Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Neuroscience

In Vivo Reprogrammation directe des cellules gliales résidentes en interneurones par injection intracérébrale de vecteurs viraux

doi: 10.3791/59465 Published: June 17, 2019

Summary

Ce protocole vise à générer des interneurones directement reprogrammés in vivo, à l'aide d'un système viral à base d'AAV dans le cerveau et d'un journaliste GFP piloté par la synapsine FLEX, qui permet l'identification cellulaire et une analyse plus approfondie in vivo.

Abstract

La conversion des glies résidentes dans le cerveau en neurones fonctionnels et spécifiques au sous-type in vivo permet de faire un pas en avant vers le développement de thérapies alternatives de remplacement cellulaire tout en créant des outils pour étudier le destin cellulaire in situ. Jusqu'à présent, il a été possible d'obtenir des neurones par reprogrammation in vivo, mais le phénotype précis de ces neurones ou comment ils mûrissent n'a pas été analysé en détail. Dans ce protocole, nous décrivons une conversion plus efficace et une identification cellulaire spécifique des neurones reprogrammés in vivo, à l'aide d'un système vectorielle virale basé sur l'AAV. Nous fournissons également un protocole pour l'évaluation fonctionnelle de la maturation neuronale des cellules reprogrammées. En injectant des vecteurs flip-excision (FLEX), contenant les gènes de la reprogrammation et de la synapsine à des types de cellules spécifiques dans le cerveau qui servent de cible pour la reprogrammation cellulaire. Cette technique permet d'identifier facilement les neurones nouvellement reprogrammés. Les résultats montrent que les neurones reprogrammés obtenus mûrissent fonctionnellement au fil du temps, reçoivent des contacts synaptiques et montrent des propriétés électrophysiologiques de différents types d'interneurones. En utilisant les facteurs de transcription Ascl1, Lmx1a et Nurr1, la majorité des cellules reprogrammées ont des propriétés d'interneurons à pointe rapide et contenant de la parvalbumine.

Introduction

L'objectif global de cette méthode est de convertir efficacement les gliales résidentes du cerveau in vivo en neurones fonctionnels et spécifiques au sous-type tels que les interneurons exprimant la parvalbumine. Ceci fournit un pas en avant vers le développement d'une thérapie alternative de remplacement de cellules pour des maladies de cerveau sans avoir besoin d'une source exogène de cellules. Il crée également un outil pour étudier les commutateurs de destin cellulaire in situ.

Le cerveau n'a qu'une capacité limitée pour générer de nouveaux neurones. Par conséquent, dans les maladies neurologiques, il ya un besoin de sources cellulaires exogènes pour la réparation du cerveau. Pour cela, différentes sources de cellules ont fait l'objet d'intenses recherches au fil des ans, y compris des cellules provenant de tissus primaires, de cellules souches dérivées et de cellules reprogrammées1,2,3. La reprogrammation directe des cellules cérébrales résidentes en neurones est une approche récente qui pourrait fournir une méthode attrayante pour la réparation du cerveau car elle utilise les propres cellules du patient pour générer de nouveaux neurones à l'intérieur du cerveau. À ce jour, plusieurs rapports ont montré la reprogrammation in vivo par la livraison de vecteurs viraux dans le cerveau4,6,6,78,9 dans différentes régions du cerveau telles que le cortex, la moelle épinière, le striatum et le midbrain5,10,11, ainsi que dans le cerveau intact et lesioned5,8,11,12. Les neurones inhibiteurs et excitateurs ont été obtenus4,8, mais le phénotype précis ou la fonctionnalité de ces cellules n'a pas encore été analysé en détail.

Dans ce protocole, nous décrivons une reprogrammation plus efficace et l'identification cellulaire-spécifique des neurones reprogrammés in vivo. Nous fournissons un protocole pour l'évaluation fonctionnelle de la maturation neuronale et de la caractérisation de phénotype basée sur la fonctionnalité et les traits immunohistochemical.

Nous avons utilisé un vecteur AAV inductible et un journaliste GFP pour identifier les neurones reprogrammés in vivo. Ce choix de vecteurs viraux a l'avantage d'infecter à la fois les cellules de division et de non-division du cerveau, en augmentant le nombre de cellules ciblées, comme une alternative à l'utilisation du rétrovirus7,8. Un journaliste FLEX (GFP) piloté par la synapsine spécifique aux neurones nous a permis de détecter spécifiquement les neurones nouvellement générés. Des études antérieures ont utilisé des promoteurs spécifiques au sous-type pour la reprogrammation in vivo7,9, qui permettent également l'expression de gènes de reprogrammation et de journalistes dans des types de cellules spécifiques. Cependant, cette méthode exige une identification plus poussée des neurones reprogrammés par l'analyse post mortem de la co-expression des marqueurs de journaliste et neuronal. L'utilisation d'un journaliste spécifique aux neurones, comme celui décrit ci-contre, permet une identification directe. Ceci fournit une preuve directe d'une conversion réussie et permet une identification de cellules vivantes qui est exigée pour l'électrophysiologie de correction-clamp.

Protocol

Toutes les procédures expérimentales ont été réalisées dans le cadre de la directive de l'Union européenne (2010/63/UE) et approuvées par le comité d'éthique pour l'utilisation d'animaux de laboratoire à l'Université de Lund et le Département suédois de l'agriculture (Jordbruksverket). Les souris sont logées dans un cycle clair/sombre de 12 h avec un accès ad libitum à la nourriture et à l'eau.

1. Vecteurs viraux

  1. Clonage des vecteurs AAV
    1. Pour créer des vecteurs AAV5 inductibles, insérez l'ADNc pour les séquences GFP, Ascl1, Lmx1a et NR4A2 (Nurr1) dans une orientation inverse flanquée de deux paires de séquences de flip-excision LoxP (FLEX) hétérotypiques et antiparallèles (Tableaudes Matériaux). Pour l'insertion de l'ADNc, utilisez une colonne vertébrale comme pAAV-Cba-FLEX ou une colonne ayant une structure similaire, contenant des séquences FLEX et un promoteur de bêta-actine de poulet (CBA).
    2. Insérez chaque aDNc unique (p. ex. Ascl1) dans l'épine dorsale par réaction en chaîne de polymérase (PCR) et enzymes de restriction. Express GFP sous le contrôle d'un promoteur de synapsin et Ascl1, Lmx1a, Nurr1 sous le contrôle d'un promoteur de l'ABC omniprésente exprimée.
      REMARQUE: Assurez-vous d'avoir de l'ADN sans endotoxine à l'aide de kits d'isolement de Plasmide sans endotoxines spécifiques.
    3. Effectuer l'analyse de séquençage et de restriction sur les constructions avant utilisation, afin de vérifier le succès de l'étape de clonage.
  2. Production de vecteurs viraux AAV5
    MISE EN GARDE: Consultez les lignes directrices locales en matière de biosécurité lorsque vous manipulez un virus adéno-associé (AAV). En Suède, l'AAV utilisé dans ce protocole nécessite le niveau de biosécurité 2 (BSL-2).
    1. Cellules HEK293T de semences avec des supports de culture standard (DMEM-Glutamax - 10% FBS - pénicilline (100 U/ml) streptomycine (100 g/mL), voir Table of Materials) en flacons T175 à une densité de 3 x 106 cellules par flacon. Comptez 5 flacons par lot d'AAV et planifiez 6 lots à la fois.
    2. Lorsque les cellules atteignent 50-70% de confluence, préparer le mélange suivant pour la transfection (par 175 cm2 flacon).
      1. Dans un tube centrifugeur de 50 ml, ajouter des quantités équimolaires de plasmide vectoriel et de plasmide d'aide de la série pDG (pDP5, pDP6), avec une quantité totale de 72 g par 175 cm2 flacons.
      2. Ajouter le tampon Tris-EDTA (tampon TE, 10 mM Tris-HCl, 1 mM EDTA) à un volume final de 144 ml.
      3. Ajouter de l'eau ultrapure pour que le volume total devienne 1296 ml et mélanger.
      4. Ajouter 144 l de 2,5 M CaCl2 et mélanger. Ajouter 1,92 l de Saline tamponnée HEPES (HBS) (1,5 mM Na2HPO4 ,140 mM NaCl, 50 mM HEPES) à la solution d'ADN et mélanger immédiatement par vortex.
      5. Incuber à température ambiante (RT) pour exactement 60 s. Transférer la solution à 28 ml de culture cellulaire fraîche et mélanger.
    3. Remplacer le milieu dans les flacons par un milieu de culture cellulaire contenant un mélange de transfection.
    4. Trois jours après la transfection, récolter les cellules en versant le milieu thr des flacons dans un récipient jetable pour les déchets et ajouter 5 ml de tampon de récolte (EDTA ajouté à phosphate-Tamponed Saline, voir Tableau des matériaux, DPBS à une concentration finale de 5 mm) à une concentration de 5 mm) dans chaque flacon pour permettre le détachement cellulaire.
    5. Verser la solution cellulaire dans un tube centrifugeur de 50 ml. Ajouter 4 ml de DPBS à chaque flacon pour rincer les cellules restantes et mettre en commun avec la première solution cellulaire. Centrifuger les cellules récoltées à 1 000 x g pendant 5 min à 4 oC.
    6. Après centrifugation, retirer le supernatant et dissoudre les granulés dans 15 ml de tampon de lyse (50 mM Tris-HCl pH 8,5, 150 mM NaCl, 1 mM MgCl2) par vortex.
    7. Congelez-les dans un bain CO 2-glace/éthanol pendant 15 min et conservez-les dans un congélateur de -20 oC. Décongeler le lysate de la cellule récoltée dans un bain d'eau de 37 oC avant utilisation.
  3. Purification du vecteur viral AAV5
    1. Effectuer la purification AAV par Iodixanol Gradient Ultracentrifugation13 et utiliser des tubes d'étanchéité ultracentrifuge avec centrifugation à 350 000 x g pendant 1 h et 45 min à RT.
    2. Utilisez une seringue de 10 ml avec une aiguille de 18 G et insérez environ 2 mm au-dessous de la bordure de phase de 40/60% avec le bevel orienté vers le haut afin d'extraire la phase contenant de l'AAV. Assurez-vous de vous arrêter avant d'atteindre la bande protéique après l'extraction de 5 à 6 ml.
    3. Entreposez les extraits de dégradé dans des bouteilles en verre autoclaved à 4 oC. Évitez de stocker des temps plus longtemps que pendant la nuit.
    4. Diluer l'extrait de gradient d'iodixanol 3 fois en tapotage lentement dans 12 mL de tampon d'élution d'iodixanol (IE) (20 mM Tris-HCl pH 8,0, 15 mM NaCl) tout en tourbillonnant.
    5. Purifiez et concentrez le gradient d'iodixanol dilué à travers un filtre d'échange d'anions. Poussez-le lentement avec une vitesse pas plus rapide que 1 goutte / s. Poussez 3 mL de tampon IE lentement à travers le filtre pour le laver.
    6. Elute dans une unité de filtre centrifuge avec 1-2 ml de tampon d'élution (20 mM Tris-HCl pH 8.0;250 mM NaCl). Ajouter DPBS à l'appareil à un volume final de 4 ml. Centrifugeuse à 2 000 x g à RT jusqu'à ce qu'il reste moins de 0,5 ml dans le filtre. Retirer le liquide du fond du tube, remplir avec 4 ml de DPBS et centrifugeuse à nouveau. Répétez cette étape deux fois de plus. Assurez-vous que le volume de vecteur concentré sur le filtre est d'environ 200 L après la dernière étape de centrifugation.
    7. Retirez le vecteur concentré de 200 l à l'aide d'une pipette et poussez le concentré à travers un filtre de 0,22 mm pour le stériliser. Aliquot 200 Ldans un flacon de verre de 9 mm avec insert imbriqué (Tableau des Matériaux).
      REMARQUE: Les stocks de vecteurs AAV5 peuvent être stockés dans des congélateurs de -80 oC pour un stockage long, ou à 4 oC s'ils sont utilisés dans les 2 semaines.
  4. Détermination des vecteurs viraux AAV5
    1. Déterminer le tter AAV5 à l'aide de la réaction quantitative standard en chaîne de polymérase (qPCR) avec des amorces pour la séquence Derepeat Terminal Inverted(ITR) et une sonde de 5 'FAM / 3 'BHQ1 pour la séquence ITR (Tableau des matériaux). Utilisez une courbe standard obtenue avec des quantités connues d'ITR contenant du plasmide. Chaque vecteur AAV doit avoir une portée de 1E14 à 1E15 copies du génome par millilitre si la séquence ITR est utilisée pour la détermination des titer.
      REMARQUE: Une production réussie de virus AAV5 donne des stocks avec des titres dans la gamme minimale de 3E13 - 7E-13 Unités/mL.

2. Injection de facteurs de reprogrammation dans le cerveau

  1. Installation animale, placement stéréotaxique et forage
    note:Ce protocole se concentre sur l'utilisation d'Ascl1, Lmx1a et Nurr1 (ALN) pour la reprogrammation de NG2 glia en interneurons. Dans notre expérience, les interneurons d'un phénotype semblable peuvent être obtenus utilisant d'autres combinaisons de facteur11 Ans, états-unis (.
    1. Avant la chirurgie, préparez le mélange viral contenant les vecteurs Cba-FLEX-Ascl1, Cba-FLEX-Lmx1a, Cba-FLEX-Nurr1 et le vecteur reporter Syn-FLEX-GFP. Ajoutez chacun des stocks préparés dans la section 1 au mix final, de sorte que la solution virale finale comporte 5 % de chacun des facteurs de reprogrammation (Ascl1, Lmx1a et Nurr1) et 10 % de la construction du journaliste (5 % A, 5 % L, 5 % N et 10 % GFP).
      REMARQUE: Les mélanges vectoriels AAV5 peuvent être stockés à 4 oC et conservés pour une utilisation future in vivo.
    2. Anesthésier la souris à l'aide de 2% d'isoflurane dans un mélange d'air et d'oxyde nitreux (N2O) à un rapport de 4:1. Surveillez la respiration de l'animal en observant les mouvements du diaphragme. Pendant la chirurgie, maintenir l'anesthésie en utilisant 1 à 1,5 % d'isoflurane.
      REMARQUE: Le modèle de souris décrit par la présente se compose d'une souche de souris qui exprime spécifiquement Cre dans NG2 glia. La reprogrammation in vivo peut être réalisée à l'aide de différentes souches de souris qui expriment Cre dans d'autres populations de cellules gliales (par exemple, les astrocytes14).
    3. Une fois que l'animal est complètement anesthésié (p. ex.relaxation musculaire complète et absence de réponse à une pincée dans le coussinet), rasez la zone autour du site d'incision et amenez l'animal au cadre stéréotaxique.
    4. Pour maintenir la température corporelle de l'animal pendant la chirurgie, attachez un coussin chauffant à la base du cadre stéréotaxique. Placez la souris sur un essuie-tout propre et sec.
    5. Placez soigneusement la tête de la souris dans les barres d'oreilles. S'il est correctement placé, aucun mouvement latéral de la tête ne doit être observé. Placez la barre d'oreille gauche à 4 mm, avant de commencer à placer la souris dans le cadre stéréotaxique.
    6. Fixer la barre de dent en place, puis serrer la barre de nez. Assurez-vous que la tête ne bouge pas dans n'importe quelle dimension et pointez droit devant (la ligne médiane étant perpendiculaire au plan des barres d'oreille). Appliquer un onduleur ophtalmique pour la protection oculaire.
    7. Avant le début de la chirurgie, administrer l'analgésie appropriée (p. ex. 0,05 mg/kg de buprénorphine, sous-cutanée).
    8. Nettoyez la zone d'incision avec une gaze de coton ou une lingette imbibée de 70% EtOH, sans approcher la zone des yeux.
      REMARQUE: Pour l'injection virale intracérébrale, une seringue de 5 ou 10 ml adaptée avec un capillaire en verre tiré est utilisée. Les capillaires en verre sont tirés à l'aide d'un puller micropipette, ce qui donne un capillaire avec une pointe très fine, ce qui minimisera l'invasivité de la procédure. Pour adapter le capillaire à la seringue, utilisez un morceau de tube en caoutchouc sur la connexion entre l'aiguille de la seringue et le capillaire en verre et faites fondre-le à l'aide d'une source de chaleur (p. ex., un briquet). Une connexion étroite entre les deux pièces permettra de s'assurer qu'il n'y a pas de fuites de liquide pendant l'injection. Avant de commencer l'opération, testez-le en remplissant la seringue de salin et en poussant le liquide hors de la seringue.
    9. Faire une incision d'environ 0,5-0,8 cm le long de la ligne médiane de la tête. Couper à travers les couches cutanées et sous-cutanées, avec un scalpel.
    10. Élargir les rabats cutanés de chaque côté de l'incision. Nettoyez l'incision de tout sang et grattez les couches sous-cutanées avec un coton-tige.
    11. Déplacez le bras M/L-D/V du cadre stéréotaxique en place (au-dessus de l'animal) et fixez-le.
      REMARQUE: Le cadre stéréotaxique permet d'ajuster la seringue le long de l'axe Antérieur/Posterior (A/P, Y), Médial/Lateral (M/L, X axe) et Dorsal/Ventral (D/V, z axe).
    12. Déplacer la seringue le long de l'axe différent du cadre stéréotaxique, pour apporter la pointe du capillaire de verre juste au-dessus de bregma (le point de jonction où les différentes plaques de crâne se rencontrent).
    13. Assurez-vous que la pointe capillaire est parfaitement droite dans les deux plans A/P et M /L. En cas de bregma ambigu, prenez la moyenne des sutures latérales et médianes.
    14. Lorsque la pointe du capillaire est correctement placée au-dessus du bregma, réinitialiser les valeurs M/L et A/P à 0,0 sur le compteur de coordonnées numériques.
    15. Pour vous assurer que la tête de l'animal est en position parfaitement plate, utilisez le compteur de coordonnées numériques pour mesurer la valeur de la coordonnées D/V, lorsque le bras A/P est à 2,0 et -2,0 (M/L à 0,0), ainsi que lorsque le bras M/L est à 2,0 et -2,0 (A/P et 0,0). Ajustez la hauteur de la barre dentaire et des barres d'oreilles en conséquence.
    16. Déplacer la seringue vers les coordonnées souhaitées pour l'injection de vecteurs viraux dans le striatum (A/P et 1,0; M/L - -2,0, par rapport à bregma).
    17. Soulevez légèrement la seringue et, en regardant le site d'injection à travers le microscope, percer un trou à l'aide d'une perceuse dentaire aux coordonnées d'injection. Commencez à forer sur le site, en travaillant de manière circulaire et douce.
      REMARQUE: Ne pas mettre trop de pression vers le bas, comme le foret-bit doit être assez forte pour passer par l'os sans force supplémentaire. Évitez les forages longs et soutenus, car cela crée de la chaleur.
    18. À la fin du forage, vérifiez que le dura mater reste intact et exposé pour l'injection.
  2. Préparation de configuration de seringue
    1. Placer un morceau de gaze de coton sur l'incision ouverte et rincer la seringue avec une solution saline.
    2. Après le rinçage, prenez une bulle d'air de 1 à 2 l, suivie d'une solution contenant les vecteurs viraux, en évitant toute bulle involontaire. Assurez-vous que la solution virale peut facilement être visualisée sous la bulle d'air, tout en étant injectée.
  3. Injection virale
    1. Retirez la gaze de coton au-dessus du site d'incision, et abaissez la seringue en utilisant le bras D/V du cadre stéréotaxique. Lorsque la surface du crâne est approchée, regardez attentivement à travers le microscope et mesurez le niveau D/V de dura mater — il devrait gonfler légèrement sous une légère pression.
    2. Tout en touchant le dura mater avec la pointe du capillaire, régler la coordonnées D/V à 0,0.
    3. Abaissez la seringue, progressant lentement jusqu'à la profondeur désirée (D/V -2,7, par rapport à dura mater). Assurez-vous que la trajectoire est claire des fragments d'os, de sorte qu'aucune flexion de l'aiguille / capillaire est observée.
      REMARQUE: Les coordonnées présentées se réfèrent à une injection des facteurs de reprogrammation dans le striatum des souris NG2-Cre. Des coordonnées correspondant à d'autres régions du cerveau peuvent être utilisées. Testez toujours les coordonnées pour l'injection d'abord à l'aide d'un colorant (par exemple Trypan Blue), injection de perles colorées ou un vecteur viral journaliste avant l'injection de facteurs de reprogrammation dans le cerveau d'une nouvelle souche de souris. Si vous injectez Trypan Blue, les animaux doivent être sacrifiés immédiatement après la chirurgie et le cerveau disséqué. Les cerveaux frais peuvent être coupés à l'aide d'un microtome, bien que congelés, et le site d'injection déterminé par la visualisation de la position de teinture dans le cerveau. Si les tests se coordonnent à l'aide de perles colorées, il est possible de déterminer le site d'injection sur les cerveaux perfusés et coupés une semaine après l'injection. Alternativement, une injection avec un vecteur viral portant un gène de journaliste peut être employée, et le site d'injection déterminé dans les cerveaux coupés perfusés.
    4. Injecter 1 L de la solution virale à un taux de 0,4 l/min. Lorsque le volume entier est injecté, prévoir une période de diffusion de 2 min avant le retrait de la seringue.
    5. Après la diffusion, rétractez lentement la seringue jusqu'à ce que la pointe du capillaire soit complètement hors du cerveau.
    6. Placez un morceau de gaze de coton sur la plaie et rincer la seringue avec une solution saline.
    7. Déplacez le bras M/L-D/V du cadre stéréotaxique hors de la zone de travail.
  4. Procédures de fermeture des plaies et postopératoires
    1. Suturez soigneusement l'incision à l'aide du fil de suture.
      REMARQUE: Tous les fils de suture utilisés chez les animaux injectés doivent être éliminés dans une tasse /flacon contenant une solution détergente antivirale. La même solution est utilisée pour nettoyer toutes les surfaces entourant la zone de chirurgie qui ont été en contact avec des matériaux chirurgicaux. Tous les outils chirurgicaux sont soigneusement lavés et autoclaved à la fin de chaque journée de chirurgie.
    2. Retirez l'animal du cadre stéréotaxique et placez-le dans une station postopératoire, qui comprend une cage propre et chauffée, l'accès à la nourriture et à l'eau, et où l'animal reste jusqu'à ce qu'il soit complètement éveillé. Pendant cette période, surveillez l'animal de près jusqu'à ce que la conscience soit rétablie.
    3. Ne pas loger les animaux opérés avec des animaux non opérés jusqu'à ce que les premiers se soient complètement remis de la chirurgie.
    4. Superviser les animaux opérés tous les jours. Selon les sutures utilisées, assurez-vous qu'elles sont enlevées si nécessaire. Tous les animaux ont reçu Bupenorphinum (Temgesic à 1ml/kg) sous-cutané comme soin postopératoire.
      REMARQUE: Si vous utilisez la même seringue pendant deux jours consécutifs, rincer avec de l'eau, suivie de l'éthanol 70% et de l'eau à nouveau. Laissez la seringue remplie d'eau toute la nuit, pour permettre la dissolution de tous les résidus possibles.

3. Enregistrements électrophysiologiques

  1. Préparation des tranches de tissu pour l'électrophysiologie
    MISE EN GARDE: Une préparation de tissu bien exécutée est nécessaire afin d'obtenir de bons enregistrements électrophysiologiques. Préparer la pièce avec soin et placer les outils pour la perfusion et la dissection sur la glace.
    1. Préparer la solution de mousse glacée et oxygénée (95 % O2 et 5 % CO2) pour la perfusion, la dissection et la coupe (préparer ceci le même jour à partir du stock 10x en diluant la solution de bouillon dans de l'eau ultrapure et en ajoutant naHCO3 et glucose). Les composants de la solution Krebs en mM (après dilution à 1x) sont : 126 NaCl, 2,5 KCl, 1,2 NaH2PO4 H2O, 1,3 MgCl26H2O, et 2,4 CaCl2'6H2O, 22 NaHCO3, 10 glucose. Ajuster le pH de la solution à 7,4.
    2. Effectuer un étalonnage (Vibracheck) pour le vibratome avec une nouvelle lame de rasoir.
    3. Démarrer le bloc de refroidissement du vibratome (ou remplir la chambre environnante avec de la glace), remplir la chambre de coupe avec la solution Krebs pour l'oxygénation avec 95 % O2 et 5 % CO2 au moins 30 min avant utilisation.
    4. Mettez un plat Petri sur la glace et remplissez-le d'une solution Krebs oxygénée. Placer la lame, les ciseaux et la plaque de montage sur la glace.
      MISE EN GARDE: Apportez la cage contenant la souris à la pièce au moins 1 h avant de commencer la procédure d'acclimatation. Le stress a un effet négatif sur l'état des sections des tissus cérébraux.
    5. Anesthésiez la souris en phase terminale en injectant une surdose de Pentobarbital et laissez l'animal s'endormir.  Lorsque le réflexe de clignotement est sorti et que l'animal ne répond pas aux stimuli de la douleur, perfusez transcardialement l'animal avec une solution Krebs glacée pendant 2-3 min (à un taux de 10-20 ml/min).
    6. Rapidement, mais soigneusement, disséquer le cerveau et le mettre à l'envers dans le Petri-plat qui est placé sur la glace (contenant la solution Krebs).
      REMARQUE: Afin de comparer la maturation fonctionnelle des neurones reprogrammés, sacrifiez les animaux pour des enregistrements à différents moments post-viraux. Évaluer les propriétés de tir de sous-types distincts de neurones en se basant sur la littérature existante15 .
    7. Faire une coupe coronale le long du cervelet moyen et coller ce côté sur la plaque de montage (également glacée) pour la coupe vibratome.
    8. Trempez soigneusement le cerveau collé dans la chambre tampon du vibratome.
      MISE EN GARDE: Veillez à ne pas toucher la lame de rasoir pour votre propre sécurité, et de sorte que la lame restera calibrée.
    9. Couper de la partie la plus rostrale du cerveau jusqu'au niveau striatal à une vitesse élevée. Coupez ensuite le striatum coronally à 275 mm à vitesse lente (0,10 mm/s).
    10. Après chaque coupe, retirez soigneusement le côté striatal non injecté (p. ex., avec une aiguille pliée) et transférez le côté injecté dans une autre fiole dans un bain d'eau, contenant un filet inférieur (Krebs oxygéné à RT) placé dans un bain d'eau. Gardez ceci à RT jusqu'à ce que toutes les sections soient coupées.
    11. Augmentez lentement la température du bain d'eau à 37 oC et laissez-le pendant 30 min. Puis éteignez le chauffage et laissez refroidir jusqu'à ce que RT.
      REMARQUE : À ce stade, vous pouvez faire une pause jusqu'à ce que vous commenciez à enregistrer. Les sections durent 4-6 h.
  2. Enregistrements patch-clamp à cellules entières
    1. Transférer la première section de tissu à la chambre d'enregistrement immergée dans un flux continu de solution Krebs. Montez la section à l'aide de poids légers et submergez l'objectif.
    2. Identifier la région striatale au microscope et rechercher des neurones gFP-positifs (reprogrammés). Sélectionnez un neurone qui est vaste en morphologie et non couvert par des faisceaux de fibres ou des vaisseaux sanguins.
    3. Préparer des pipettes en verre borosilicate (3 à 7 M) pour le patching et le remplir avec la solution intracellulaire suivante (en mM) : 122,5 gluconate de potassium, 12,5 KCl, 0,2 EGTA, 10 HEPES, 2 MgATP, 0,3 Na3GTP et 8 NaCl, ajusté au pH 7,3 avec KOH.
    4. Pour la remplissage de la biocytine, ajouter 1 mg de sel de biocytine à 1 ml de solution interne et de vortex.
      MISE EN GARDE: Assurez-vous de filtrer la solution interne avec de la biocytine car cela peut autrement obstruer l'électrode.
    5. Fixez la pipette en verre à l'électrode d'enregistrement et plongez dans la solution. Vérifier la résistance de l'électrode. Puis approchez lentement la cellule avec la pipette, en gardant une légère pression positive dans l'électrode pour éviter de boucher la pointe.
      MISE EN GARDE: Veillez à garder une trace de votre cellule pendant la descente de l'électrode et de ne pas blanchir la fluorescence dans la cellule (c.-à-d., éteignez la lampe de fluorescence lorsque vous n'en avez pas besoin).
    6. Rincer soigneusement le tissu environnant à l'aide de la pression positive de l'électrode et approcher la cellule avec l'électrode. Localisez l'électrode juste au-dessus de la cellule et descendez jusqu'à ce que l'électrode touche la membrane. Faire un joint Giga-MD entre l'électrode et la membrane cellulaire, et avec des impulsions de pression négative, rompre la membrane pour créer un patch à cellules entières.
      MISE EN GARDE: Les neurones reprogrammés sont sensibles. Soyez prudent lors de la correction et ne pas mettre trop de pression négative lorsque vous atteignez un joint Giga-MD ou l'ouverture de la membrane cellulaire. En outre, patching sur les animaux qui sont plus âgés nécessite la pratique et la patience que leur tissu conjonctif est plus épais et il est plus difficile de visualiser les neurones.
    7. Vérifiez les potentiels de la membrane de repos immédiatement après la rupture en mode de la pince de courant et notez pour analyse.
    8. Dans la pince actuelle, maintenez la cellule entre -60 mV à -80 mV et injectez des courants de 500 ms de -20 pA à 90 pA, avec des incréments de 10 pA pour induire des potentiels d'action.
    9. Transférer dans la tension-clamp et mesurer le sodium entrant et les courants de potassium rectifiants retardés à des étapes de dépolarisation de 10 mV.
      REMARQUE: Les enregistrements de la tension-clamp sont mieux évalués à l'aide d'une solution interne différente, composée de produits chimiques qui serrent plus efficacement la membrane. Cependant, pour les neurones reprogrammés, le nombre de cellules que vous pouvez enregistrer est peu nombreux et le nombre de sections tissulaires avec ces neurones est limité. Par conséquent, c'est un avantage d'enregistrer à la fois dans le courant-clamp et tension-clamp de la même cellule.
    10. En mode tension-clamp, enregistrez l'activité postsynaptique spontanée à -70 mV. Distinguer les événements postsynaptiques inhibiteurs à un potentiel membranaire de 0 mV des événements excitateurs à -70 mV.
    11. Après avoir atteint une base stable, ajouter picrotoxine, l'antagoniste des récepteurs GABA A, à la solution Krebs qui se jette dans la chambre d'enregistrement, pour extraire les événements excitatifs (ajouter une solution de stock de Picrotoxine à une concentration finale de 50 mM dans des seringue tampon qui est reliée à la perfusion de chambre. Connectez l'écoulement du tampon de la chambre à un sac sous vide pour une élimination sécuritaire).
    12. Après 20 min, ajouter CNQX (20 mM), un antagoniste de l'AMPA, à la solution Krebs qui se jette dans la chambre d'enregistrement, pour bloquer les événements inhibiteurs (en utilisant la même procédure que pour la picrotoxine). Laisser agir encore 20 min, puis laver avec la solution Krebs. Retirer la section tissulaire de la chambre.
    13. Après avoir terminé les enregistrements, faites une analyse hors ligne des courants excitateurs spontanés post-synaptiques (EPSC) et des courants post-synaptiques inhibiteurs (IPSC) à l'aide d'une détection d'événements de seuil (n. 5 pA) dans le programme d'analyse.
    14. Pendant tout l'enregistrement, la cellule sera lentement remplie de la solution interne contenant de la biocytine. Gardez le patch pendant au moins 20 minutes avant d'enlever lentement l'électrode afin d'obtenir le remplissage complet de la cellule.
      MISE EN GARDE: Veillez à ne pas avoir de pression positive dans l'électrode qui pourrait détruire l'analyse morphologique consécutive des cellules par la suite.
    15. Pour la biocytine-visualisation, placez la section tissulaire dans 4 % de paraformaldéhyde (PFA) pendant la nuit à 4 oC. Rincer la section dans 0.02 M tampon de phosphate de potassium (KPBS) avec 0.1 % Triton. Ensuite, tache pour streptavidin- Cy3 (1: 600 en KPBS-T, 2 h), pour l'identification de la cellule remplie de biocytine et la visualisation morphologique du neurone reprogrammé.
      REMARQUE: Le remplissage de biocytine peut être employé pour l'analyse morphologique et les illustrations des neurones patchés.

4. Immunohistochimie, stérilisation et quantification

REMARQUE: Consacrer un groupe spécifique de souris pour l'immunohistochimie, car les sections de tissu utilisées pour l'électrophysiologie ne sont pas optimales pour l'immunohistochimie.

  1. Anesthésiez les souris avec une injection i.p. d'une surdose de pentobarbital et montez l'animal pour la perfusion.
  2. Perfuse transcardialement les souris, d'abord avec une solution saline pour enlever le sang, puis avec la glace-froid 4% PFA.
  3. Disséquer le cerveau et post-fixer pendant au moins 12 h dans 4% PFA.
  4. Mettre le cerveau dans une solution de saccharose à 25 % (pour la cryoprotection) pendant environ 12 h.
    REMARQUE: Les cerveaux sont prêts à être coupés quand ils coulent dans la solution de saccharose de 25%, ce qui indique que le saccharose a pénétré tout le cerveau de la souris.
  5. Faire une coupe coronale à travers le cervelet, utiliser la partie plate et la plus caudale du cerveau pour placer le cerveau sur un microtome et le fixer en place en utilisant un composé optimal de température de coupe (OCT).
  6. Couper le cerveau en tranches coronales d'une épaisseur de 35 mm et diviser le cerveau en séries consécutives placées dans des flacons ou des puits contenant 0,02 M KPBS.
  7. Traiter les sections pour l'immunohistochimie à l'aide d'anticorps contre les marqueurs GFP et interneuron tels que GAD65/67, PV, Chat (acétyltransferase de choline) et NPY (Neuropeptide Y), selon les protocoles standard16, 17.
    REMARQUE: Les tranches de cerveau peuvent être conservées à 4 oC ou -20 oC dans une solution antigel pendant de longues périodes.
  8. Une fois la coloration terminée, montez les sections sur un toboggan en verre et recouvrez-la d'une glissière en verre, en utilisant une solution de montage pour la fixer en place. Laissez sécher les toboggans à couverture pendant la nuit.
    REMARQUE: Pour nos études, les cerveaux entiers sont coupés en série 1:8 (c.-à-d., chaque flacon contenant des sections tiendra un huitième du cerveau de souris11).
  9. Analyser les sections à l'aide d'une fluorescence inversée et/ou d'un microscope confocal.
    MISE EN GARDE: La microscopie fluorescente est utile pour un aperçu général des résultats et la capture d'images pour calculer l'efficacité de la reprogrammation. Pour une analyse plus détaillée de l'identité phénotypique par l'observation des cellules double-positives, l'imagerie confocale devrait être employée.
  10. Pour la quantification des différents marqueurs exprimés dans les neurones GFPdans le striatum, comptez le nombre de cellules double-positives par rapport au nombre total de cellules GFP (c.-à-d. les neurones reprogrammés), dans au moins deux domaines de chaque section striatale.
  11. Pour déterminer le nombre total approximatif extrapolé de neurones reprogrammés par cerveau, comptez les neurones GFPprésents dans le striatum de l'une des séries cérébrales coupées plus tôt, puis multipliez par le nombre total de séries.
    REMARQUE: Différentes méthodes de quantification peuvent être utilisées pour exprimer l'efficacité de la reprogrammation, le nombre de neurones reprogrammés par animal et le pourcentage de neurones qui expriment certains marqueurs phénotypiques. Pour plus d'informations, voir la publication précédente11.
  12. Analyser les différences entre les conditions à l'aide de Graph Pad Prism ou similaire.
    REMARQUE: Pour le calcul de l'efficacité, nous avons injecté des souris NG2-Cre avec les vecteurs de conversion ALN dépendants du CRE et le journaliste gFP. Pour estimer l'efficacité de conversion, nous avons également injecté aux animaux un GFP dépendantde Cre sous le promoteur omniprésent de cba, rendant toutes les cellules ciblées GFP. En utilisant cette comparaison, nous avons estimé que 66,81 % - 38,38 % des cellules ciblées converties en neurones. Pour la validation de l'expression de chacun des gènes, une double coloration immunofluorescente complémentaire peut être réalisée pour GFP/Ascl1, GFP/Lmx1a et GFP/Nurr1. En outre, le séquençage du génome tel que le séquençage de l'ARN à cellule unique peut révéler la présence de chacun des gènes dans les cellules reprogrammées.

Representative Results

L'injection de vecteurs AAV est utilisée pour reprogrammer avec succès les cellules gliales NG2 résidentes dans les neurones du striatum de souris NG2-Cre (Figure 1A). Pour cibler spécifiquement NG2 glia, les vecteurs FLEX avec des gènes de reprogrammation/reporter, sont insérés dans une direction antisens et flanqués de deux paires de sites loxP antiparallèles et hétérorotypic (Figure 1B). Chacun des trois gènes de reprogrammation (Ascl1, Lmx1a et Nurr1) est placé sous le contrôle du promoteur de l'abc omniprésent sur les vecteurs individuels. Afin de s'assurer que l'expression GFP est limitée aux neurones reprogrammés provenant d'une cellule exprimant cre, GFP est placé sous le contrôle du promoteur de synapsin spécifique aux neurones, (également dans un vecteur FLEX).

L'utilisation de la combinaison de la reprogrammation et des constructions de reporter permet la génération de neurones GFP-positifs dans le striatum de souris (Figure 1C, C'). L'utilisation de la construction du journaliste sans la présence de gènes de reprogrammation ne donne pas de neurones GFP-positifs (Figure 1D).

Les neurones reprogrammés qui sont remplis de biocytine sont visibles après l'immunocoloration post-mortem (Figure 2A). Si la conversion est réussie, il devrait y avoir une morphologie neuronale étendue. Les enregistrements électrophysiologiques des neurones reprogrammés montrent la présence de connexions fonctionnelles postsynaptiques avec des mesures d'activité spontanées (Figure 2B, C). Ceci peut être bloqué avec le bloqueur gabAergique ionotropique ou glutamatergic (Picrotoxin ou CNQX), suggérant l'entrée synaptique excitatoire et inhibitrice aux neurones reprogrammés. L'occurrence de l'activité spontanée augmente avec le temps après l'injection virale (figure 2D),indiquant une maturation progressive.

Les potentiels d'action induits par le courant sont présents dans les neurones fonctionnels. Les potentiels d'action augmentent en nombre au fil du temps après la conversion (Figure 2E). Ceci indique davantage la maturation dans la fonction neuronale. Dans un neurone immature, le courant induira aucun ou très peu de potentiels d'action (Figure 2F).

Les modèles de tir d'un neurone est de type cellulaire spécifique car il dépend de facteurs tels que la morphologie des cellules et l'expression du canal15. Les modèles enregistrés dans les neurones reprogrammés in vivo peuvent être distingués en groupes et comparés à ceux des sous-types neuronaux endogènes, par exemple les interneurons à pointe rapide (cell type B, figure 3B) ou d'autres types de cellules (Figure 3A,C,D ). Les différences électrophysiologiques observées peuvent être confirmées par la présence de marqueurs de sous-type spécifiques et la coexpression avec GFP (Figure 3E-H). Au total, ces données indiquent que les neurones reprogrammés présents dans le striatum ont des propriétés de différents types d'interneurons, tels que Les interneurons exprimant par-albumine, ChAt- et NPY, ainsi que l'identité striatal de neurones épineux moyens (DARPP32) ( Figure 3E -H).

Figure 1
Figure 1 : Reprogrammation in vivo des gliales NG2 résidentes en neurones. (A) Représentation schématique de la reprogrammation in vivo de NG2 médié par le virus AAV. (B) Représentation schématique des constructions AAV5 FLEX utilisées pour la reprogrammation in vivo, dans laquelle l'expression des gènes est réglementée par l'expression Cre dans les cellules ciblées. (C et C') Neurones reprogrammés in vivo, résultant de l'injection de Syn-GFP et d'ALN dans le Striatum. (D) Absence de neurones reprogrammés lorsqu'aucun facteur de reprogrammation n'est ajouté dans le cocktail viral, et que seule la construction du journaliste est injectée in vivo. Barres d'échelle de 100 mm (C), 25 mm (C'), 25 mm (D). Veuillez cliquer ici pour voir une version plus grande de ce chiffre.

Figure 2
Figure 2 : Les neurones reprogrammés in vivo sont fonctionnels et montrent une maturation au fil du temps. (A) Neurone reprogrammé rempli de biocytine, montre la morphologie neuronale mûre, y compris les épines dendritiques. Traces montre (B) l'activité inhibitrice (GABAergic) qui est bloquée avec la picrotoxine, un antagoniste des récepteurs GABAA et (C) activité excitatrice qui est bloqué avec CNQX, un antagoniste des récepteurs AMPA. (D) Le nombre de neurones avec l'activité postsynaptique augmente avec le temps. (E) Les neurones patchés montrent le tir répétitif déjà à 5 semaines après l'injection (w.p.i.) et continuent à montrer qu'à 8 et 12 w.p.i. (F) Potentiel d'action induit par le courant et activité postsynaptique d'un neurone immature, montrant peu de synaptique événements et peu de potentiels d'action par rapport à B et D. Barre d'échelle de 25 mm S'il vous plaît cliquez ici pour voir une version plus grande de ce chiffre.

Figure 3
Figure 3 : Les neurones reprogrammés in vivo montrent des propriétés immunohistochimiques et électrophysiologiques des interneurons striatal. (A-D) Les modèles de tir des neurones reprogrammés in vivo peuvent être de types distincts : (A) Type A est similaire au neurone épineux moyen endogène (DARPP32); (B) semblable aux interneurons à pointe rapide (PVMD); (C) semblable aux neurones à faible seuil avec un affaissement proéminent (NPYMD); (D) neurones tirant avec une grande hyperpolarisation après (Chat). (E-H) Images confocales montrant la co-localisation du GFP et des marqueurs interneuron PV (E), ChAT (F), NPY (G), et marqueur neuronal de projection DARPP32 (H). Toutes les barres d'échelle de 50 mm. Veuillez cliquer ici pour voir une version plus grande de ce chiffre.

Discussion

La reprogrammation directe in vivo peut être réalisée à l'aide de vecteurs AAV FLEX dans les souches de souris exprimant cre. Il est important de noter que des différences entre les souches de souris en ce qui concerne l'efficacité de la reprogrammation ont été observées. Pour la reprogrammation in vivo dans le striatum, la ligne de souris NG2-Cre s'est avérée la plus efficace par rapport à d'autres souches. Avant de commencer à utiliser une nouvelle souche animale, il est important de vérifier les directives du fournisseur de souris concernant l'expression Cre au fil du temps, comme l'âge des animaux a souvent un impact sur la spécificité de cette expression protéique. Dans nos études, les animaux âgés de plus de 12 semaines n'ont pas été utilisés pour la reprogrammation in vivo car il y avait un risque d'expression cre dans des cellules autres que NG2 glia. La présence et la surveillance constantes des animaux témoins injectés uniquement avec la construction Synapsin-FLEX-GFP sont conseillées. Cela permet de surveiller les animaux pour les cellules GFP-positives qui ne devraient pas être présents si aucun gène de reprogrammation (ALN) n'est utilisé.

Pour identifier les neurones nouvellement reprogrammés, une méthode d'identification spécifique aux neurones comme celle décrite dans ce protocole est de la plus haute importance. Cela permet une identification et une distinction appropriées des neurones reprogrammés des cellules environnantes endogènes qui est d'une pertinence particulière lors de la reprogrammation dans une région homotopique.

Il est également important de cibler la structure correcte pour l'injection virale. Par conséquent, la chirurgie stéréotaxique pour l'injection virale est importante et doit être abordée avec précision, en particulier lorsque vous ciblez de plus petites structures du cerveau.

Nous avons déjà montré11 qu'il n'est pas fiable de prédire le résultat de la reprogrammation in vivo basée sur des expériences de reprogrammation in vitro en utilisant les mêmes facteurs de reprogrammation. Tous les facteurs d'intérêt doivent donc être testés in vivo. Dans nos mains, de nombreuses combinaisons de facteurs différents donnent le même sous-type de neurones (c.-à-d., interneurons11 in vivo) malgré le fait que ces gènes ont été impliqués dans le développement d'autres neurones.

La pince de correction de cellules entières pour les neurones reprogrammés est une technique délicate et le traitement de tissu est important pour un bon résultat. La perfusion avec la solution Krebs glacée améliore la qualité des tissus. En outre, les neurones patchés doivent être traités avec soin. Même si la maturation et l'identité phénotypique des neurones reprogrammés peuvent être quelque peu évaluées à l'aide de pinces à patch à cellules entières, ces cellules ne sont pas entièrement comparables à leurs homologues endogènes. D'autres types d'analyse, comme le séquençage du génome (p. ex., le séquençage de l'ARN) devraient être utilisés pour confirmer davantage l'identité cellulaire reprogrammée.

La technique décrite ci-dessous est pourrait être considérée pour le développement de thérapies futures où le remplacement neuronal est nécessaire dans le cerveau. Bien que la reprogrammation in vivo en soit encore à ses débuts et que la traduction chez l'homme ne soit pas encore prévue, cette technique pourrait fournir une méthode pour évaluer la fonction génique exogène dans le cerveau et étudier la maturation cellulaire in vivo.

Disclosures

Les auteurs n'ont rien à révéler.

Acknowledgments

Marcella Birtele a été financée par le programme Horizon 2020 de l'Union européenne (H2020-MSCA-ITN-2015) dans le cadre des réseaux de formation innovants Marie Skoodowska-Curie et de l'Accord de subvention no 676408. Daniella Rylander Ottosson a été financée par le Conseil suédois de la recherche (2017-01234).

Materials

Name Company Catalog Number Comments
REAGENTS FOR AAV5 CLONING AND VIRAL VECTOR PREPARATION
pAAV-CA-FLEX AddGene 38042
Ascl1 AddGene 67291 NM_008553.4
Lmx1a AddGene 33013 NM_0033652.5
Nurr1 AddGene 35000 NM_013613.2
GFP-syn AddGene 30456
LoxP (FLEX) sequence 1 GATCTccataacttcgtataaagtatcctatac
gaagttatatcaaaataggaagaccaatgcttc
accatcgacccgaattgccaagcatcaccatcg
acccataacttcgtataatgtatgctatacgaa
gttatactagtcccgggaaggcgaagacgcgga
agaggctctaga
LoxP (FLEX) sequences 2 tactagtataacttcgtataggatactttatac
gaagttatcattgggattcttcctattttgatc
caagcatcaccatcgaccctctagtccacatct
caccatcgacccataacttcgtatagcatacat
tatacgaagttatgtccctcgaagaggttcgaa
ttcgtttaaacGGTACCCTCGAC
pDP5 Plasmid Factory PF435
pDP6 Plasmid Factory PF436
Phosphate-Buffered Saline (PBS) Thermo Fisher Scientific 10010023
FBS (Fetal bovine serum) Thermo Fisher Scientific 10500064
Penicillin streptomycin Thermo Fisher Scientific 15140122
DMEM (Dulbecco's Modified Eagle Medium)+ Glutamax Thermo Fisher Scientific 61965026
DPBS (Dulbecco's Phosphate Buffer Saline) Thermo Fisher Scientific 14190094
HEK293 cells Thermo Fisher Scientific 85120602-1VL
Flasks BD Falcon 10078780 175 cm2
Tris H-CL Sigma Aldrich 10812846001 For TE buffer use 10 mM, pH 8.0; for lysis buffer use 50mM, pH 8.5; for IE buffer use 20 mM, pH 8.0; for elution buffer use 20 mM, pH 8.0
EDTA EDTA: Invitrogen EDTA: AM9260G For TE buffer use 1 mM EDTA
Ultrapure water see Ultrapure water system
CaCl2 SigmaAldrich C5080 2.5 M
Dulbecco´s phosphate-buffered saline (DPBS) Thermo Fisher Scientific 14190136
NaCl Sigma-Aldrich S3014 FOR HBS use 140 mM; for Lysis Buffer use 150 mM; for IE buffer use 15 mM; for elution buffer use 250 mM
MgCl2 Sigma-Aldrich M8266-100G For lysis Buffer: 1 mM
Ultracentrifuge sealing tubes Beckman Coulter Quick-Seal® Polypropylene Tube
OptiPrep™ Density Gradient Medium Sigma Aldrich D1556-250ML
10-mL syringe-18G needle BD 305064
Laboratory glass bottles VWR ?
Anion exchange filter PALL laboratory MSTG25Q6 Acrodisc unit with Mustang Q membrane
Centrifugal filter unit Merck Z740210-24EA Amicon Ultra-4 device
Endotoxin-Free Plasmid DNA Isolation Kits Thermo Fisher Scientific A33073
Na2PO4 Sigma-Aldrich S7907
HEPES Sigma-Aldrich H7523 15 mL
Falcon tube Thermo Fisher Scientific Corning 352196
Falcon tube Thermo Fisher Scientific Corning 352070
Glass Vials Novatech 30209-1232 CGGCCTCAGFGAGCGA
Forward Primer for Inverted Terminal Repeat (ITR) sequence GGAACCCCTAGTGATGGAGTT
Reverse Primer for Inverted Terminal Repeat (ITR) sequence CACTCCCTCTCTGCGCGCTCG
5´FAM / 3´BHQ1 probe Jena Bioscience
0.22 mm filter Merck SLGV004SL Millex-GV filter
EQUIPMENT AAV5 VIRAL VECTOR PREPARATION
Freezer -20 °C
Freezer -80 °C
Fridge +4 °C
AAV viral room
Ultrapure Water system Merck Milli-Q® IQ 7000
Vortex mixer VWR 444-0004
Ultracentrifuge Beckman Coulter Beckman Optima LE-80K Ultracentrifuge
Autoclave Tuttnauer 2540 EL
Polymerase Chain Reaction (PCR) BioRad C1000 Touch Thermal Cycler
Quantitative PCR (qPCR) Roche LightCycler® 480 System
Centrifuge Thermo Fisher Scientific Sorvall ST16
Water Bath Thermo Fisher Scientific TSGP02
ANIMAL MODEL
NG2-Cre mice Jackson NG2-CrexB6129, Stock #008533
REAGENTS FOR INJECTION OF REPROGRAMMING FACTORS INTO THE BRAIN
Water
Saline Apoteket AB 70%
Ethanol Solveco
Isolfurane Apoteket AB Dilute to 1% solution with warm water.
Virkon Viroderm 7511 
Pentobarbital Apoteket AB P0500000 i.p. for terminal procedure at the dose of 60 mg/ml.
Sucrose Merck S0389-500G
Trypan Blu Thermo Fisher Scientific 15250061
Retrobeads Lumafluor R170
Buprenorphine Apoteket AB
EQUIPMENT FOR INJECTION OF REPROGRAMMING FACTORS INTO THE BRAIN From RSG Solingen.
Scissors VWR 233-1552 From Biochem.
Tweezers VWR 232-0007
Forcep VWR 232-0120
Scalpel holder VWR RSGA106.621 Number 20.
Scalpel VWR RSGA106.200
Stereotaxic frame Stoelting Europe 51500D
Mouse ear bars Stoelting Europe 51648 5 ul
Syringe with Removable needle Hamilton Company 65 0,75 inner diameter and 1.5 outer diameter.
Glass capilaries Stoelting 50811
Glass capillary puller Sutter company P-1000
Dental drill Agnthos AB 1464
Shaver Agnthos AB GT420
Isoflurane Chamber and pump Agnthos AB 8323101 2 mL
Syringes Merck Z118400-30EA 25G
Needles Merck Z192414 Aldrich
Mouse and neonatal rat adaptor for stereotaxic fram Stoelting 51625
Heating pad Braintree scientific, inc 53800M From Covidien 2187.
Cotton gauze Fisher Scientific 22-037-902
Rubber tube Elfa Distrelec HFT-A-9.5/4.8 PO-X BK 150
Cotton swabs Fisher Scientific 18-366-473
REAGENTS FOR WHOLE-CELL PATCH CLAMP RECORDINGS
NaCl Sigma-Aldrich S3014
KCl Sigma-Aldrich P9333
NaH2PO4-H2O Sigma-Aldrich S9638
MgCl2-6 H2O Sigma-Aldrich M2670
CaCl2-6 H2O Sigma-Aldrich C8106
MgSO4-7 H2O Sigma-Aldrich 230391
NaHCO3 Sigma-Aldrich S5761
Glucose Sigma-Aldrich G7021 see Ultrapure Water system
Ultrapure Water Prepare 1 or 2M.
KOH Sigma-Aldrich P5958-500G
K-D-gluconate Sigma-Aldrich G4500 Sigma
KCl Sigma-Aldrich P9541
KOH-EGTA (Etilene glycol-bis-N-tetracetic acid) Sigma-Aldrich E3889 Sigma
KOH- Hepes acid (N-2-hydroxyethylpiperazine-N’-2-ethanesulfonic acid) Sigma-Aldrich H7523
NaCl Sigma-Aldrich S3014
Mg2ATP Sigma-Aldrich A9187
Na3GTP Sigma-Aldrich G8877
Biocytin Sigma-Aldrich B4261
Picrotoxin Merck P1675 Sigma
CNQX Merck C239 Sigma
Ice
EQUIPMENT FOR WHOLE-CELL PATCH CLAMP RECORDINGS
Borosilicate glass pipette Sutter Company B150-86-10
Glass capillary puller Sutter company P-1000
Vibratome Leica Leica VT1000 S
WaterBath Thermo Fisher Scientific TSGP02
Clampfit software Molecular Devices
Multiclamp software Molecular Devices
REAGENTS FOR IMMUNOHISTOCHEMISTRY Use at a concentration of 4%. CAUTION: PFA is a potent fixative. Avoid ingestion and contact with skin.
Paraformaldehyde (PFA) Merck Millipore 1040051000 Use at a concentration of 0.1%.
Triton X-100 Fisher Scientific 10254640 Donkey.Use at a concentration of 1 : 400.
Serum Merck Millipore S30-100ML Reconstitute the powder in Milli-Q water to 1 mg/mL. Aliquot and store at -20°C, light sensitive. Use at a concentration of 1 : 500.
4′,6-Diamidino-2′-phenylindole dihydrochloride (DAPI) Sigma Aldrich D9542 1: 600 in KPBS-T.
streptavidin- Cy3 Thermo Fisher Scientific 434315 1:5000, rabbit.
Anti-GAD65/67 Abcam 1:2000, mouse.
Anti-PV Sigma P3088 1:200, goat.
Anti-Chat Merk AB143 1:5000, rabbit.
Anti-NPY Immunostar 22940
K2HPO4 Sigma-Aldrich P3786
NaCl Sigma-Aldrich S3014
KH2PO4 Sigma-Aldrich NIST200B 1:1000, chicken.
Anti-GFP Abcam ab13970
Mounting solution Merck 10981 Polyvinyl alcohol mounting medium with DABCO®, antifading
OCT Agar Scientific
Glycerol Sigma-Aldrich G9012-100ML
Distilled water
Anti-freeze solution Tissue Pro Technology AFS05-1000N, 1000 mL/ea.
EQUIPMENT FOR IMMUNOHISTOCHEMISTRY
Inverted fluorescence microscope Leica DMI6000 B
Confocal microscope Leica TCS SP8 laser scanning confocal microscope.
Prism GraphPad
Microtome Leica SM2010R

DOWNLOAD MATERIALS LIST

References

  1. Barker, R. A., Parmar, M., Studer, L., Takahashi, J. Human Trials of Stem Cell-Derived Dopamine Neurons for Parkinson's Disease: Dawn of a New Era. Cell Stem Cell. 21, (5), 569-573 (2017).
  2. Southwell, D. G., et al. Interneurons from embryonic development to cell-based therapy. Science. 344, (6180), 1240622 (2014).
  3. Parmar, M., Torper, O., Drouin-Ouellet, J. Cell-based therapy for Parkinson's disease: A journey through decades toward the light side of the Force. European Journal of Neuroscience. (2018).
  4. Torper, O., et al. In Vivo Reprogramming of Striatal NG2 Glia into Functional Neurons that Integrate into Local Host Circuitry. Cell Reports. 12, (3), 474-481 (2015).
  5. Su, Z., Niu, W., Liu, M. L., Zou, Y., Zhang, C. L. In vivo conversion of astrocytes to neurons in the injured adult spinal cord. Nature Communication. 5, 3338 (2014).
  6. Liu, Y., et al. Ascl1 Converts Dorsal Midbrain Astrocytes into Functional Neurons In Vivo. Journal of Neuroscience. 35, (25), 9336-9355 (2015).
  7. Guo, Z., et al. In vivo direct reprogramming of reactive glial cells into functional neurons after brain injury and in an Alzheimer's disease model. Cell Stem Cell. 14, (2), 188-202 (2014).
  8. Grande, A., et al. Environmental impact on direct neuronal reprogramming in vivo in the adult brain. Nature Communication. 4, 2373 (2013).
  9. Niu, W., et al. In vivo reprogramming of astrocytes to neuroblasts in the adult brain. Nature Cell Biology. 15, (10), 1164-1175 (2013).
  10. Weinberg, M. S., Criswell, H. E., Powell, S. K., Bhatt, A. P., McCown, T. J. Viral Vector Reprogramming of Adult Resident Striatal Oligodendrocytes into Functional Neurons. Molecular Therapy. 25, (4), 928-934 (2017).
  11. Pereira, M., et al. Direct Reprogramming of Resident NG2 Glia into Neurons with Properties of Fast-Spiking Parvalbumin-Containing Interneurons. Stem Cell Reports. 9, (3), 742-751 (2017).
  12. Rivetti di Val Cervo, P., et al. Induction of functional dopamine neurons from human astrocytes in vitro and mouse astrocytes in a Parkinson's disease model. Nature Biotechnology. 35, (5), 444-452 (2017).
  13. Crosson, S. M., Dib, P., Smith, J. K., Zolotukhin, S. Helper-free Production of Laboratory Grade AAV and Purification by Iodixanol Density Gradient Centrifugation. Molecular Therapy Methods & Clinial Development. 10, 1-7 (2018).
  14. Torper, O., et al. Generation of induced neurons via direct conversion in vivo. Proceedings of the National Academy of Sciences of the United States of America. 110, (17), 7038-7043 (2013).
  15. Kawaguchi, Y., Kubota, Y. Correlation of physiological subgroupings of nonpyramidal cells with parvalbumin- and calbindinD28k-immunoreactive neurons in layer V of rat frontal cortex. Journal of Neurophysiology. 70, (1), 387-396 (1993).
  16. Grealish, S., et al. The A9 dopamine neuron component in grafts of ventral mesencephalon is an important determinant for recovery of motor function in a rat model of Parkinson's disease. Brain. 133, (Pt 2), 482-495 (2010).
  17. Thompson, L., Barraud, P., Andersson, E., Kirik, D., Bjorklund, A. Identification of dopaminergic neurons of nigral and ventral tegmental area subtypes in grafts of fetal ventral mesencephalon based on cell morphology, protein expression, and efferent projections. Journal of Neuroscience. 25, (27), 6467-6477 (2005).
In Vivo Reprogrammation directe des cellules gliales résidentes en interneurones par injection intracérébrale de vecteurs viraux
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Pereira, M., Birtele, M., Rylander Ottosson, D. In Vivo Direct Reprogramming of Resident Glial Cells into Interneurons by Intracerebral Injection of Viral Vectors. J. Vis. Exp. (148), e59465, doi:10.3791/59465 (2019).More

Pereira, M., Birtele, M., Rylander Ottosson, D. In Vivo Direct Reprogramming of Resident Glial Cells into Interneurons by Intracerebral Injection of Viral Vectors. J. Vis. Exp. (148), e59465, doi:10.3791/59465 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter