUBMB Life. 68, (10), 783-791 (2016).
  14. Dai, L., et al. Structures of the Zika Virus Envelope Protein and Its Complex with a Flavivirus Broadly Protective Antibody. Cell Host & Microbe. 19, (5), 696-704 (2016).
  15. Sirohi, D., et al. The 3.8 A resolution cryo-EM structure of Zika virus. Science. 352, (6284), 467-470 (2016).
  16. George, J., et al. Prior Exposure to Zika Virus Significantly Enhances Peak Dengue-2 Viremia in Rhesus Macaques. Scientific Reports. 7, (1), 10498 (2017).
  17. Morens, D. M., Halstead, S. B. Measurement of antibody-dependent infection enhancement of four dengue virus serotypes by monoclonal and polyclonal antibodies. Journal of General Virology. 71, Pt 12 2909-2914 (1990).
  18. Dejnirattisai, W., et al. Cross-reacting antibodies enhance dengue virus infection in humans. Science. 328, (5979), 745-748 (2010).
  19. Priyamvada, L., et al. Human antibody responses after dengue virus infection are highly cross-reactive to Zika virus. Proceedings of the National Academy of Sciences of the United States of America. 113, (28), 7852-7857 (2016).
  20. Charles, A. S., Christofferson, R. C. Utility of a Dengue-Derived Monoclonal Antibody to Enhance Zika Infection In Vitro. PLoS Currents. 8, (2016).
  21. Swanstrom, J. A., et al. Dengue Virus Envelope Dimer Epitope Monoclonal Antibodies Isolated from Dengue Patients Are Protective against Zika Virus. MBio. 7, (4), (2016).
Kvantifiering av antikroppsberoende förbättring av zikaviruset i primära mänskliga celler
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Asad, S., Feitosa-Suntheimer, F., Gold, A., Londono-Renteria, B., Colpitts, T. M. Quantification of Antibody-dependent Enhancement of the Zika Virus in Primary Human Cells. J. Vis. Exp. (143), e58691, doi:10.3791/58691 (2019).More

Asad, S., Feitosa-Suntheimer, F., Gold, A., Londono-Renteria, B., Colpitts, T. M. Quantification of Antibody-dependent Enhancement of the Zika Virus in Primary Human Cells. J. Vis. Exp. (143), e58691, doi:10.3791/58691 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter