Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Neuroscience

In vivo direkte omprogrammering af residente Gliale celler til Interneuroner ved intracerebral injektion af virale vektorer

doi: 10.3791/59465 Published: June 17, 2019

Summary

Denne protokol har til formål at generere direkte omprogrammeret interneuroner in vivo, ved hjælp af et AAV-baseret viral system i hjernen og en FLEX synapsin-drevet GFP reporter, som giver mulighed for celle identifikation og yderligere analyse in vivo.

Abstract

Konvertering Resident glia i hjernen til funktionelle og subtype-specifikke neuroner in vivo giver et skridt fremad mod udviklingen af alternative celle udskiftning terapier samtidig skabe værktøjer til at studere celle skæbne in situ. Til dato har det været muligt at opnå neuroner via in vivo omprogrammering, men den præcise fænotype af disse neuroner eller hvordan de modne er ikke blevet analyseret i detaljer. I denne protokol beskriver vi en mere effektiv konvertering og celle specifik identifikation af in vivo-omprogrammerede neuroner ved hjælp af et AAV-baseret viral vektorsystem. Vi tilbyder også en protokol til funktionel vurdering af de omprogrammerede cellernes neuronal modning. Ved at injicere flip-excision (FLEX) vektorer, der indeholder omprogrammering og synapsin-driven reporter gener til specifikke celletyper i hjernen, der tjener som mål for celle omprogrammering. Denne teknik giver mulighed for nem identifikation af nyligt omprogrammerede neuroner. Resultaterne viser, at de opnåede reprogrammerede neuroner funktionelt modne over tid, modtage synaptiske kontakter og vise elektrofysiologiske egenskaber af forskellige typer af interneuroner. Ved hjælp af transkriptionsfaktorerne Ascl1, Lmx1a og Nurr1, de fleste af de omprogrammerede celler har egenskaber af hurtigtspiking, parvalbumin-holdige interneuroner.

Introduction

Det overordnede mål med denne metode er effektivt at omdanne hjernen Resident glia in vivo til funktionelle og subtype-specifikke neuroner såsom parvalbumin-udtrykker interneuroner. Dette giver et skridt fremad mod udviklingen af en alternativ celle substitutionsterapi for hjernesygdomme uden behov for en eksogene celle kilde. Det skaber også et værktøj til at studere celle skæbne afbrydere in situ.

Hjernen har kun en begrænset kapacitet til at generere nye neuroner. Derfor, i neurologiske sygdomme, der er behov for eksogene celle kilder til hjernen reparation. Til dette har forskellige kilder til celler været udsat for intens forskning gennem årene, herunder celler fra primær væv, stamcelle-afledte celler og omprogrammerede celler1,2,3. Direkte omprogrammering af residente hjerneceller til neuroner er en nylig tilgang, der kunne give en attraktiv metode til hjerne reparation, da det bruger patientens egne celler til at generere nye neuroner inde i hjernen. Til dato, flere rapporter har vist in vivo omprogrammering gennem viral vektor levering i hjernen4,5,6,78,9 i forskellige hjerneområder såsom cortex, rygmarv, striatum og hjernen5,10,11, samt i intakt og læsioneret hjerne5,8,11,12. Både hæmmende og excitatoriske neuroner er opnået4,8, men den præcise fænotype eller funktionalitet af disse celler er endnu ikke blevet analyseret i detaljer.

I denne protokol beskriver vi en mere effektiv omprogrammering og celle specifik identifikation af in vivo-omprogrammerede neuroner. Vi leverer en protokol til funktionel vurdering af neuronal modning og fænotype karakterisering baseret på funktionalitet og immun histokemiske egenskaber.

Vi brugte en CRE-inducerbar AAV vektor og en GFP Reporter til at identificere in vivo reprogrammerede neuroner. Dette valg af virale vektorer har den fordel, at inficere både dividere og ikke-dividere celler i hjernen, øge antallet af målrettede celler, som et alternativ til brugen af retrovirus7,8. En neuron-specifik synapsin-driven FLEX reporter (GFP), gjorde det muligt for os specifikt at registrere de nyligt genererede neuroner. Tidligere undersøgelser har brugt subtype-specifikke initiativtagere til in vivo omprogrammering7,9, der også giver mulighed for ekspressions genprogrammering gener og journalister i specifikke celletyper. Denne metode kræver imidlertid yderligere identifikation af omprogrammerede neuroner ved post mortem analyse af co-ekspression af reporter og neuronal markører. Brugen af en neuron-specifik reporter, som den, der er beskrevet heri, giver mulighed for en direkte identifikation. Dette giver et direkte bevis på en vellykket konvertering og tillader en levende celle identifikation, der er nødvendig for patch-clamp Elektrofysiologi.

Protocol

Alle forsøgsprocedurer blev gennemført i henhold til EU-direktivet (2010/63/EU) og godkendt af det etiske udvalg for brug af forsøgsdyr ved Lunds Universitet og det svenske landbrugsministerium (Jordbruksverket). Mus er anbragt i en 12 h lys/mørk cyklus med ad libitum adgang til mad og vand.

1. viral vektorer

  1. Kloning, i, AAV vektorer
    1. For at skabe CRE-inducerbare AAV5 vektorer, Indsæt cDNA for GFP, Ascl1, Lmx1a og NR4A2 (Nurr1) i en omvendt retning flankeret af to par Heterotypiske, anti parallelle LoxP flip-excision (FLEX) sekvenser (tabel over materialer). Til cDNA-indsættelse skal du bruge en rygrad som pAAV-CBA-FLEX eller en med en lignende struktur, der indeholder FLEX-sekvenser og en Chicken beta actin (CBA)-promotor.
    2. Indsæt hvert enkelt cDNA (f. eks. Ascl1) i rygraden ved polymerase-kædereaktion (PCR) og begrænsnings enzymer. Express GFP under kontrol af en synapsin promoter og Ascl1, Lmx1a, Nurr1 under kontrol af en allestedsnærværende udtrykt CBA-promotor.
      Bemærk: Sørg for at have endotoksin fri DNA ved hjælp af specifikke endotoksin-fri plasmid DNA isolationssæt.
    3. Udfør sekvensering og begrænsnings analyse på konstrukterne før brug for at kontrollere succesen af klonings trinnet.
  2. AAV5 viral vektor produktion
    Forsigtig: Se lokale retningslinjer for biosikkerhed, når du håndterer adeno-associeret virus (AAV). I Sverige kræver den AAV, der anvendes i denne protokol, biosikkerhedsniveau 2 (BSL-2).
    1. Seed HEK293T celler med standard kultur medier (DMEM + Glutamax + 10% FBS + penicillin (100 e/ml) streptomycin (100 μg/mL), se tabel over materialer) i T175 kolber med en densitet på 3 x 106 celler pr. kolbe. Tegner 5 kolber pr. parti AAV og planlægger 6 batches ad gangen.
    2. Når cellerne når 50-70% konfluency, Forbered følgende mix for transfektering (pr. 175 cm2 kolbe).
      1. I et 50 ml centrifugeglas tilsættes ækvimolære mængder af vektor plasmid og PDG Series Helper plasmid (pDP5, pDP6), med et samlet beløb på 72 μg pr. 175 cm2 kolbe.
      2. Tilsæt Tris-EDTA buffer (TE buffer, 10 mM Tris-HCl, 1 mM EDTA) til en endelig volumen på 144 mL.
      3. Tilsæt ultrarent vand, så den totale volumen bliver 1296 ml og blandes.
      4. Tilsæt 144 μL 2,5 M CaCl2 og bland. Der tilsættes 1,92 μL HEPES-buffer saltvand (HBS) (1,5 mM na2HPO4 , 140 mM NaCl, 50 mm HEPES) til DNA-opløsningen og blandes straks ved vortexing.
      5. Inkuber ved stuetemperatur (RT) for præcis 60 s. Overfør opløsningen til 28 mL medier med frisk cellekultur og bland.
    3. Udskift mediet i kolberne med cellekulturmedium, der indeholder transfektering mix.
    4. Tre dage efter transfection, høst cellerne ved at hælde af thr medium fra kolberne i en engangsbeholder til affald og tilsæt 5 mL høst buffer (EDTA tilsat fosfat-bufferet saltvand, se tabel over materialer, dpbs til en endelig koncentration 5 mm) til en koncentration på 5 mM) i hver kolbe for at tillade celle frigørelse.
    5. Hæld celle opløsningen i et 50 mL centrifugeglas. Tilsæt yderligere 4 mL DPBS til hver kolbe for at skylle de resterende celler og puljen med første celle opløsning. De høstede celler centrifugeres ved 1.000 x g i 5 minutter ved 4 °c.
    6. Efter centrifugering fjernes supernatanten, og pellets opløses i 15 mL lysisbuffer (50 mM Tris-HCl pH 8,5, 150 mM NaCl, 1 mM MgCl2) ved vortexing.
    7. Fryse dem i CO2-is/ethanol bad for 15 min og opbevares i en-20 °c fryser. Tø det høstede celle lysat i et 37 °C vandbad før brug.
  3. AAV5 viral vektor rensning
    1. Udfør AAV rensning ved Iodixanol gradient ultracentrifugering13 og brug ultracentrifuge tætnings slanger med centrifugering ved 350.000 x g i 1 time og 45 min ved rt.
    2. Brug en 10 mL sprøjte med en 18G nål og Indsæt ca. 2 mm under 40/60% fase grænsen med facet opad for at udtrække den AAV-holdige fase. Sørg for at stoppe før du når protein båndet efter 5-6 mL er blevet ekstraheret.
    3. Farveforløbs ekstrakterne opbevares i autoklaveres-glasflasker ved 4 °c. Undgå at opbevare tidspunkter længere end natten over.
    4. Iodixanol-gradient ekstraktet fortyndes 3 gange ved langsomt pipettering i 12 mL Iodixanol Elution (IE) buffer (20 mM Tris-HCl pH 8,0, 15 mM NaCl), mens hvirvlende.
    5. Rense og koncentrere den fortyndede Iodixanol gradient gennem et anionbytnings filter. Skub den langsomt igennem med en hastighed, der ikke er hurtigere end 1 dråbe/s. Skub 3 mL IE-buffer langsomt gennem filteret for at vaske det.
    6. Elute i en centrifugal filterenhed med 1-2 mL elueringsbuffer (20 mM Tris-HCl pH 8.0; 250 mM NaCl). Tilføj DPBS til enheden til en endelig volumen på 4 mL. Centrifugeres ved 2.000 x g ved rt, indtil der er mindre end 0,5 ml tilbage i filteret. Fjern væsken fra bunden af røret, fyld med 4 mL DPBS og centrifuger igen. Gentag dette trin to gange til. Sørg for, at mængden af koncentreret vektor på filteret er ca. 200 μL efter det sidste Centrifugerings trin.
    7. Fjern 200 Μlkoncentreret vektor ved hjælp af en pipette, og skub koncentratet gennem et 0,22 mm filter for at sterilisere det. Aliquot 200 μlinto et 9 mm hætteglas med blokeret Indsæt (tabel over materialer).
      Bemærk: De AAV5 vektorer bestande kan lagres i-80 °C frysere til lang opbevaring, eller ved 4 °C, hvis de anvendes inden for 2 uger.
  4. AAV5 viral vektor titer bestemmelse
    1. Bestem AAV5 titer ved hjælp af standard kvantitativ polymerasekæde reaktion (qPCR) med primere for inverteret Terminal REPEAT (ITR)-sekvens og en 5 ́Fam/3 ́BHQ1-sonde til ITR-sekvens (tabel over materialer). Brug en standardkurve opnået med kendte mængder af ITR indeholdende plasmid. Hver AAV-vektor skal have et interval på 1E+ 14 – 1E+ 15 genom-kopier pr. MILLILITER, hvis ITR-sekvensen anvendes til bestemmelse af titer.
      Bemærk: En vellykket AAV5 virus produktion giver bestande med titre i minimums intervallet 3e+ 13 – 7e+ 13 enheder/ml.

2. injektion af Omprogrammerings faktorer i hjernen

  1. Dyre opsætning, stereotaxisk placering og boring
    Bemærk:Denne protokol fokuserer på brugen af Ascl1, Lmx1a og Nurr1 (ALN) til omprogrammering af NG2 glia til interneuroner. I vores erfaring, kan interneuroner af en lignende fænotype opnås ved hjælp af andre faktor kombinationer11.
    1. Før operationen skal du forberede den virale blanding, der indeholder vektorer CBA-FLEX-Ascl1, CBA-FLEX-Lmx1a, CBA-FLEX-Nurr1 og reporter Vector syn-FLEX-GFP. Hver af de bestande, der er fremstillet i punkt 1, tilsættes til den endelige blanding, således at den endelige virale opløsning har 5% af hver enkelt af de omprogrammerings faktorer (Ascl1, Lmx1a og Nurr1) og 10% af rapporterings konstruktionen (5% A, 5% L, 5% N og 10% GFP).
      Bemærk: De AAV5 vektor blandinger kan opbevares ved 4 °C og opbevares til fremtidig brug in vivo.
    2. Bedøvelse ved hjælp af 2% isofluran i en blanding af luft og nitrogenoxid (N2O) ved et 4:1-forhold. Overvåge dyrets vejrtrækning ved at observere bevægelser af membranen. Under operationen, opretholde anæstesi med 1 – 1.5% isofluran.
      Bemærk: Den beskrevne musemodel består af en musestamme, der specifikt udtrykker CRE i NG2 glia. In vivo omprogrammering kan opnås ved hjælp af forskellige muse stammer, der udtrykker CRE i andre populationer af gliale celler (f. eks astrocytter14).
    3. Når dyret er helt bedøvet (f. eks komplet muskel afslapning og ingen reaktion på en knivspids i foden pad), barberer området omkring indsnit stedet og bringe dyret til den stereotaxiske ramme.
    4. For at opretholde dyrets kropstemperatur under operationen, Fastgør en varmepude til bunden af den stereotaxiske ramme. Placer musen på et rent, tørt papirhåndklæde.
    5. Placer forsigtigt musens hoved i ørepuderne. Hvis den placeres korrekt, skal der ikke observeres nogen lateral bevægelse af hovedet. Indstil den venstre ørestang til 4 mm, før du begynder at placere musen i stereotaksisk rammen.
    6. Fastgør tandstangen på plads, og stram derefter næse stangen. Sørg for, at hovedet ikke bevæger sig i nogen dimension og punkt lige frem (midterlinjen er vinkelret på planet af øre bars). Anvend oftalmisk salve til Øjenværn.
    7. Før begyndelsen af operationen, administrere passende analgesi (f. eks 0,05 mg/kg buprenorphin, subkutan).
    8. Rengør incisionområdet med en vatpind eller en tør gennemblødt med 70% EtOH, uden at nærme sig øjenområdet.
      Bemærk: Til intracerebral viral injektion anvendes en 5 eller 10 mL sprøjte, der er tilpasset med et trukket glas kapillar. Glas kapillærer trækkes ved hjælp af en mikropipette Puller, hvilket resulterer i en kapillar med en meget fin spids, som vil minimere invasivitet af proceduren. For at tilpasse kapillær i sprøjten skal du bruge et stykke gummislange over forbindelsen mellem sprøjtens nål og glasset kapillær og smelte den ved hjælp af en varme kilde (f. eks. en lighter). En tæt forbindelse mellem de to stykker vil sikre, at der ikke er væske lækager under injektionen. Før operationen påbegyndes, testes dette ved at fylde sprøjten med saltvand og skubbe væsken ud af sprøjten.
    9. Lav en indsnit på ca. 0,5-0,8 cm langs midterlinjen af hovedet. Skær gennem både kutane og subkutane lag, med en skalpel.
    10. Udvid hudflapper på hver side af snittet. Rengør snittet af ethvert blod og skrabe de subkutane lag med en vatpind.
    11. Flyt M/L-D/V-armen på den stereotype ramme på plads (over dyret), og fastgør den.
      Bemærk: Den stereotaxiske ramme tillader justering af sprøjten langs anterior/posterior (A/P, Y-aksen), medial/lateral (M/L, X-aksen) og dorsal/ventral (D/V, Z-aksen) akse.
    12. Flyt sprøjten langs den forskellige akse i den stereotype ramme, for at bringe spidsen af glasset kapillær lige over bregma (samlingspunktet, hvor de forskellige kraniets plader mødes).
    13. Sørg for, at kapillar spidsen er helt lige i både A/P-og M/L-flyene. I tilfælde af en tvetydig bregma, tage gennemsnittet af laterale og mellemlinie suturer.
    14. Når spidsen af kapillar er placeret korrekt over bregma, skal du nulstille både M/L-og A/P-værdierne til 0,0 på den digitale koordinat tæller.
    15. For at sikre, at dyrets hoved er i en helt flad position, skal du bruge den digitale koordinat tæller til at måle D/V-koordinat værdien, når A/P-armen er på + 2,0 og-2,0 (M/L = 0,0), samt når M/L-armen er på + 2,0 og-2,0 (A/P = 0,0). Juster højden på tandstang og ørepude i overensstemmelse hermed.
    16. Flyt sprøjten til de ønskede koordinater for injektion af virale vektorer i striatum (A/P = + 1,0; M/L =-2,0, i forhold til bregma).
    17. Løft sprøjten lidt, og ved at kigge på injektionsstedet gennem mikroskopet, bor et hul ved hjælp af en tand øvelse ved injektions koordinaterne. Begynd at bore på stedet, arbejder i cirkulær og blid måde.
      Bemærk: Undlad at lægge for meget nedadgående tryk, da bore-bit skal være skarp nok til at gå gennem knoglen uden yderligere kraft. Undgå lange, vedvarende boring, da dette skaber varme.
    18. Ved afslutningen af boringen kontrolleres det, at dura mater forbliver intakt og eksponeres for injektion.
  2. Klargøring af sprøjte opsætning
    1. Placer et stykke bomuld gaze over det åbne snit og skyl sprøjten med saltvandsopløsning.
    2. Efter skylning, tage en luftboble på 1 – 2 μL, efterfulgt af 1 μL opløsning, der indeholder de virale vektorer, undgå eventuelle utilsigtede bobler. Sørg for, at den virale opløsning let kan visualiseres under luftboblen, mens den injiceres.
  3. Viral injektion
    1. Fjern bomuldsgaze fra over indsnit stedet, og sænk sprøjten ved hjælp af D/V-armen i stereotaksisk frame. Som overfladen af kraniet er nærmede sig, omhyggeligt se gennem mikroskopet og måle D/V niveau af dura mater — det skal bule lidt under forsigtigt tryk.
    2. Mens du rører ved dura mater med spidsen af kapillar, skal du indstille D/V koordinaten til 0,0.
    3. Sænk sprøjten, og langsomt fremad til den ønskede dybde (D/V =-2,7, i forhold til dura mater). Sørg for, at bane er fri for knoglefragmenter, således at ingen bøjning af nålen/kapillær observeres.
      Bemærk: De præsenterede koordinater refererer til en injektion af omprogrammerings faktorerne i striatum af NG2-CRE-mus. Der kan anvendes koordinater svarende til andre hjerneområder. Test altid koordinaterne for injektion først ved hjælp af et farvestof (f. eks. Trypan blå), farvet perle injektion eller en reporter viral vektor før injektion af omprogrammerings faktorer i hjernen af en ny musestamme. Hvis injektion Trypan blå, dyrene skal ofres umiddelbart efter operationen og hjernen dissekeret ud. Friske hjerner kan skæres ved hjælp af en mikrotom, mens frosset, og injektionsstedet bestemmes ved visualisering af farvestof position i hjernen. Hvis test koordinater ved hjælp af farvede perler, er det muligt at bestemme injektionsstedet på perfbrugt og skære hjerner en uge efter injektion. Alternativt kan der anvendes en injektion med en viral vektor, som bærer et reporter-gen, og injektionsstedet, der er bestemt i perfektionet skære hjerner.
    4. 1 μL af den virale opløsning indsprøjtes med en hastighed på 0,4 μL/min. Når hele volumen injiceres, give mulighed for en diffusions periode på 2 min før sprøjten tilbagetrækning.
    5. Efter diffusion trækkes sprøjten langsomt tilbage, indtil spidsen af kapillær er helt ude af hjernen.
    6. Placer et stykke bomuld gaze over såret og skyl sprøjten med saltvandsopløsning.
    7. Flyt M/L-D/V-armen i stereotaksisk-rammen ud af arbejdsområdet.
  4. Sårluknings-og postoperative procedurer
    1. Forsigtigt sutur snittet ved hjælp af sutur tråd.
      Bemærk: Alle sutur tråde, der anvendes i injicerede dyr, skal bortskaffes i et bæger/hætteglas, der indeholder et anti-viral rengøringsmiddel. Den samme opløsning bruges til at rengøre alle overflader omkring operationsområdet, der har været i kontakt med kirurgiske materialer. Alle kirurgiske værktøjer er grundigt vasket og autoklaveret i slutningen af hver kirurgi dag.
    2. Fjern dyret fra det stereo taxiske stel og Placer det i en post-operative Station, som omfatter en ren, opvarmet bur, adgang til mad og vand, og hvor dyret forbliver indtil helt vågen. I denne periode, overvåge dyret tæt, indtil bevidstheden er genvundet.
    3. Undlad at huse opererede dyr med ikke-opererede dyr, indtil førstnævnte fuldt ud er kommet sig efter operationen.
    4. Dagligt føre tilsyn med opererede dyr. Afhængigt af de anvendte suturer skal du sørge for, at de fjernes, hvis det er nødvendigt. Alle dyr fik Bupenorphinum (Temgesic ved 1ml/kg) subkutant som postoperativ pleje.
      Bemærk: Hvis der anvendes den samme sprøjte i to på hinanden følgende dage, skylles den med vand, efterfulgt af ethanol 70% og vand igen. Lad sprøjten være fyldt med vand over natten, for at muliggøre opløsning af eventuelle rester.

3. elektrofysiologiske optagelser

  1. Vævs skive forberedelse til Elektrofysiologi
    Forsigtig: Et veludført vævs præparat er nødvendigt for at opnå gode elektrofysiologiske optagelser. Forbered rummet omhyggeligt og Placer værktøjer til perfusion og dissektion på is.
    1. Forbered iskold og oxygenized (95% O2 og 5% Co2) Krebs løsning til perfusion, dissektion og skæring (Forbered dette på samme dag fra 10x bestanden ved fortynding af stamopløsningen i ultrarent vand og tilsætning af NaHCO3 og glucose). Komponenterne i Krebs opløsningen i mM (efter fortynding til 1x) er: 126 NaCl, 2,5 KCl, 1,2 NaH2po4· H2o, 1,3 mgcl2· 6h2o, og 2,4 CaCl2· 6H2o, 22 NaHCO3, 10 glucose. Juster pH-værdien af opløsningen til 7,4.
    2. Udfør en kalibrering (Vibracheck) for vibratome med et nyt barberblad.
    3. Start køle blokken af vibratome (eller fyld det omgivende kammer med is), fyld skære kammeret med Krebs opløsning til iltning med 95% O2 og 5% Co2 mindst 30 min før brug.
    4. Sæt en Petri skål på is og fyld den med oxygenized Krebs løsning. Anbring kniven, sakse og monteringspladen på is.
      Forsigtig: Bring buret indeholder musen til rummet mindst 1 h før du starter proceduren for akklimatisering. Stress har en negativ indvirkning på tilstanden af hjernevæv sektioner.
    5. Terminalt bedøve musen ved at injicere en overdosis af pentobarbital og lad dyret falde i søvn.  Når blink refleks er ude og dyr ikke reagerer på smerte stimuli, transcardially perfuse dyret med is-kold Krebs løsning til 2-3 min (med en hastighed på 10-20 mL/min).
    6. Hurtigt, men forsigtigt, dissekere hjernen og sætte det på hovedet i den Petri-skål, der er placeret på is (indeholdende Krebs opløsning).
      Bemærk: For at sammenligne den funktionelle modning af de omprogrammerede neuroner, ofre dyrene for optagelser på forskellige tidspunkter post-viral injektion. Vurder fyring egenskaber af forskellige undertyper af neuroner baseret på eksisterende litteratur15 .
    7. Lav en koronal snit langs midten cerebellum og lim denne side på monteringspladen (også iskold) til vibratome skæring.
    8. Dyp den limet hjerne omhyggeligt ind i buffer kammeret i vibratome.
      Forsigtig: Vær omhyggelig med ikke at røre barberbladet for din egen sikkerhed, og så klingen vil forblive kalibreret.
    9. Skæres fra den mest rostrale del af hjernen ned til striatal niveau ved en høj hastighed. Skær derefter striatum coronally ved 275 mm ved langsom hastighed (0,10 mm/s).
    10. Efter hvert snit forsigtigt fjerne den ikke-injicerede striatal side (f. eks, med en Bendt nål) og overføre den injicerede side i et andet hætteglas i et vandbad, der indeholder en bund netto (oxygenized Krebs på RT) placeret i et vandbad. Opbevar dette på RT, indtil alle sektioner er skåret.
    11. Langsomt øge temperaturen af vandbad til 37 °C og lad det i 30 min. Derefter slukke for varmelegeme og Lad køle ned indtil RT.
      Bemærk: på dette tidspunkt kan du holde pause, indtil du starter optagelsen. Afsnittene sidste for 4-6 h.
  2. Hel-celle patch-klemme optagelser
    1. Overfør det første vævs afsnit til optagelses kammeret nedsænket i en kontinuerlig strøm af krebs opløsning. Monter sektionen ved hjælp af lette vægte, og Nedsænk målsætningen.
    2. Identificer striatal-regionen i mikroskopet, og Søg efter GFP-positive (omprogrammerede) neuroner. Vælg en neuron, der er omfattende i morfologi og ikke er dækket af fiber bundter eller blodkar.
    3. Forbered borosilikat glas pipetter (3 – 7 MΩ) til lappe og fyld med følgende intracellulære opløsning (i mm): 122,5 kaliumgluconat, 12,5 KCl, 0,2 EGTA, 10 Hepes, 2 mgatp, 0,3 na3GTP og 8 NaCl, justeret til pH 7,3 med Koh.
    4. For biocytinpåfyldning tilsættes 1 mg biocytinsalt til 1 mL intern opløsning og vortex.
      Forsigtig: Sørg for at filtrere den interne opløsning med biocytinel, da dette ellers kan tilstoppe elektroden.
    5. Fastgør glas pipetten til optage elektroden og dyp i opløsningen. Dobbelttjek elektrodens modstand. Derefter langsomt nærme cellen med pipetten, holde et lille positivt tryk i elektroden for at undgå at tilslutte spidsen.
      Forsigtig: Vær omhyggelig med at holde styr på din celle, mens du er faldende elektroden og ikke at blege fluorescens i cellen (dvs. slukke fluorescens lampe, når du ikke har brug for det).
    6. Skyl det omgivende væv forsigtigt ved hjælp af det positive tryk fra elektroden og nærme cellen med elektroden. Find elektroden lige på toppen af cellen og ned, indtil elektroden touchd membranen. Lav en Giga-Ω tætning mellem elektroden og cellemembranen og med negative trykimpulser, ruptur membranen for at skabe en hel-celle patch.
      Forsigtig: Omprogrammerede neuroner er følsomme. Vær forsigtig, når du lappe og ikke lægger for meget negativt tryk, når du når en Giga-Ω forsegling eller åbning af cellemembranen. Også, lappe på dyr, der er ældre kræver praksis og tålmodighed som deres bindevæv er tykkere, og det er sværere at visualisere neuroner.
    7. Kontroller potentialerne for hvile membranen umiddelbart efter, at de er brudt ind i strøm klemmen, og skriv ned til analyse.
    8. I nuværende klemme, vedligeholde cellen mellem-60 mV til-80 mV og injicere 500 MS strømme fra-20 pA til + 90 pA, med 10 pA intervaller for at inducere action potentialer.
    9. Overfør ind i spændings klemmen og mål den indadvendte natrium og forsinkede rektificerende kalium strømme ved depolariserende trin på 10 mV.
      Bemærk: Spænding-klemme optagelser er bedre vurderet ved hjælp af en anden intern løsning, sammensat af kemikalier, der mere effektivt klemme membranen. Men for omprogrammeret neuroner, antallet af celler, som du kan optage fra er få og antallet af vævs sektioner med disse neuroner er begrænset. Derfor er det en fordel at registrere både i strøm-klemme og spænding-clamp fra den samme celle.
    10. Optag spontan postsynaptisk aktivitet ved-70 mV i spændings klemme tilstand. Skelne hæmmende postsynaptiske hændelser ved et membran potentiale på 0 mV fra excitatoriske hændelser ved-70 mV.
    11. Efter at have nået en stabil baseline, tilsættes Picrotoxin, GABAen receptor antagonist, til Krebs løsning, der strømmer ind i optagelsen kammer, at udtrække excitatoriske hændelser (tilsæt en stamopløsning af picrotoxin til en endelig koncentration på 50 mm i separate buffer sprøjte, der er forbundet til kammeret perfusion. Forbind udstrømningen af buffer fra kammeret til en vakuum pose for sikker bortskaffelse).
    12. Efter 20 min, tilsættes CNQX (20 mM), en AMPA antagonist, til Krebs løsning, der strømmer ind i optagelsen kammer, at blokere de hæmmende hændelser (ved hjælp af samme procedure som for Picrotoxin). Lad i en anden 20 min og derefter vaske ud med Krebs løsning. Fjern vævs afsnittet fra kammeret.
    13. Efter endt optagelser, lave en offline analyse af spontane excitatoriske post-Synaptic strømme (EPSC) og hæmmende post-Synaptic strømme (IPSC) ved hjælp af en tærskel-hændelse opdagelse (> 5 pA) i analyseprogrammet.
    14. Under hele optagelsen bliver cellen langsomt fyldt med den biocytinholdige interne opløsning. Opbevar plasteret i mindst 20 minutter, før du langsomt fjerner elektroden for at opnå fuldstændig fyldning af cellen.
      Forsigtig: Vær omhyggelig med ikke at have et positivt tryk i elektroden, der kan ødelægge den efterfølgende morfologiske analyse af cellerne bagefter.
    15. For biocytin-visualisering sættes vævs sektionen i 4% PARAFORMALDEHYD (PFA) natten over ved 4 °C. Skyl afsnittet i 0,02 M kaliumphosphat buffer (KPBS) med 0,1% Triton. Derefter plette for streptavidin-Cy3 (1:600 i KPBS-T, 2 h), til identifikation af den biocytinfyldte celle og morfologiske visualisering af den omprogrammerede neuron.
      Bemærk: Biocytin påfyldning kan bruges til morfologiske analyse og illustrationer af de lappet neuroner.

4. immunhistokemi, Stereologi og kvantificering

Bemærk: Dedikere en specifik gruppe mus til immun histokemi, da vævs sektioner, der anvendes til Elektrofysiologi, ikke er optimale for immun histokemi.

  1. Anæstetize mus med en IP injektion af en overdosis af pentobarbital og montere dyret for perfusion.
  2. Transcardially perfuse musene, først med en saltvandsopløsning til at fjerne blod, og derefter med iskold 4% PFA.
  3. Dissekere hjernen og post-Fix for mindst 12 h i 4% PFA.
  4. Sæt hjernen i 25% saccharoseopløsning (til kryoprottion) i ca. 12 timer.
    Bemærk: Hjernen er klar til at blive skåret, når de synke i 25% saccharose opløsning, hvilket indikerer, at saccharose har trængt hele muse hjernen.
  5. Lav en koronal snit over cerebellum, bruge den flade, mest hale del af hjernen til at placere hjernen på en mikrotom og ordne det på plads ved hjælp af optimal skæring temperatur sammensatte (OCT).
  6. Skær hjernen i koronalsektion skiver med en tykkelse på 35 mm og opdele hjernen i fortløbende serier placeret i hætteglas eller brønde, der indeholder 0,02 M Kpbs.
  7. Behandl afsnittene for immun histokemi ved hjælp af antistoffer mod gfp og interneuron markører såsom GAD65/67, PV, chat (cholin acetyltransferase) og npy (neuropeptid Y), i henhold til standardprotokoller16, 17.
    Bemærk: Hjerne skiver kan opbevares ved 4 °C eller-20 °C i anti-fryse opløsning i lange perioder.
  8. Når farvningen er færdig, skal du montere sektionerne på et glas skred og dække med en glas dækseddel ved hjælp af en monteringsløsning for at fastgøre den på plads. Lad coveret glide til tørre over natten.
    Bemærk: For vores undersøgelser, hele hjerner er skåret i 1:8 serie (dvs. hvert hætteglas indeholder sektioner vil holde en ottendedel af musen hjernen11).
  9. Analysér afsnittene ved hjælp af en inverteret fluorescens og/eller Konfokal mikroskop.
    Forsigtig: Fluorescerende mikroskopi er nyttig til en generel oversigt over resultater og optagelse af billeder til beregning af omprogrammering effektivitet. For en mere detaljeret analyse af fænotypiske identitet ved observation af dobbelt-positive celler, bør konfokale Imaging anvendes.
  10. For kvantificering af forskellige markører udtrykt i GFP+ neuroner i striatum tælles antallet af dobbelt positive celler i forhold til det samlede antal gfp+- celler (dvs. de omprogrammerede neuroner) i mindst to felter af hver striatal sektion.
  11. Til bestemmelse af det omtrentlige ekstruderede samlede antal omprogrammerede neuroner per hjerne, tælle GFP+ neuroner til stede i striatum af en af hjernen serien skåret tidligere, og derefter multipliceres med det samlede antal serier.
    Bemærk: Forskellige metoder til kvantificering kan bruges til at udtrykke omprogrammering effektivitet, antallet af omprogrammeret neuroner per dyr og procentdel af neuroner, der udtrykker visse fænotypiske markører. Yderligere oplysninger finder du i forrige publikation11.
  12. Analysere forskellene mellem betingelser ved hjælp af graf pad prisme eller lignende.
    Bemærk: Til effektivitets beregning injicerede vi NG2-CRE-mus med de CRE-afhængige ALN-konverterings vektorer og gfp-reporter. For at estimere konverteringseffektiviteten injicerede vi også dyr med en CRE-afhængig GFP under den allestedsnærværende CBA-promotor, der gengiver alle målrettede celler GFP+. Ved hjælp af denne sammenligning vurderede vi, at 66,81% ± 38,38% af målrettede celler omdannet til neuroner. Til validering af ekspression af hvert af generne kan der udføres supplerende dobbelt Immunofluorescent farvning for GFP/Ascl1, GFP/Lmx1a og GFP/Nurr1. Derudover kan genom-sekvensering, såsom enkelt celle-RNA-sekvensering, afsløre tilstedeværelsen af hvert af de genprogrammerede cellers gener.

Representative Results

Injektion af AAV-vektorer bruges til at omprogrammere residente NG2 glia-celler til neuroner i NG2-CRE-muse striatum (figur 1a). For specifikt at målrette NG2 glia, er FLEX vektorer med omprogrammering/reporter gener indsat i en antisense retning og flankeret af to par anti parallelle, Heterotypiske loxP sites (figur 1b). Hver af de tre omprogrammerings gener (Ascl1, Lmx1a og Nurr1) er placeret under kontrol af den allestedsnærværende CBA-promotor på individuelle vektorer. For at sikre, at GFP-udtrykket er begrænset til omprogrammerede neuroner, der stammer fra en CRE-ekspressig celle, er GFP placeret under kontrol af den neuron-specifikke synapsin-promotor (også i en FLEX-vektor).

Brugen af kombinationen af omprogrammering og reporter konstruktioner giver mulighed for generering af GFP-positive neuroner i musens striatum (figur 1c, C '). Brugen af reporter konstruere uden tilstedeværelsen af omprogrammering gener ikke giver GFP-positive neuroner (figur 1d).

De omprogrammerede neuroner, der er biocytinfyldte, er synlige efter post mortem-immuno-farvning (figur 2a). Hvis konvertering er vellykket, bør der være omfattende neuronal morfologi. De elektrofysiologiske optagelser af omprogrammerede neuroner viser tilstedeværelsen af postsynaptiske funktionelle forbindelser med spontane aktivitets foranstaltninger (figur 2b, C). Dette kan blokeres med enten ionotropic GABAergic eller glutamatergic blokker (picrotoxin eller cnqx), tyder både excitatoriske og hæmmende synaptisk input til de omprogrammerede neuroner. Forekomsten af spontan aktivitet stiger med tiden efter viral injektion (figur 2D), hvilket indikerer en gradvis modning.

Nuværende-induceret action potentialer er til stede i funktionelle neuroner. Aktions potentialerne øges i antal over tid efter omregning (figur 2E). Dette indikerer yderligere modning i neuronal funktion. I en umoden Neuron, vil strømmen fremkalde enten ingen eller meget få aktionspotentialer (figur 2F).

De fyring mønstre af en neuron er celletype specifik, da det afhænger af faktorer såsom morfologi af cellerne og kanal udtryk15. De registrerede mønstre i in vivo-omprogrammerede neuroner kan opdeles i grupper og sammenlignes med endogene neuronal subtypes, fx hurtigtspiking interneuroner (celle type B, figur 3b) eller andre celletyper (figur 3a, C, D ). De observerede elektrofysiologiske forskelle kan bekræftes ved tilstedeværelsen af specifikke subtype markører og co-Expression med GFP (figur 3E-H). Tilsammen indikerer disse data, at de omprogrammerede neuroner i striatum har egenskaber af forskellige typer af interneuroner, såsom Parvalbumin-, ChAt-og NPY-ekspanderende interneuroner, samt striatal medium spiny neuron identitet (DARPP32 +) ( Figur 3E -H).

Figure 1
Figur 1: in vivo omprogrammering af Resident NG2 glia til neuroner. A) skematisk gengivelse af AAV-virusmedieret in vivo-omprogrammering af STRIATAL NG2 glia. B) skematisk gengivelse af AAV5-Flex-konstruktioner, der anvendes til in vivo-omprogrammering, hvor genekspression reguleres af CRE-udtryk i målcellerne. (C og c ') in vivo omprogrammerede neuroner, som følge af syn-GFP + ALN injektion i striatum. D) fravær af omprogrammerede neuroner, når der ikke tilsættes omprogrammerings faktorer til viral cocktail, og kun reporter-konstruktionen injiceres in vivo. Skala stænger = 100 mm (C), 25 mm (C '), 25 mm (D). Venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2: in vivo omprogrammerede neuroner er funktionelle og viser modning over tid. (A) biocytinfyldt omprogrammeret Neuron, viser moden neuronal morfologi, herunder dendritiske spines. Traces viser (B) inhiberende (gabaerge) aktivitet, der er blokeret med picrotoxin, en GABAen receptor antagonist og (C) excitatoriske aktivitet, der er blokeret med cnqx, en AMPA-receptor antagonist. (D) antallet af neuroner med postsynaptisk aktivitet stiger over tid. (E) lappet neuroner vise gentagne fyring allerede på 5 uger efter injektion (w.p.i.) og fortsætte med at vise, at ved 8 og 12 w.p.i. (F) nuværende-induceret virknings potentiale og postsynaptisk aktivitet af en umoden Neuron, viser få synaptisk begivenheder og få aktionspotentialer sammenlignet med B og D. Scale bar = 25 mm Klik her for at se en større version af dette tal.

Figure 3
Figur 3: in vivo omprogrammerede neuroner udviser immun histokemiske og elektrofysiologiske egenskaber af striatal interneuroner. (A-D) Fyring mønstre af in vivo omprogrammerede neuroner kan være af forskellige typer: (a) type A svarer til endogene medium spiny neuron (DARPP32 +); (B) svarende til hurtigtspiking (PV +) interneuroner; (C) ligner lavtærskel spiking neuroner med fremtrædende sag (npy +); D) neuroner, som fyres med stor efter-hyperpolarisering (chat +). (E-H) Konfokale billeder, der viser samlokalisering af GFP og interneuron-markører PV (E), ChAT (F), npy (G) og Projection neuron Marker DARPP32 (H). Alle skala stænger = 50 mm. Klik her for at se en større version af dette tal.

Discussion

In vivo direkte omprogrammering kan opnås ved hjælp af AAV FLEX vektorer i CRE-udtrykke muse stammer. Det er vigtigt at bemærke, at forskelle mellem muse stammer med hensyn til omprogrammering effekt er blevet observeret. For in vivo omprogrammering i striatum har NG2-CRE-muse linjen vist sig at være mere effektiv sammenlignet med andre stammer. Før du begynder at bruge en ny dyrestamme, er det vigtigt at kontrollere musen udbyder retningslinjer vedrørende CRE udtryk over tid, da dyrenes alder ofte påvirker specificiteten af dette protein udtryk. I vores studier blev dyr over 12 uger ikke anvendt til in vivo-omprogrammering, da der var en risiko for CRE-ekspression i andre celler end NG2 glia. Den konstante tilstedeværelse og overvågning af kontroldyr injiceres kun med Synapsin-FLEX-GFP konstruktion tilrådes. Dette gør det muligt at overvåge dyrene for GFP-positive celler, der ikke bør være til stede, hvis der ikke anvendes genprogrammerings gener (ALN).

For at identificere de nyligt omprogrammerede neuroner er en neuron-specifik identifikationsmetode som den, der er beskrevet i denne protokol, af allerstørste vigtighed. Dette giver mulighed for en korrekt identifikation og skelnen af de omprogrammerede neuroner fra de endogene omgivende celler, der er af særlig relevans, når omprogrammering i en homotopic region.

Det er også vigtigt at målrette den korrekte struktur for viral injektion. Derfor er den stereotaxiske kirurgi for viral injektion vigtig og skal gribes an med nøjagtighed, især når de er rettet mod mindre strukturer i hjernen.

Vi har tidligere vist11 , at det ikke er pålideligt at forudsige resultatet af in vivo omprogrammering baseret på in vitro omprogrammering eksperimenter ved hjælp af de samme omprogrammering faktorer. Alle interesse faktorer skal derfor testes in vivo. I vores hænder giver mange forskellige faktor kombinationer den samme subtype af neuroner (dvs. interneuroner11 in vivo) på trods af, at disse gener har været impliceret i udviklingen af andre neuroner.

Helcelle patch klemme til omprogrammerede neuroner er en delikat teknik og vævs behandling er vigtig for et godt resultat. Perfusion med Ice-Cold Krebs løsning forbedrer vævs kvaliteten. Også, lappet neuroner skal behandles omhyggeligt. Selv om modning og fænotypisk identitet af omprogrammerede neuroner kan vurderes noget ved hjælp af hele cellen patch clamp, disse celler er ikke fuldt ud sammenlignelige med deres endogene modparter. Yderligere analysetyper, såsom genom-sekvensering (f. eks. RNA-sekvensering), bør anvendes til yderligere at bekræfte omprogrammeret celle identitet.

Den teknik, der er beskrevet heri, kan overvejes til udvikling af fremtidige terapier, hvor neuronal udskiftning er nødvendig i hjernen. Selv om in vivo omprogrammering er stadig på sit tidlige stadier, og oversættelsen til mennesker er endnu ikke forudset, denne teknik kan give en metode til at vurdere eksogene gen funktion i hjernen og studere celle modning in vivo.

Disclosures

Forfatterne har intet at afsløre.

Acknowledgments

Marcella Birtele er blevet finansieret af den Europæiske Unions Horisont 2020 program (Horisont 2020-MSCA-ITN-2015) under Marie Skłodowska-Curie innovative uddannelsesnet og tilskudsaftale nr. 676408. Daniella Rylander Ottosson er blevet finansieret af det svenske Forskningsråd (2017-01234).

Materials

Name Company Catalog Number Comments
REAGENTS FOR AAV5 CLONING AND VIRAL VECTOR PREPARATION
pAAV-CA-FLEX AddGene 38042
Ascl1 AddGene 67291 NM_008553.4
Lmx1a AddGene 33013 NM_0033652.5
Nurr1 AddGene 35000 NM_013613.2
GFP-syn AddGene 30456
LoxP (FLEX) sequence 1 GATCTccataacttcgtataaagtatcctatac
gaagttatatcaaaataggaagaccaatgcttc
accatcgacccgaattgccaagcatcaccatcg
acccataacttcgtataatgtatgctatacgaa
gttatactagtcccgggaaggcgaagacgcgga
agaggctctaga
LoxP (FLEX) sequences 2 tactagtataacttcgtataggatactttatac
gaagttatcattgggattcttcctattttgatc
caagcatcaccatcgaccctctagtccacatct
caccatcgacccataacttcgtatagcatacat
tatacgaagttatgtccctcgaagaggttcgaa
ttcgtttaaacGGTACCCTCGAC
pDP5 Plasmid Factory PF435
pDP6 Plasmid Factory PF436
Phosphate-Buffered Saline (PBS) Thermo Fisher Scientific 10010023
FBS (Fetal bovine serum) Thermo Fisher Scientific 10500064
Penicillin streptomycin Thermo Fisher Scientific 15140122
DMEM (Dulbecco's Modified Eagle Medium)+ Glutamax Thermo Fisher Scientific 61965026
DPBS (Dulbecco's Phosphate Buffer Saline) Thermo Fisher Scientific 14190094
HEK293 cells Thermo Fisher Scientific 85120602-1VL
Flasks BD Falcon 10078780 175 cm2
Tris H-CL Sigma Aldrich 10812846001 For TE buffer use 10 mM, pH 8.0; for lysis buffer use 50mM, pH 8.5; for IE buffer use 20 mM, pH 8.0; for elution buffer use 20 mM, pH 8.0
EDTA EDTA: Invitrogen EDTA: AM9260G For TE buffer use 1 mM EDTA
Ultrapure water see Ultrapure water system
CaCl2 SigmaAldrich C5080 2.5 M
Dulbecco´s phosphate-buffered saline (DPBS) Thermo Fisher Scientific 14190136
NaCl Sigma-Aldrich S3014 FOR HBS use 140 mM; for Lysis Buffer use 150 mM; for IE buffer use 15 mM; for elution buffer use 250 mM
MgCl2 Sigma-Aldrich M8266-100G For lysis Buffer: 1 mM
Ultracentrifuge sealing tubes Beckman Coulter Quick-Seal® Polypropylene Tube
OptiPrep™ Density Gradient Medium Sigma Aldrich D1556-250ML
10-mL syringe-18G needle BD 305064
Laboratory glass bottles VWR ?
Anion exchange filter PALL laboratory MSTG25Q6 Acrodisc unit with Mustang Q membrane
Centrifugal filter unit Merck Z740210-24EA Amicon Ultra-4 device
Endotoxin-Free Plasmid DNA Isolation Kits Thermo Fisher Scientific A33073
Na2PO4 Sigma-Aldrich S7907
HEPES Sigma-Aldrich H7523 15 mL
Falcon tube Thermo Fisher Scientific Corning 352196
Falcon tube Thermo Fisher Scientific Corning 352070
Glass Vials Novatech 30209-1232 CGGCCTCAGFGAGCGA
Forward Primer for Inverted Terminal Repeat (ITR) sequence GGAACCCCTAGTGATGGAGTT
Reverse Primer for Inverted Terminal Repeat (ITR) sequence CACTCCCTCTCTGCGCGCTCG
5´FAM / 3´BHQ1 probe Jena Bioscience
0.22 mm filter Merck SLGV004SL Millex-GV filter
EQUIPMENT AAV5 VIRAL VECTOR PREPARATION
Freezer -20 °C
Freezer -80 °C
Fridge +4 °C
AAV viral room
Ultrapure Water system Merck Milli-Q® IQ 7000
Vortex mixer VWR 444-0004
Ultracentrifuge Beckman Coulter Beckman Optima LE-80K Ultracentrifuge
Autoclave Tuttnauer 2540 EL
Polymerase Chain Reaction (PCR) BioRad C1000 Touch Thermal Cycler
Quantitative PCR (qPCR) Roche LightCycler® 480 System
Centrifuge Thermo Fisher Scientific Sorvall ST16
Water Bath Thermo Fisher Scientific TSGP02
ANIMAL MODEL
NG2-Cre mice Jackson NG2-CrexB6129, Stock #008533
REAGENTS FOR INJECTION OF REPROGRAMMING FACTORS INTO THE BRAIN
Water
Saline Apoteket AB 70%
Ethanol Solveco
Isolfurane Apoteket AB Dilute to 1% solution with warm water.
Virkon Viroderm 7511 
Pentobarbital Apoteket AB P0500000 i.p. for terminal procedure at the dose of 60 mg/ml.
Sucrose Merck S0389-500G
Trypan Blu Thermo Fisher Scientific 15250061
Retrobeads Lumafluor R170
Buprenorphine Apoteket AB
EQUIPMENT FOR INJECTION OF REPROGRAMMING FACTORS INTO THE BRAIN From RSG Solingen.
Scissors VWR 233-1552 From Biochem.
Tweezers VWR 232-0007
Forcep VWR 232-0120
Scalpel holder VWR RSGA106.621 Number 20.
Scalpel VWR RSGA106.200
Stereotaxic frame Stoelting Europe 51500D
Mouse ear bars Stoelting Europe 51648 5 ul
Syringe with Removable needle Hamilton Company 65 0,75 inner diameter and 1.5 outer diameter.
Glass capilaries Stoelting 50811
Glass capillary puller Sutter company P-1000
Dental drill Agnthos AB 1464
Shaver Agnthos AB GT420
Isoflurane Chamber and pump Agnthos AB 8323101 2 mL
Syringes Merck Z118400-30EA 25G
Needles Merck Z192414 Aldrich
Mouse and neonatal rat adaptor for stereotaxic fram Stoelting 51625
Heating pad Braintree scientific, inc 53800M From Covidien 2187.
Cotton gauze Fisher Scientific 22-037-902
Rubber tube Elfa Distrelec HFT-A-9.5/4.8 PO-X BK 150
Cotton swabs Fisher Scientific 18-366-473
REAGENTS FOR WHOLE-CELL PATCH CLAMP RECORDINGS
NaCl Sigma-Aldrich S3014
KCl Sigma-Aldrich P9333
NaH2PO4-H2O Sigma-Aldrich S9638
MgCl2-6 H2O Sigma-Aldrich M2670
CaCl2-6 H2O Sigma-Aldrich C8106
MgSO4-7 H2O Sigma-Aldrich 230391
NaHCO3 Sigma-Aldrich S5761
Glucose Sigma-Aldrich G7021 see Ultrapure Water system
Ultrapure Water Prepare 1 or 2M.
KOH Sigma-Aldrich P5958-500G
K-D-gluconate Sigma-Aldrich G4500 Sigma
KCl Sigma-Aldrich P9541
KOH-EGTA (Etilene glycol-bis-N-tetracetic acid) Sigma-Aldrich E3889 Sigma
KOH- Hepes acid (N-2-hydroxyethylpiperazine-N’-2-ethanesulfonic acid) Sigma-Aldrich H7523
NaCl Sigma-Aldrich S3014
Mg2ATP Sigma-Aldrich A9187
Na3GTP Sigma-Aldrich G8877
Biocytin Sigma-Aldrich B4261
Picrotoxin Merck P1675 Sigma
CNQX Merck C239 Sigma
Ice
EQUIPMENT FOR WHOLE-CELL PATCH CLAMP RECORDINGS
Borosilicate glass pipette Sutter Company B150-86-10
Glass capillary puller Sutter company P-1000
Vibratome Leica Leica VT1000 S
WaterBath Thermo Fisher Scientific TSGP02
Clampfit software Molecular Devices
Multiclamp software Molecular Devices
REAGENTS FOR IMMUNOHISTOCHEMISTRY Use at a concentration of 4%. CAUTION: PFA is a potent fixative. Avoid ingestion and contact with skin.
Paraformaldehyde (PFA) Merck Millipore 1040051000 Use at a concentration of 0.1%.
Triton X-100 Fisher Scientific 10254640 Donkey.Use at a concentration of 1 : 400.
Serum Merck Millipore S30-100ML Reconstitute the powder in Milli-Q water to 1 mg/mL. Aliquot and store at -20°C, light sensitive. Use at a concentration of 1 : 500.
4′,6-Diamidino-2′-phenylindole dihydrochloride (DAPI) Sigma Aldrich D9542 1: 600 in KPBS-T.
streptavidin- Cy3 Thermo Fisher Scientific 434315 1:5000, rabbit.
Anti-GAD65/67 Abcam 1:2000, mouse.
Anti-PV Sigma P3088 1:200, goat.
Anti-Chat Merk AB143 1:5000, rabbit.
Anti-NPY Immunostar 22940
K2HPO4 Sigma-Aldrich P3786
NaCl Sigma-Aldrich S3014
KH2PO4 Sigma-Aldrich NIST200B 1:1000, chicken.
Anti-GFP Abcam ab13970
Mounting solution Merck 10981 Polyvinyl alcohol mounting medium with DABCO®, antifading
OCT Agar Scientific
Glycerol Sigma-Aldrich G9012-100ML
Distilled water
Anti-freeze solution Tissue Pro Technology AFS05-1000N, 1000 mL/ea.
EQUIPMENT FOR IMMUNOHISTOCHEMISTRY
Inverted fluorescence microscope Leica DMI6000 B
Confocal microscope Leica TCS SP8 laser scanning confocal microscope.
Prism GraphPad
Microtome Leica SM2010R

DOWNLOAD MATERIALS LIST

References

  1. Barker, R. A., Parmar, M., Studer, L., Takahashi, J. Human Trials of Stem Cell-Derived Dopamine Neurons for Parkinson's Disease: Dawn of a New Era. Cell Stem Cell. 21, (5), 569-573 (2017).
  2. Southwell, D. G., et al. Interneurons from embryonic development to cell-based therapy. Science. 344, (6180), 1240622 (2014).
  3. Parmar, M., Torper, O., Drouin-Ouellet, J. Cell-based therapy for Parkinson's disease: A journey through decades toward the light side of the Force. European Journal of Neuroscience. (2018).
  4. Torper, O., et al. In Vivo Reprogramming of Striatal NG2 Glia into Functional Neurons that Integrate into Local Host Circuitry. Cell Reports. 12, (3), 474-481 (2015).
  5. Su, Z., Niu, W., Liu, M. L., Zou, Y., Zhang, C. L. In vivo conversion of astrocytes to neurons in the injured adult spinal cord. Nature Communication. 5, 3338 (2014).
  6. Liu, Y., et al. Ascl1 Converts Dorsal Midbrain Astrocytes into Functional Neurons In Vivo. Journal of Neuroscience. 35, (25), 9336-9355 (2015).
  7. Guo, Z., et al. In vivo direct reprogramming of reactive glial cells into functional neurons after brain injury and in an Alzheimer's disease model. Cell Stem Cell. 14, (2), 188-202 (2014).
  8. Grande, A., et al. Environmental impact on direct neuronal reprogramming in vivo in the adult brain. Nature Communication. 4, 2373 (2013).
  9. Niu, W., et al. In vivo reprogramming of astrocytes to neuroblasts in the adult brain. Nature Cell Biology. 15, (10), 1164-1175 (2013).
  10. Weinberg, M. S., Criswell, H. E., Powell, S. K., Bhatt, A. P., McCown, T. J. Viral Vector Reprogramming of Adult Resident Striatal Oligodendrocytes into Functional Neurons. Molecular Therapy. 25, (4), 928-934 (2017).
  11. Pereira, M., et al. Direct Reprogramming of Resident NG2 Glia into Neurons with Properties of Fast-Spiking Parvalbumin-Containing Interneurons. Stem Cell Reports. 9, (3), 742-751 (2017).
  12. Rivetti di Val Cervo, P., et al. Induction of functional dopamine neurons from human astrocytes in vitro and mouse astrocytes in a Parkinson's disease model. Nature Biotechnology. 35, (5), 444-452 (2017).
  13. Crosson, S. M., Dib, P., Smith, J. K., Zolotukhin, S. Helper-free Production of Laboratory Grade AAV and Purification by Iodixanol Density Gradient Centrifugation. Molecular Therapy Methods & Clinial Development. 10, 1-7 (2018).
  14. Torper, O., et al. Generation of induced neurons via direct conversion in vivo. Proceedings of the National Academy of Sciences of the United States of America. 110, (17), 7038-7043 (2013).
  15. Kawaguchi, Y., Kubota, Y. Correlation of physiological subgroupings of nonpyramidal cells with parvalbumin- and calbindinD28k-immunoreactive neurons in layer V of rat frontal cortex. Journal of Neurophysiology. 70, (1), 387-396 (1993).
  16. Grealish, S., et al. The A9 dopamine neuron component in grafts of ventral mesencephalon is an important determinant for recovery of motor function in a rat model of Parkinson's disease. Brain. 133, (Pt 2), 482-495 (2010).
  17. Thompson, L., Barraud, P., Andersson, E., Kirik, D., Bjorklund, A. Identification of dopaminergic neurons of nigral and ventral tegmental area subtypes in grafts of fetal ventral mesencephalon based on cell morphology, protein expression, and efferent projections. Journal of Neuroscience. 25, (27), 6467-6477 (2005).
In vivo direkte omprogrammering af residente Gliale celler til Interneuroner ved intracerebral injektion af virale vektorer
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Pereira, M., Birtele, M., Rylander Ottosson, D. In Vivo Direct Reprogramming of Resident Glial Cells into Interneurons by Intracerebral Injection of Viral Vectors. J. Vis. Exp. (148), e59465, doi:10.3791/59465 (2019).More

Pereira, M., Birtele, M., Rylander Ottosson, D. In Vivo Direct Reprogramming of Resident Glial Cells into Interneurons by Intracerebral Injection of Viral Vectors. J. Vis. Exp. (148), e59465, doi:10.3791/59465 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter