Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Neuroscience

वायरल वेक्टर्स के इंट्रासेरेब्रल इंजेक्शन द्वारा इंटरन्यूरॉन्स में निवासी ग्लिल सेल के विवो डायरेक्ट रीप्रोग्रामिंग में

doi: 10.3791/59465 Published: June 17, 2019

Summary

इस प्रोटोकॉल सीधे vivo में reprogrammed interneurons पैदा करना है, मस्तिष्क में एक AAV आधारित वायरल प्रणाली और एक FLEX synapsin संचालित GFP रिपोर्टर, जो सेल पहचान और विवो में आगे विश्लेषण के लिए अनुमति देता है का उपयोग कर.

Abstract

विवो में कार्यात्मक और उपप्रकार-विशिष्ट न्यूरॉन्स में मस्तिष्क में निवासी glia परिवर्तित करने के लिए वैकल्पिक सेल प्रतिस्थापन उपचार के विकास की दिशा में एक कदम आगे प्रदान करता है, जबकि भी उपकरण बनाने के लिए situ में सेल भाग्य का अध्ययन. तारीख करने के लिए, यह vivo reprogramming में के माध्यम से न्यूरॉन्स प्राप्त करने के लिए संभव हो गया है, लेकिन इन न्यूरॉन्स के सटीक phenotype या कैसे वे परिपक्व विस्तार से विश्लेषण नहीं किया गया है. इस प्रोटोकॉल में, हम एक AAV आधारित वायरल वेक्टर प्रणाली का उपयोग कर, में vivo reprogrammed न्यूरॉन्स की एक अधिक कुशल रूपांतरण और सेल-विशिष्ट पहचान का वर्णन. हम भी reprogrammed कोशिकाओं के कार्यात्मक मूल्यांकन के लिए एक प्रोटोकॉल प्रदान करते हैं' न्यूरॉन परिपक्वता. फ्लिप-एक्साइस (फ्लेक्स) वैक्टर इंजेक्शन लगाकर, मस्तिष्क में विशिष्ट सेल प्रकारों के लिए reprogramming और synapsin-चालित रिपोर्टर जीन युक्त है कि सेल reprogramming के लिए लक्ष्य के रूप में सेवा. इस तकनीक को नए reprogrammed न्यूरॉन्स की आसान पहचान के लिए अनुमति देता है. परिणाम बताते हैं कि प्राप्त reprogrammed न्यूरॉन्स कार्यात्मक समय के साथ परिपक्व, synaptic संपर्क प्राप्त करते हैं और interneurons के विभिन्न प्रकार के electrophysiological गुण दिखा. प्रतिलेखन कारकों Ascl1, Lmx1a और Nurr1 का उपयोग करना, reprogrammed कोशिकाओं के बहुमत तेजी से spiking, parvalbumin युक्त interneurons के गुण है.

Introduction

इस विधि के समग्र लक्ष्य कुशलता से इस तरह के parvalbumin-expressing interneurons के रूप में कार्यात्मक और उपप्रकार-विशिष्ट न्यूरॉन्स में विवो में मस्तिष्क निवासी ग्लिया परिवर्तित करने के लिए है। यह एक exogenous सेल स्रोत के लिए आवश्यकता के बिना मस्तिष्क रोगों के लिए एक वैकल्पिक सेल रिप्लेसमेंट थेरेपी के विकास की दिशा में एक कदम आगे प्रदान करता है. यह भी सीटू में सेल भाग्य स्विच का अध्ययन करने के लिए एक उपकरण बनाता है।

मस्तिष्क नए न्यूरॉन्स पैदा करने के लिए केवल एक सीमित क्षमता है. इसलिए, स्नायविक रोगों में, मस्तिष्क की मरम्मत के लिए exogenous सेल स्रोतों की जरूरत है. इसके लिए कोशिकाओं के विभिन्न स्रोतों पर पिछले कुछ वर्षों में गहन अनुसंधान किया गया है, जिसमें प्राथमिक ऊतक, स्टेम सेल व्युत्पन्न कोशिकाओं और पुनः क्रमादेशित कोशिकाओं1,2,3से कोशिकाओं को शामिल किया गया है। न्यूरॉन्स में निवासी मस्तिष्क कोशिकाओं के प्रत्यक्ष reprogramming एक हाल ही में दृष्टिकोण है कि मस्तिष्क की मरम्मत के लिए एक आकर्षक तरीका प्रदान कर सकता है के रूप में यह मस्तिष्क के अंदर उपन्यास न्यूरॉन्स पैदा करने के लिए रोगी की अपनी कोशिकाओं का उपयोग करता है. तारीख करने के लिए, कई रिपोर्टों जैसे मस्तिष्क 4,5,6,78,9 में वायरल वेक्टर वितरण के माध्यम से विवो reprogramming में दिखाया गया है कॉर्टेक्स , रीढ़ की हड्डी , स्ट्रेटम और मिडब्रेन5,10,11, साथ ही अक्षुण्ण और घावदार मस्तिष्क5,8,11,12. दोनों निरोधात्मक और उत्तेजक न्यूरॉन्स प्राप्त किया गया है4,8, लेकिन सटीक phenotype या इन कोशिकाओं की कार्यक्षमता अभी तक विस्तार से विश्लेषण नहीं किया गया है.

इस प्रोटोकॉल में, हम एक और अधिक कुशल reprogramming और कोशिका विशेष पहचान vivo reprogrammed न्यूरॉन्स में का वर्णन. हम कार्यक्षमता और इम्यूनोहिस्टोकेमिकल लक्षण के आधार पर न्यूरोनल परिपक्वता और phenotype लक्षण के कार्यात्मक मूल्यांकन के लिए एक प्रोटोकॉल प्रदान करते हैं।

हम एक Cre-inducible AAV वेक्टर और एक GFP रिपोर्टर का इस्तेमाल किया vivo reprogrammed न्यूरॉन्स की पहचान. वायरल सदिशों के इस चुनाव में मस्तिष्क की विभाजन और गैर-विभाजित कोशिकाओं दोनों को संक्रमित करने का लाभहोता है, जिससे लक्षित कोशिकाओं की संख्या में वृद्धि होती है, जो रेट्रोवायरस 7,8के उपयोग के विकल्प के रूप में होती है। एक न्यूरॉन विशेष synapsin संचालित FLEX रिपोर्टर (GFP), हमें विशेष रूप से नए उत्पन्न न्यूरॉन्स का पता लगाने के लिए सक्षम. पिछले अध्ययनों में विवो reprogramming में के लिए subtype-विशिष्ट प्रमोटरों का इस्तेमाल किया है7,9, कि भी विशिष्ट सेल प्रकार में जीन और पत्रकारों reprogramming की अभिव्यक्ति की अनुमति. हालांकि, उस विधि रिपोर्टर और न्यूरॉन मार्करों के सह-अभिव्यक्ति के पोस्टमार्टम विश्लेषण द्वारा reprogrammed न्यूरॉन्स के आगे की पहचान की आवश्यकता है. एक न्यूरॉन विशेष संवाददाता का उपयोग, इस तरह के एक यहाँ वर्णित के रूप में, एक प्रत्यक्ष पहचान के लिए अनुमति देता है. यह एक सफल रूपांतरण का एक सीधा सबूत प्रदान करता है और पैच-क्लैम्प इलेक्ट्रोफिजियोलॉजी के लिए आवश्यक है कि एक जीवित सेल पहचान की अनुमति देता है.

Protocol

सभी प्रयोगात्मक प्रक्रियाओं यूरोपीय संघ के निर्देश (2010/63/EU) के तहत किया गया और लुंड विश्वविद्यालय और स्वीडिश कृषि विभाग (Jordbruksverket) में प्रयोगशाला जानवरों के उपयोग के लिए नैतिक समिति द्वारा अनुमोदित किया गया. चूहे को भोजन और पानी तक पहुंच के साथ 12 एच प्रकाश/अंधेरे चक्र में रखा जाता है।

1. वायरल वैक्टर

  1. AAV सदिशों की क्लोनिंग
    1. Cre-indutable AAV5 सदिश बनाने के लिए, GFP, Ascl1, Lmx1a और NR4A2 (Nurr1) के लिए cDNA डालने विषमविशिष्ट के दो जोड़े द्वारा flanked अभिविन्यास में, antiparallel LoxP फ्लिप-एक्साइसाइन (FLEX) अनुक्रम (सामग्रीकीतालिका). CDNA प्रविष्टि के लिए, एक समान संरचना के साथ पाएवी-Cba-FLEX या एक समान संरचना के साथ एक रीढ़ की हड्डी का उपयोग करें, जिसमें FLEX अनुक्रम और एक चिकन बीटा actin (CBA) प्रमोटर.
    2. प्रत्येक एकल cDNA डालें (जैसे, Ascl1) polymerase श्रृंखला प्रतिक्रिया (पीसीआर) और प्रतिबंध एंजाइमों द्वारा रीढ़ की हड्डी में. एक synapsin प्रमोटर और Ascl1के नियंत्रण में GFP एक्सप्रेस , Lmx1a, Nurr1 एक सर्वव्यापी व्यक्त सीबीए प्रमोटर के नियंत्रण में.
      नोट: विशिष्ट एंडोटॉक्सिन मुक्त प्लाज्मिड डीएनए आइसोलेशन किट का उपयोग करके एंडोटॉक्सिन मुक्त डीएनए सुनिश्चित करें।
    3. क्लोनिंग चरण की सफलता की जांच करने के लिए, उपयोग करने से पहले निर्माण पर अनुक्रमण और प्रतिबंध विश्लेषण करें।
  2. AAV5 वायरल वेक्टर उत्पादन
    चेतावनी: एडेनो-संबद्ध वायरस (AAV) से निपटने के दौरान स्थानीय जैव सुरक्षा दिशानिर्देशों का संदर्भ लें। स्वीडन में, AAV इस प्रोटोकॉल में इस्तेमाल किया जैव सुरक्षा स्तर 2 (BSL-2) की आवश्यकता है.
    1. मानक संस्कृति मीडिया के साथ बीज HEK293T कोशिकाओं (DMEM + Glutamax + 10% FBS + पेनिसिलिन (100 यू /एमएल) streptomycin (100 डिग्री ग्राम/ AAV के बैच प्रति 5 फ्लास्क के लिए खाता है और एक समय में 6 बैचों के लिए योजना है।
    2. जब कोशिकाएं 50-70% संगम तक पहुंच जाती हैं, तो ट्रांसफेक्शन (प्रति 175 सेमी2 फ्लास्क) के लिए निम्नलिखित मिश्रण तैयार करें।
      1. 50 एमएल अपकेंद्रित्र नली में, सदिश प्लाज़्मिड तथा पीडीजी श्रेणी सहायक प्लाज्मिड (पीडीपी5, पीडीपी6) की समगुण मात्रा जोड़ें, जिसमें प्रति 175 बउ2 फ्लास्क 72 ग्राम की कुल मात्रा होती है।
      2. 144 एमएल के अंतिम वॉल्यूम में Tris-EDTA बफ़र (TE बफर, 10 M M Tris-HCl, 1 M EDTA) जोड़ें।
      3. अल्ट्राप्यूर पानी जोड़ें ताकि कुल मात्रा 1296 एमएल हो जाए और मिश्रण हो जाए।
      4. 2.5 एम CaCl2 के 144 $L जोड़ें और मिश्रण. डीएनए समाधान के लिए HEPES बफर्ड लवण (HBS) (1.5 एमएम ना2एचपीओ4 ,140 एमएम NaCl, 50 m HEPES) के 1.92 $L जोड़ें और भंवर द्वारा तुरंत मिश्रण।
      5. कमरे के तापमान पर इनक्यूबेट (आरटी) के लिए वास्तव में 60 s. 28 एमएल ताजा सेल संस्कृति मीडिया और मिश्रण करने के लिए समाधान स्थानांतरण।
    3. फ्लास्क में माध्यम को सेल कल्चर माध्यम से बदलें जिसमें ट्रांसफेक्शन मिश्रण होता है।
    4. transfection के तीन दिन बाद, कचरे के लिए एक डिस्पोजेबल कंटेनर में फ्लास्क से thr माध्यम डालने से कोशिकाओं फसल और फसल बफर के 5 एमएल जोड़ने (EDTA Phosphate-बफर Saline करने के लिए जोड़ा, सामग्री की तालिकादेखें, एक अंतिम एकाग्रता के लिए DPBS की 5 एमएम) सेल टुकड़ी की अनुमति देने के लिए प्रत्येक फ्लास्क में 5 एमएम की एकाग्रता के लिए।
    5. 50 एमएल अपकेंद्रित्र ट्यूब में कोशिका विलयन डालें। शेष कोशिकाओं और पहले सेल समाधान के साथ पूल कुल्ला करने के लिए प्रत्येक फ्लास्क करने के लिए DPBS का एक और 4 एमएल जोड़ें। 4 डिग्री सेल्सियस पर 5 मिनट के लिए 1,000 x ग्राम पर काटा कोशिकाओं सेंट्रीफ्यूज।
    6. अपकेंद्रण के बाद, सुपरनेंट को हटा दें और 15 एमएल लासिस बफर (50 एमएम ट्रास-एचसीएल पीएच 8.5, 150 एमएम नैकल, 1 एमएम एमजीसीएल2) में छर्रों को भंग करें।
    7. उन्हें सीओ2में फ्रीज करें - 15 मिनट के लिए आइस/एथेनोल स्नान करें और एक -20 डिग्री सेल्सियस फ्रीजर में स्टोर करें। उपयोग करने से पहले 37 डिग्री सेल्सियस पानी के स्नान में काटा गया सेल lysate था।
  3. AAV5 वायरल वेक्टर शुद्धि
    1. Iodixanol ग्रेडिएंट Ultracentrifugation13 द्वारा एवी शुद्धि प्रदर्शन और RT में 1 एच और 45 मिनट के लिए 350,000 x ग्राम पर centrifugation के साथ ultracentrifuge सील ट्यूबों का उपयोग करें।
    2. AAV युक्त चरण निकालने के क्रम में ऊपर की ओर का सामना करना पड़ बेवल के साथ 40/60% चरण सीमा के नीचे के बारे में 2 मिमी डालने के लिए एक 18G सुई के साथ एक 10 एमएल सिरिंज का प्रयोग करें। 5-6 एमएल निकाले जाने के बाद प्रोटीन बैंड तक पहुंचने से पहले बंद करने के लिए सुनिश्चित करें।
    3. ढाल के अर्क को ऑटोक्लेव्ड कांच की बोतलों में 4 डिग्री सेल्सियस पर स्टोर करें। रात भर से अधिक समय के भंडारण से बचें।
    4. चक्कर लगाते समय आयोडिक्सेनोल एल्यूशन (आईईई) बफर (20 एमएम ट्राइस-एचसीएल पीएच 8.0, 15 एमएम नाक्वल) के 12 एमएल में धीरे-धीरे पाइपिंग द्वारा Iodixanol ढाल निकालने 3-गुना को पतला करें।
    5. शुद्ध और एक आयन विनिमय फिल्टर के माध्यम से पतला Iodixanol ढाल ध्यान केंद्रित. इसे धीरे-धीरे 1 ड्रॉप/s से अधिक तेज़ गति से पुश करें. इसे धोने के लिए फिल्टर के माध्यम से धीरे-धीरे IE बफ़र के 3 एमएल को पुश करें।
    6. एल्यूशन बफर (20 एमएम ट्राइस-एचसीएल पीएच 8.0;250 एम एनसीएल) के साथ 1-2 एमएल के साथ एक केन्द्रापसारक फिल्टर इकाई में Elute। 4 एमएल के अंतिम वॉल्यूम के लिए डिवाइस के लिए DPBS जोड़ें। कम से कम 0.5 एमएल फ़िल्टर में छोड़ दिया जाता है जब तक RT पर 2,000 x ग्राम पर सेंट्रीफ्यूज। ट्यूब के नीचे से तरल निकालें, DPBS के 4 एमएल और अपकेंद्रित्र के साथ फिर से फिर से भरें। इस चरण को दो बार दोहराएँ. सुनिश्चित करें कि फ़िल्टर पर संकेंद्रित सदिश की मात्रा पिछले अपकेंद्रण चरण के बाद लगभग 200 $L है।
    7. एक पिपेट का उपयोग कर 200 $Lconcentrated वेक्टर निकालें और यह बाँझ करने के लिए एक 0.22 मिमी फिल्टर के माध्यम से ध्यान केंद्रित धक्का. अलीकोट 200 [Linto एक 9 मिमी ग्लास शीशी के साथ interlocked डालने (सामग्री की तालिका) .
      नोट: AAV5 वेक्टर स्टॉक लंबे भंडारण के लिए -80 डिग्री सेल्सियस फ्रीजर में संग्रहीत किया जा सकता है, या 4 डिग्री सेल्सियस पर अगर 2 सप्ताह के भीतर इस्तेमाल किया।
  4. AAV5 वायरल वेक्टर titer निर्धारण
    1. उल्टे टर्मिनल दोहराएँ (ITR) अनुक्रम और आईटीआर अनुक्रम के लिए एक 5 ]FAM / 3 ]BHQ1 जांच के लिए प्राइमर के साथ मानक मात्रात्मक बहुलक श्रृंखला प्रतिक्रिया (QPCR) का उपयोग कर AAV5 titer का निर्धारण (सामग्री की तालिका)। एक मानक वक्र का उपयोग करें जो प्लाज्मिड युक्त आईटीआर की ज्ञात मात्रा के साथ प्राप्त किया गया है। प्रत्येक AAV वेक्टर की एक सीमा होनी चाहिए 1E+14 - 1E+15 जीनोम प्रतिप्रतिप्रतिप्रतिप्रतियां यदि आईटीआर अनुक्रम titer निर्धारण के लिए प्रयोग किया जाता है.
      नोट: एक सफल AAV5 वायरस उत्पादन 3E+13 की न्यूनतम सीमा में titers के साथ शेयर ों देता है - 7E+13 इकाइयों /

2. मस्तिष्क में reprogramming कारकों का इंजेक्शन

  1. पशु सेटअप, स्टीरियोटैक्सिक प्लेसमेंट और ड्रिलिंग
    नोट:इस प्रोटोकॉल Ascl1, Lmx1a और Nurr1 (ALN) के उपयोग पर केंद्रित NG2 glia के interneurons में reprogramming के लिए. हमारे अनुभव में, एक समान phenotype के interneurons अन्य कारक संयोजन का उपयोग कर प्राप्त किया जा सकता है11.
    1. सर्जरी से पहले, वेक्टर Cba-FLEX-Ascl1, Cba-FLEX-Lmx1a, Cba-FLEX-Nurr1 और रिपोर्टर वेक्टर Syn-FLEX-GFP युक्त वायरल मिश्रण तैयार करें। अंतिम मिश्रण करने के लिए खंड 1 में तैयार शेयरों में से हर एक जोड़ें, ताकि अंतिम वायरल समाधान reprogramming कारकों में से हर एक के 5% है (Ascl1, Lmx1a और Nurr1) और रिपोर्टर के 10% निर्माण (5% ए, 5% एल, 5% एन और 10% GFP).
      नोट: AAV5 वेक्टर घोला जा सकता है 4 डिग्री सेल्सियस पर संग्रहीत किया जा सकता है और विवो में भविष्य के उपयोग के लिए रखा।
    2. 4:1 अनुपात में वायु और नाइट्रस ऑक्साइड (एन2ओ) के मिश्रण में 2% isoflurane का उपयोग करके माउस को एनेस्थेटाइज करें। डायाफ्राम की गतिविधियों को देख कर जानवर की सांस लेने की निगरानी करें। सर्जरी के दौरान, 1-1.5 % आइसोफ्लुरेन का उपयोग करके संज्ञाहरण बनाए रखें।
      नोट: माउस मॉडल इसके द्वारा वर्णित एक माउस तनाव है कि विशेष रूप से NG2 glia में Cre व्यक्त के होते हैं. विवो reprogramming में विभिन्न माउस उपभेदों है कि glial कोशिकाओं की अन्य आबादी में क्रे व्यक्त का उपयोग कर प्राप्त किया जा सकता है (जैसे, astrocytes14).
    3. एक बार जानवर पूरी तरह से anesthetized है (जैसे, पूर्ण मांसपेशियों में छूट और पैर पैड में एक चुटकी के लिए कोई प्रतिक्रिया), चीरा साइट के आसपास के क्षेत्र दाढ़ी और stereotaxic फ्रेम करने के लिए जानवर ले आओ.
    4. सर्जरी के दौरान पशु के शरीर के तापमान को बनाए रखने के लिए, stereotaxic फ्रेम के आधार के लिए एक हीटिंग पैड देते हैं। माउस को एक साफ, सूखे कागज तौलिया पर रखें।
    5. ध्यान से कान सलाखों में माउस के सिर जगह है. यदि सही ढंग से रखा, सिर का कोई पार्श्व आंदोलन मनाया जाना चाहिए. 4 मिमी करने के लिए छोड़ दिया कान पट्टी सेट, stereotaxic फ्रेम में माउस रखने शुरू करने से पहले.
    6. जगह में दांत पट्टी सुरक्षित है, और फिर नाक पट्टी कस. सुनिश्चित करें कि सिर किसी भी आयाम में कदम नहीं है और सीधे आगे बिंदु (मध्य रेखा कान सलाखों के विमान के लंबवत जा रहा है). नेत्र सुरक्षा के लिए नेत्र मलम लागू करें।
    7. सर्जरी की शुरुआत से पहले, उपयुक्त analgesia प्रशासन (उदा., 0.05 मिलीग्राम/
    8. एक कपास धुंध या एक पोंछ 70% EtOH के साथ भिगो के साथ चीरा क्षेत्र साफ, आंख क्षेत्र के पास के बिना.
      नोट: इंट्रासेब्रल वायरल इंजेक्शन के लिए, एक 5 या 10 एमएल सिरिंज एक खींच ग्लास केशिका के साथ अनुकूलित प्रयोग किया जाता है। ग्लास केशिकाओं एक micropipette खींचने का उपयोग कर खींच रहे हैं, एक बहुत ठीक टिप के साथ एक केशिका में जिसके परिणामस्वरूप, जो प्रक्रिया के आक्रामकता को कम करेगा. सिरिंज में केशिका अनुकूलन करने के लिए, सिरिंज और कांच केशिका की सुई के बीच कनेक्शन पर रबर ट्यूबिंग के एक टुकड़े का उपयोग करें और इसे गर्मी स्रोत (उदा., एक लाइटर) का उपयोग करके पिघला एंटरल करें। दो टुकड़ों के बीच एक तंग कनेक्शन यकीन है कि वहाँ इंजेक्शन के दौरान कोई तरल पदार्थ लीक कर रहे हैं कर देगा. सर्जरी शुरू करने से पहले, नमकीन के साथ सिरिंज भरने और सिरिंज से बाहर तरल धक्का द्वारा इस परीक्षण.
    9. सिर की मिडलाइन के साथ लगभग 0.5-0.8 सेमी का चीरा बनाएं। दोनों cutaneous और उप cutaneous परतों के माध्यम से कट, एक स्केलपेल के साथ.
    10. चीरा के प्रत्येक पक्ष पर त्वचा फ्लैप चौड़ा. किसी भी रक्त के चीरा को साफ करें और कपास की कली के साथ अधस्त्वक् परतों को वापस परिमार्जन करें।
    11. जगह में stereotaxic फ्रेम के M/L-D/V हाथ ले जाएँ (जानवर के ऊपर) और इसे सुरक्षित.
      नोट: स्टीरियोटैक्सी फ्रेम पूर्ववर्ती/पोस्टर (ए/पी, वाई अक्ष), मध्य/पार्श्व (एम/एल, एक्स अक्ष) और डोर्सल/वेंट्रल (D/V, जेड अक्ष) अक्ष के साथ सिरिंज के समायोजन की अनुमति देता है।
    12. stereotaxic फ्रेम के विभिन्न अक्ष के साथ सिरिंज ले जाएँ, बस bregma के ऊपर कांच केशिका की नोक लाने के लिए ( जंक्शन बिंदु जहां विभिन्न खोपड़ी प्लेटें मिलते हैं).
    13. सुनिश्चित करें कि केशिका टिप पूरी तरह से दोनों A/P और M/L विमानों में सीधे है. एक अस्पष्ट संक्षिप्त के मामले में, पार्श्व और मिडलाइन टांके के औसत ले लो।
    14. जब केशिका की नोक सही रूप से bregma ऊपर रखा गया है, तो दोनों M/L और A/P मान 0.0 डिजिटल निर्देशांक काउंटर पर रीसेट करें।
    15. यह सुनिश्चित करने के लिए कि जानवर का सिर पूरी तरह से सपाट स्थिति में है, D/V निर्देशांक मान को मापने के लिए डिजिटल निर्देशांक काउंटर का उपयोग करें, जब A/P आर्म +2.0 और -2.0 (M/L $ 0.0) पर है, साथ ही साथ जब M/L आर्म +2.0 और -2.0 (A/P $ 0.0) पर है। तदनुसार टूथ बार और कान सलाखों की ऊंचाई समायोजित करें।
    16. striatum में वायरल वैक्टर के इंजेक्शन के लिए वांछित निर्देशांक के लिए सिरिंज ले जाएँ (A/P ] +1.0; M/L - 2.0, bregma के सापेक्ष).
    17. सिरिंज थोड़ा उठाएँ और, माइक्रोस्कोप के माध्यम से इंजेक्शन साइट को देखकर, इंजेक्शन निर्देशांक में एक दंत ड्रिल का उपयोग कर एक छेद ड्रिल. साइट पर ड्रिल करने के लिए शुरू, परिपत्र और कोमल तरीके से काम कर रहे.
      नोट: बहुत ज्यादा नीचे दबाव मत डालो, क्योंकि ड्रिल-बिट अतिरिक्त बल के बिना हड्डी के माध्यम से जाने के लिए पर्याप्त तेज होना चाहिए। लंबे, निरंतर ड्रिलिंग से बचें क्योंकि यह गर्मी पैदा करता है।
    18. ड्रिलिंग के अंत में, ड्यूरा मैटर बरकरार रहता है और इंजेक्शन के लिए उजागर की जाँच करें।
  2. Syringe सेटअप तैयारी
    1. खुले चीरा पर कपास धुंध का एक टुकड़ा रखें और नमकीन समाधान के साथ सिरिंज फ्लश।
    2. फ्लशिंग के बाद, 1-2 डिग्री सेल्सियस का एक हवा का बुलबुला लें, इसके बाद वायरल सदिशों वाले समाधान के 1 डिग्री एल के बाद, किसी भी अनजाने बुलबुले से बचें। सुनिश्चित करें कि वायरल समाधान आसानी से हवा बुलबुला नीचे कल्पना की जा सकती है, whilst इंजेक्शन जा रहा है.
  3. वायरल इंजेक्शन
    1. चीरा साइट पर से कपास धुंध निकालें, और stereotaxic फ्रेम के डी / वी हाथ का उपयोग कर सिरिंज कम. जैसे-जैसे खोपड़ी की सतह के पास आता है, सूक्ष्मदर्शी को ध्यान से देखें और ड्यूरा मैटर के डी/वी स्तर को मापें - यह कोमल दबाव में थोड़ा उभारना चाहिए।
    2. केशिका की नोक के साथ ड्यूरा मेटर को छूते समय, D/V निर्देशांक को 0.0 पर सेट करें।
    3. सिरिंज कम, वांछित गहराई करने के लिए धीरे धीरे प्रगति (D/V $ -2.7, ड्यूरा मैटर के सापेक्ष). सुनिश्चित करें कि प्रक्षेप पथ हड्डी के टुकड़ों से स्पष्ट है, ताकि सुई/केपिलरी का कोई झुकने नहीं देखा जाता है।
      नोट: प्रस्तुत निर्देशांक NG2-Cre चूहों के striatum में reprogramming कारकों का एक इंजेक्शन को देखें. अन्य मस्तिष्क क्षेत्रों के लिए इसी निर्देशांक इस्तेमाल किया जा सकता है. हमेशा एक डाई (जैसे Trypan ब्लू), रंग का मनका इंजेक्शन या एक नया माउस तनाव के मस्तिष्क में reprogramming कारकों के इंजेक्शन से पहले एक पत्रकार वायरल वेक्टर का उपयोग कर पहले इंजेक्शन के लिए निर्देशांक का परीक्षण. यदि ट्रिपन ब्लू इंजेक्शन, जानवरों को सर्जरी के तुरंत बाद बलिदान करने की आवश्यकता है और मस्तिष्क को अलग कर दिया गया है। ताजा दिमाग एक microtome का उपयोग कर काटा जा सकता है, जबकि जमे हुए, और मस्तिष्क में डाई की स्थिति के दृश्य द्वारा निर्धारित इंजेक्शन की साइट. यदि परीक्षण रंगीन मोती का उपयोग कर निर्देशांक, यह perfused पर इंजेक्शन की साइट निर्धारित करने के लिए संभव है और इंजेक्शन के बाद एक सप्ताह दिमाग में कटौती. वैकल्पिक रूप से, एक वायरल वेक्टर एक पत्रकार जीन ले जाने के साथ एक इंजेक्शन इस्तेमाल किया जा सकता है, और इंजेक्शन की साइट perfused कटौती दिमाग में निर्धारित.
    4. 0ण्4 डिग्री सेल्सियस प्रति मिनट की दर से वायरल विलयन का 1 डिग्री सेल्सियस इंजेक्शन। जब पूरी मात्रा इंजेक्शन है, सिरिंज वापसी से पहले 2 मिनट के एक प्रसार अवधि के लिए अनुमति देते हैं.
    5. प्रसार के बाद, धीरे-धीरे सिरिंज को तब तक वापस लेना जब तक कि केशिका की नोक पूरी तरह से मस्तिष्क से बाहर न हो जाए।
    6. घाव पर कपास धुंध का एक टुकड़ा रखें और नमकीन समाधान के साथ सिरिंज फ्लश करें।
    7. काम क्षेत्र से बाहर स्टीरियोटैक्सिक फ्रेम के M/L-D/V आर्म ले जाएँ।
  4. घाव बंद करने और बाद ऑपरेटिव प्रक्रियाओं
    1. ध्यान से सीवन धागा का उपयोग कर चीरा सीवन.
      नोट: इंजेक्शन जानवरों में इस्तेमाल किए जाने वाले सभी सीवन धागों को एंटी-वायरल डिटर्जेंट समाधान युक्त एक कप/वील में निपटाना चाहिए। एक ही समाधान शल्य चिकित्सा सामग्री के साथ संपर्क में किया गया है कि सर्जरी क्षेत्र के आसपास के सभी सतहों को साफ करने के लिए प्रयोग किया जाता है। सभी शल्य चिकित्सा उपकरण अच्छी तरह से धोया और प्रत्येक सर्जरी दिन के अंत में autoclaved हैं.
    2. स्टीरियोटैक्सिक फ्रेम से जानवर निकालें और एक के बाद ऑपरेटिव स्टेशन है, जो एक स्वच्छ, गर्म पिंजरे, भोजन और पानी के लिए उपयोग भी शामिल है, और जहां जानवर पूरी तरह से जाग जब तक रहता है में जगह है। इस अवधि के दौरान, पशु बारीकी से निगरानी जब तक चेतना आ गया है.
    3. पूर्व पूरी तरह से सर्जरी से ठीक हो गया है जब तक गैर संचालित जानवरों के साथ घर संचालित जानवरों मत करो।
    4. प्रतिदिन संचालित पशुओं की निगरानी करें। उपयोग किए गए टांके के आधार पर, सुनिश्चित करें कि यदि आवश्यक हो तो उन्हें हटा दिया जाता है। सभी जानवरों को पोस्ट ऑपरेटिव केयर के रूप में बुपेनोर्फिनम (1 मिली/किलोग्राम पर टेमजेसिक) को नीचे की ओर दिया गया था।
      नोट: यदि लगातार दो दिनों में एक ही सिरिंज का उपयोग कर के संचालन, यह पानी के साथ फ्लश, इथेनॉल 70% और पानी के बाद फिर से. किसी भी संभावित अवशेषों के विघटन की अनुमति देने के लिए, रात भर पानी से भरे सिरिंज को छोड़ दें।

3. इलेक्ट्रोफिजियोलॉजिकल रिकॉर्डिंग

  1. इलेक्ट्रोफिजियोलॉजी के लिए ऊतक टुकड़ा तैयारी
    चेतावनी: अच्छा इलेक्ट्रोफिजियोलॉजिकल रिकॉर्डिंग प्राप्त करने के लिए एक अच्छी तरह से निष्पादित ऊतक तैयारी आवश्यक है। कमरे को ध्यान से तैयार करें और बर्फ पर भ्रम और विच्छेदन के लिए उपकरण रखें।
    1. बर्फ ठंडा और ऑक्सीजनीकृत तैयार (95% हे2 और 5% सीओ2) परफ्यूजन, विच्छेदन और काटने के लिए Krebs समाधान (अल्ट्राप्यूर पानी में स्टॉक समाधान को कम करके और NaHCO3 और ग्लूकोज जोड़ने के द्वारा 10x स्टॉक से एक ही दिन पर यह तैयारी)। एम एम में Krebs समाधान में घटक (1x करने के लिए कमजोर पड़ने के बाद) हैं: 126 NaCl, 2.5 KCl, 1.2 NaH2पीओ4] ज2व्, 1.3 एमजीसीएल2[6H2व्, और 2.4 CaCl2]6H2O, 22 NaHCO3, 10 ग्लूकोज. समाधान के pH को 7.4 तक समायोजित करें.
    2. एक नया उस्तरा ब्लेड के साथ vibratome के लिए एक अंशांकन (Vibracheck) प्रदर्शन.
    3. vibratome के ठंडा ब्लॉक शुरू (या बर्फ के साथ आसपास के कक्ष को भरने), उपयोग करने से पहले कम से कम 30 मिनट के साथ ऑक्सीजन के लिए Krebs समाधान के साथ काटने कक्ष भरें.
    4. बर्फ पर एक पेट्री पकवान रखो और यह oxygenized Krebs समाधान के साथ भरें. बर्फ पर ब्लेड, कैंची और बढ़ते प्लेट रखें।
      चेतावनी: acclimateization के लिए प्रक्रिया शुरू करने से पहले कम से कम 1 एच कमरे में माउस युक्त पिंजरे लाओ. तनाव मस्तिष्क ऊतक वर्गों की स्थिति पर एक नकारात्मक प्रभाव पड़ता है.
    5. पेन्टोबार्बिटल की अधिक मात्रा का इंजेक्शन लगाकर माउस को अंत:स्थ रूप से एनेस्थेटाइज करें और जानवर को सो जाने दें।  जब पलक पलटा बाहर है और पशु दर्द उत्तेजनाओं का जवाब नहीं है, transcardially 2-3 मिनट के लिए बर्फ ठंडा Krebs समाधान के साथ जानवर perfuse (10-20 एमएल /
    6. तेजी से, लेकिन ध्यान से, मस्तिष्क को अलग करें और इसे पेट्री-डिश में उल्टा कर दें जो बर्फ पर रखा गया है (क्रेब्स समाधान युक्त)।
      नोट: आदेश में reprogrammed न्यूरॉन्स के कार्यात्मक परिपक्वता की तुलना करने के लिए, अलग अलग समय अंक के बाद वायरल इंजेक्शन पर रिकॉर्डिंग के लिए जानवरों का बलिदान. मौजूदा साहित्य15 के आधार पर न्यूरॉन्स के अलग उपप्रकारों के फायरिंग गुणों का आकलन करें।
    7. मध्य सेरिबैलम के साथ एक कोरोनल कट करें और वाइब्राटोम काटने के लिए बढ़ते प्लेट (आइस-कोल्ड) पर इस तरफ गोंद करें।
    8. ग्लू मस्तिष्क को वाइब्रेटोम में बफर चैम्बर में ध्यान से डुबोएं।
      चेतावनी: अपनी खुद की सुरक्षा के लिए उस्तरा ब्लेड को छूने के लिए नहीं सावधान रहें, और इतना है कि ब्लेड calibrated रहेगा।
    9. मस्तिष्क के सबसे रोस्ट्रल भाग से नीचे एक उच्च गति पर striatal स्तर तक कट. फिर धीमी गति से 275 मिमी (0.10 मिमी/s) पर striatum coronally कटौती।
    10. प्रत्येक कटौती के बाद, ध्यान से गैर इंजेक्शन striatal पक्ष को दूर (उदा., एक झुका सुई के साथ) और एक पानी के स्नान में एक और शीशी में इंजेक्शन पक्ष हस्तांतरण, एक नीचे शुद्ध (आरटी पर oxygenized Krebs) एक पानी स्नान में रखा युक्त. सभी वर्गों में कटौती कर रहे हैं जब तक आरटी पर यह रखें.
    11. धीरे-धीरे पानी के स्नान के तापमान को 37 डिग्री सेल्सियस तक बढ़ाएं और इसे 30 मिनट के लिए छोड़ दें। फिर हीटर बंद कर देते हैं और आरटी तक शांत हो जाओ।
      नोट: इस बिंदु पर, आप रोक सकते हैं जब तक आप रिकॉर्डिंग शुरू करते हैं. वर्गों 4-6 एच के लिए पिछले.
  2. पूरे सेल पैच-क्लैम्प रिकॉर्डिंग
    1. Krebs समाधान की एक सतत प्रवाह में डूब रिकॉर्डिंग कक्ष के लिए पहले ऊतक अनुभाग स्थानांतरण. हल्के वजन का उपयोग कर अनुभाग माउंट और उद्देश्य डूब.
    2. माइक्रोस्कोप में striatal क्षेत्र की पहचान और GFP सकारात्मक (reprogrammed) न्यूरॉन्स के लिए खोज. एक न्यूरॉन है कि आकृति विज्ञान में व्यापक है और फाइबर बंडलों या रक्त वाहिकाओं द्वारा कवर नहीं का चयन करें.
    3. पैचिंग के लिए बोरोसिलिकेट ग्लास पिपेट (3-7 एमजेड) तैयार करें और निम्नलिखित इंट्रासेल्यूलर समाधान (एमएम में) के साथ भरें: 122.5 पोटेशियम ग्लूकोनेट, 12.5 केसीएल, 0.2 ईजीटीए, 10 HEPES, 2 MgATP, 0.3 Na3GTP और 8 NaCl, को समायोजित करने के लिए पीएच 7.3 KOH के साथ।
    4. biocytin भरने के लिए, आंतरिक समाधान और भंवर के 1 एमएल करने के लिए biocytin नमक की 1 मिलीग्राम जोड़ें.
      चेतावनी: biocytin के साथ आंतरिक समाधान फिल्टर करने के लिए सुनिश्चित करें के रूप में यह अन्यथा इलेक्ट्रोड रोकना कर सकते हैं.
    5. रिकॉर्डिंग इलेक्ट्रोड के लिए कांच पिपेट संलग्न करें और समाधान में डुबकी। इलेक्ट्रोड के प्रतिरोध की दो-दो जाँच करें। फिर धीरे धीरे पिपेट के साथ सेल दृष्टिकोण, इलेक्ट्रोड में एक मामूली सकारात्मक दबाव रखने के लिए टिप plugging से बचने के लिए.
      चेतावनी: इलेक्ट्रोड उतरते समय अपने सेल का ट्रैक रखने के लिए और सेल में फ्लोरोसेंट ब्लीच करने के लिए नहीं सावधान रहें (यानी, जब आप इसे ज़रूरत नहीं है फ्लोरोसेंट दीपक बंद कर देते हैं).
    6. आसपास के ऊतकों को सावधानी से इलेक्ट्रोड के सकारात्मक दबाव का उपयोग करक लें और इलेक्ट्रोड के साथ सेल से संपर्क करें। कोशिका के शीर्ष पर इलेक्ट्रोड सही का पता लगाएँ और उतर जब तक इलेक्ट्रोड झिल्ली को छुआ. इलेक्ट्रोड और कोशिका झिल्ली के बीच एक गिगा-जेड सील करें, और नकारात्मक दबाव दालों के साथ, एक पूरे सेल पैच बनाने के लिए झिल्ली को तोड़ना।
      चेतावनी: पुनः क्रमादेशित न्यूरॉन्स संवेदनशील होते हैं. पैचिंग करते समय सावधान रहें और गिगा-जेड सील तक पहुंचने या कोशिका झिल्ली को खोलते समय बहुत अधिक नकारात्मक दबाव न डालें। इसके अलावा, बड़े होते हैं कि जानवरों पर पैचिंग अभ्यास और धैर्य की आवश्यकता के रूप में उनके संयोजी ऊतक मोटा है और यह न्यूरॉन्स कल्पना करने के लिए कठिन है.
    7. वर्तमान-क्लैम्प मोड में तोड़ने के तुरंत बाद आराम झिल्ली क्षमता की जाँच करें और विश्लेषण के लिए नीचे लिखें।
    8. वर्तमान क्लैम्प में, -60 एमवी से -80 एमवी के बीच सेल को बनाए रखें और कार्रवाई क्षमताओं को प्रेरित करने के लिए 10 pA वृद्धि के साथ -20 pA से +90 pA तक 500 एमएस धाराओं को इंजेक्ट करें।
    9. वोल्टेज-क्लैम्प में स्थानांतरण करें और आवक सोडियम को मापने और 10 एमवी के depolarizing चरणों पर पोटेशियम धाराओं को सुधारने में देरी।
      नोट: वोल्टेज-क्लैम्प रिकॉर्डिंग बेहतर एक अलग आंतरिक समाधान का उपयोग कर मूल्यांकन कर रहे हैं, रसायनों से बना है कि और अधिक कुशलता से झिल्ली दबाना. हालांकि, reprogrammed न्यूरॉन्स के लिए, कोशिकाओं है कि आप से रिकॉर्ड कर सकते हैं की संख्या कुछ है और इन न्यूरॉन्स के साथ ऊतक वर्गों की संख्या सीमित है. इसलिए, यह एक ही सेल से वर्तमान-क्लैम्प और वोल्टेज-क्लैम्प दोनों में रिकॉर्ड करने के लिए एक लाभ है।
    10. वोल्टेज-क्लैम्प मोड में, -70 एमवी पर सहज पोस्टीनैप्टिक गतिविधि रिकॉर्ड करें। -70 एमवी पर उत्तेजक घटनाओं से 0 एमवी की झिल्ली क्षमता पर निरोधात्मक पदों को अलग करें।
    11. एक स्थिर आधार रेखा तक पहुँचने के बाद, Picrotoxin जोड़ने, गाबाएक रिसेप्टर विरोधी, रिकॉर्डिंग कक्ष में बहती है कि Krebs समाधान करने के लिए, उत्तेजक घटनाओं को निकालने के लिए (Picrotoxin के एक शेयर समाधान जोड़ने के लिए एक अंतिम एकाग्रता के लिए 50 एमएम अलग बफर सिरिंज जो कक्ष भ्रम से जुड़ा हुआ है. सुरक्षित निपटान के लिए एक वैक्यूम बैग के लिए कक्ष से बफर के बहिर्वाह कनेक्ट).
    12. 20 मिनट के बाद, CNQX जोड़ें (20 एमएम), एक AMPA विरोधी, Krebs समाधान है कि रिकॉर्डिंग कक्ष में बहती है, निरोधात्मक घटनाओं को ब्लॉक करने के लिए (Picrotoxin के लिए के रूप में एक ही प्रक्रिया का उपयोग). एक और 20 मिनट के लिए छोड़ दो और फिर Krebs समाधान के साथ बाहर धोने. कक्ष से ऊतक अनुभाग निकालें.
    13. रिकॉर्डिंग खत्म करने के बाद, विश्लेषण कार्यक्रम में एक दहलीज-घटना का पता लगाने का उपयोग कर सहज उत्तेजक पोस्ट-synaptic धाराओं (EPSC) और निरोधात्मक पोस्ट-synaptic धाराओं (IPSC) का एक ऑफ़लाइन विश्लेषण करते हैं।
    14. पूरी रिकॉर्डिंग के दौरान, सेल धीरे-धीरे biocytin युक्त आंतरिक समाधान से भर जाएगा। धीरे धीरे सेल की पूरी भरने को प्राप्त करने के क्रम में इलेक्ट्रोड को हटाने से पहले कम से कम 20 मिनट के लिए पैच रखें.
      चेतावनी: इलेक्ट्रोड में कोई सकारात्मक दबाव नहीं है कि बाद में कोशिकाओं के लगातार रूपात्मक विश्लेषण को नष्ट कर सकता है सावधान रहें.
    15. बायोसाइटिन-विजुअलाइजेशन के लिए, ऊतक अनुभाग को 4 % पैराफॉर्मेल्डिहाइड (पीएफए) रात भर 4 डिग्री सेल्सियस में रखें। 0.02 एम पोटेशियम फॉस्फेट बफर (KPBS) में 0.1% Triton के साथ अनुभाग कुल्ला. फिर, sreptavidin के लिए दाग- Cy3 (1: 600 KPBS-टी में, 2 एच), biocytin से भरे सेल और reprogrammed न्यूरॉन के रूपात्मक दृश्य की पहचान के लिए.
      नोट: Biocytin भरने morphological विश्लेषण और समझौता न्यूरॉन्स के चित्र के लिए इस्तेमाल किया जा सकता है.

4. इम्यूनोहिस्टोकेमिस्ट्री, स्टीरियोलॉजी, और क्वांटिफिकेशन

नोट: इम्यूनोहिस्टोकेमिस्ट्री के लिए चूहों के एक विशिष्ट समूह को समर्पित करें, क्योंकि इलेक्ट्रोफिजियोलॉजी के लिए उपयोग किए जाने वाले ऊतक अनुभाग इम्यूनोहिस्टोकेमिस्ट्री के लिए इष्टतम नहीं हैं।

  1. एक आई.पी. पेंटोबार्बिटल की अधिक मात्रा के इंजेक्शन के साथ चूहों को एनेस्थेटाइज करें और पर्सनल के लिए जानवर को माउंट करें।
  2. Transcardially चूहों perfuse, पहले एक नमकीन समाधान के साथ रक्त को दूर करने के लिए, और फिर बर्फ ठंडा 4% पीएफए के साथ.
  3. 4% पीएफए में कम से कम 12 एच के लिए दिमाग और पोस्ट-फिक्स को अलग करें।
  4. लगभग 12 ज के लिए 25% सुक्रोज समाधान (cryoprotection के लिए) में दिमाग रखो.
    नोट: दिमाग को काटने के लिए तैयार हैं जब वे 25% sucrose समाधान में सिंक, यह दर्शाता है कि sucrose पूरे माउस मस्तिष्क में प्रवेश किया है.
  5. सेरिबैलम भर में एक कोरोनल कटौती करें, मस्तिष्क के फ्लैट, सबसे पुच्छीय भाग का उपयोग करने के लिए एक microtome पर मस्तिष्क जगह है और यह जगह में इष्टतम काटने तापमान यौगिक (OCT) का उपयोग कर ठीक.
  6. 35 मिमी की मोटाई के साथ कोरोनल स्लाइस में मस्तिष्क कट और 0.02 एम KPBS युक्त शीशियों या कुओं में रखा लगातार श्रृंखला में मस्तिष्क विभाजित.
  7. जीएफपी और इंटरन्यूरॉन मार्कर जैसे GAD65/67, PV, चैट (कोलीन ऐसीटिलट्रांसफरेस) और एनपीवाई (न्यूरोपेप्टाइड वाई) के खिलाफ एंटीबॉडी का उपयोग करके इम्यूनोहिस्टोकेमिस्ट्री के लिए वर्गों को संसाधित करें, मानक प्रोटोकॉल16, 17 केअनुसार।
    नोट: मस्तिष्क स्लाइस लंबी अवधि के लिए विरोधी फ्रीज समाधान में 4 डिग्री सेल्सियस या -20 डिग्री सेल्सियस पर रखा जा सकता है।
  8. धुंधला पूरा होने के बाद, एक ग्लास स्लाइड पर वर्गों माउंट और एक गिलास coverslip के साथ कवर, जगह में इसे ठीक करने के लिए एक बढ़ते समाधान का उपयोग कर। रात को सूखने के लिए छिपी स्लाइड्स को छोड़ दें।
    नोट: हमारे अध्ययन के लिए, पूरे दिमाग 1:8 श्रृंखला में काट रहे हैं (यानी, वर्गों युक्त प्रत्येक शीशी माउस मस्तिष्क11के एक आठवें पकड़ होगा).
  9. एक उल्टे फ्लोरोसेंट और /
    चेतावनी: फ्लोरिसेंट माइक्रोस्कोपी परिणामों के सामान्य अवलोकन और पुनर्प्रोग्रामन दक्षता की गणना के लिए छवियों को कैप्चर करने के लिए उपयोगी है। डबल सकारात्मक कोशिकाओं के अवलोकन से phenotypic पहचान के एक अधिक विस्तृत विश्लेषण के लिए, confocal इमेजिंग इस्तेमाल किया जाना चाहिए.
  10. GFP में व्यक्त विभिन्न मार्करों के परिमाण के लिए+ न्यूरॉन्स striatum में, GFP की कुल संख्या के संबंध में डबल सकारात्मक कोशिकाओं की संख्या गिनती+ कोशिकाओं (यानी, reprogrammed न्यूरॉन्स), प्रत्येक के कम से कम दो क्षेत्रों में striatal अनुभाग.
  11. मस्तिष्क प्रति reprogrammed न्यूरॉन्स की अनुमानित extrapolated कुल संख्या का निर्धारण करने के लिए, पहले कटौती मस्तिष्क श्रृंखला में से एक के striatum में मौजूद GFP+ न्यूरॉन्स गिनती, और फिर श्रृंखला की कुल संख्या से गुणा.
    नोट: परिमाणीकरण के विभिन्न तरीकों reprogramming दक्षता व्यक्त करने के लिए इस्तेमाल किया जा सकता है, पशु प्रति reprogrammed न्यूरॉन्स की संख्या और न्यूरॉन्स का प्रतिशत है कि कुछ phenotypic मार्करों व्यक्त. अधिक जानकारी के लिए, पिछला प्रकाशन11देखें.
  12. ग्राफ पैड Prism या इसी तरह का उपयोग कर शर्तों के बीच मतभेदों का विश्लेषण करें.
    नोट: दक्षता गणना के लिए, हम CRE-निर्भर ALN रूपांतरण वैक्टर और GFP रिपोर्टर के साथ NG2-Cre चूहों इंजेक्शन. रूपांतरण दक्षता का अनुमान लगाने के लिए, हम भी सर्वव्यापी cba प्रमोटर के तहत एक क्रे-निर्भर GFP के साथ जानवरों इंजेक्शन, सभी लक्षित कोशिकाओं GFP+प्रतिपादन . इस तुलना का उपयोग करते हुए, हमने अनुमान लगाया कि 66.81% - लक्षित कोशिकाओं के 38.38% न्यूरॉन्स में परिवर्तित. जीनों में से प्रत्येक की अभिव्यक्ति के सत्यापन के लिए, पूरक डबल इम्यूनोफ्लोरेसेंट-स्टेनिंग GFP/Ascl1, GFP/Lmx1a और GFP/Nurr1 के लिए किया जा सकता है। इसके अतिरिक्त, जीनोम अनुक्रमण जैसे एकल कोशिका आरएनए अनुक्रमण reprogrammed कोशिकाओं में जीन के प्रत्येक एक की उपस्थिति प्रकट कर सकते हैं.

Representative Results

AAV वैक्टर के इंजेक्शन सफलतापूर्वक NG2-Cre माउस striatum में न्यूरॉन्स में निवासी NG2 glia कोशिकाओं reprogram करने के लिए प्रयोग किया जाता है (चित्र 1A) . विशेष रूप से NG2 glia को लक्षित करने के लिए, REprogramming/reporter जीन के साथ FLEX वैक्टर, एक antisense दिशा में डाला जाता है और antiparallel के दो जोड़े द्वारा flanked, विषमप्ररूपिक loxP साइटों (चित्र 1B) . तीन reprogramming जीन में से प्रत्येक (Ascl1, Lmx1a और Nurr1) अलग-अलग वैक्टर पर सर्वव्यापी cba प्रमोटर के नियंत्रण में रखा गया है. GFP अभिव्यक्ति एक क्रे-एक्सप्रेशन सेल से शुरू होने वाले reprogrammed न्यूरॉन्स के लिए प्रतिबंधित है बनाने के लिए, GFP न्यूरॉन विशेष synapsin प्रमोटर के नियंत्रण में रखा गया है, (यह भी एक FLEX वेक्टर में).

reprogramming और रिपोर्टर constructs के संयोजन का उपयोग माउस striatum में GFP सकारात्मक न्यूरॉन्स की पीढ़ी के लिए अनुमति देता है (चित्र 1C, सी '). पुनः प्रोग्रामजीन की उपस्थिति के बिना रिपोर्टर निर्माण का उपयोग जीएफपी-पॉजिटिव न्यूरॉन्स को प्राप्त नहीं करता है (चित्र 1D)।

बायोसाइटिन से भरे हुए पुन: प्रोग्राम किए गए न्यूरॉन्स पोस्ट-मॉर्टम इम्यूनो-स्टेनिंग के बाद दिखाई देते हैं (चित्र 2क)। यदि रूपांतरण सफल होता है, वहाँ व्यापक न्यूरोनल आकारिकी होना चाहिए. पुनः प्रोग्राम किए गए न्यूरॉन्स की इलेक्ट्रोफिजियोलॉजिकल रिकॉर्डिंग में स्फूर्तिपूर्ण क्रियाकलाप उपायों के साथ पद-प्रयत्नात्मक क्रियात्मक संबंधों की उपस्थिति दिखाई देती है (चित्र 2 ख,ब्) यह या तो ionotropic GABAergic या glutamatergic अवरोधक के साथ अवरुद्ध किया जा सकता है (Picrotoxin या CNQX), reprogrammed न्यूरॉन्स के लिए दोनों उत्तेजक और निरोधात्मक synaptic इनपुट का सुझाव. समय के बाद वायरल इंजेक्शन (चित्र 2डी) के साथ सहज गतिविधि की घटना बढ़ जाती है , जो एक क्रमिक परिपक्वता का संकेत देती है।

वर्तमान प्रेरित कार्रवाई क्षमता कार्यात्मक न्यूरॉन्स में मौजूद हैं. क्रिया संभाव्यता रूपांतरण के बाद समय के साथ संख्या में वृद्धि होती है (चित्र 2ई)। यह आगे न्यूरॉन समारोह में परिपक्वता इंगित करता है. अपरिपक्व तंत्रिकामें, धारा या तो कोई नहीं या बहुत कम क्रिया संभाव्यता को प्रेरित करेगी (चित्र 2 एफ)।

एक न्यूरॉन की फायरिंग पैटर्न कोशिका प्रकार विशिष्ट है क्योंकि यह कोशिकाओं की आकृति विज्ञान और चैनल अभिव्यक्ति15जैसे कारकों पर निर्भर करता है। इन विवो reprogrammed न्यूरॉन्स में दर्ज पैटर्न समूहों में प्रतिष्ठित किया जा सकता है और अंतर्जात न्यूरॉन उपप्रकारों की तुलना में, उदाहरण के लिए तेजी से spiking interneurons (सेल प्रकार बी, चित्रा 3 बी) या अन्य सेल प्रकार ( चित्र ासाकीर्तक,सी,डी ). प्रेक्षित इलेक्ट्रोफिजियोलॉजिकल अंतरों की पुष्टि विशिष्ट उपप्रकार मार्करों और जीएफपी के साथ सह-अभिव्यक्ति की उपस्थिति से की जा सकती है (चित्र 3ई-एच)। कुल मिलाकर, इस डेटा इंगित करता है कि striatum में मौजूद reprogrammed न्यूरॉन्स interneurons के विभिन्न प्रकार के गुण है, जैसे Parvalbumin-, ChAt- और NPY- interneurons व्यक्त, साथ ही striatal मध्यम spiny न्यूरॉन पहचान (DARPP32 +) ( चित्र 3E -H).

Figure 1
चित्र 1: न्यूरॉन्स में निवासी NG2 glia के vivo reprogramming में. (क) एएवी वायरस का योजनाबद्ध प्रतिनिधित्व, शितल NG2 ग्लिया के विवो रीप्रोग्रामन में मध्यस्थता किया गया. (बी) एएवी5 फ्लेक्स का योजनाबद्ध प्रतिनिधित्व विवो रीप्रोग्रामिंग में प्रयोग किया जाता है, जिसमें जीन अभिव्यक्ति को लक्षित कोशिकाओं में क्रे अभिव्यक्ति द्वारा विनियमित किया जाता है। (सी और सी)विवो reprogrammed न्यूरॉन्स में, Syn-GFP से जिसके परिणामस्वरूप + ALN इंजेक्शन Striatum में. (घ) जब वायरल कॉकटेल में कोई पुनर्प्रोग्रामन कारक नहीं जोड़े जाते हैं, तो पुनः क्रमादेशित न्यूरॉन्स की अनुपस्थिति, और केवल रिपोर्टर निर्माण विवो में इंजेक्ट किया जाता है। स्केल बार - 100 मिमी (सी), 25 मिमी (सी'), 25 मिमी (डी)। कृपया इस चित्र का एक बड़ा संस्करण देखने के लिए यहाँ क्लिक करें.

Figure 2
चित्रा 2: विवो reprogrammed न्यूरॉन्स में कार्यात्मक हैं और समय के साथ परिपक्वता दिखा. (ए) बायोसाइटिन से भरे पुनर्प्रोग्रामित न्यूरॉन, डेनड्रिटिक रीढ़ सहित परिपक्व न्यूरोनल आकृति विज्ञान को दर्शाता है। ट्रेस से पता चलता है (बी) निरोधात्मक (GABAergic) गतिविधि है कि picrotoxin के साथ अवरुद्ध है, एक गाबाएक रिसेप्टर विरोधी और (सी) उत्तेजक गतिविधि है कि CNQX के साथ अवरुद्ध है, एक AMPA रिसेप्टर विरोधी. (घ) समय के साथ-साथ पोस्टिनैप्टिक गतिविधि वाले न्यूरॉन्स की संख्या बढ़ जाती है। () पैचकिए हुए न्यूरॉन्स में पहले से ही 5 सप्ताह के बाद इंजेक्शन (w.p.i.) पर दोहराए जाने वाली फायरिंग दिखाते हैं और यह दिखाना जारी रखते हैं कि 8 और 12 w.p.i. (F) वर्तमान-प्रेरित कार्रवाई क्षमता और किसी अपरिपक्व न्यूरॉन की पोस्टीनैप्टिक गतिविधि, कुछ synaptic दिखा रहा है घटनाओं और कुछ कार्रवाई क्षमता बी और डी स्केल बार की तुलना में - 25 मिमी कृपया इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहाँ क्लिक करें.

Figure 3
चित्रा 3: विवो reprogrammed न्यूरॉन्स में इम्यूनोहिस्टोकेमिकल और striatal interneurons के इलेक्ट्रोफिजियोलॉजिकल गुण दिखाते हैं। (ए-डी) विवो reprogrammed न्यूरॉन्स में की फायरिंग पैटर्न अलग प्रकार के हो सकते हैं: (एक) प्रकार एक अंतर्जात मध्यम spiny न्यूरॉन के समान है (DARPP32+); (बी) तेजी से spiking के समान (पीवी +) interneurons; (सी) प्रमुख साग (एनपीवाई +) के साथ कम थ्रेसहोल्ड spiking न्यूरॉन्स के समान; (डी) न्यूरॉन्स बड़े के साथ फायरिंग-hyperpolarization (Chat+). (ई-एच) GFP के सह-स्थानीयकरण और interneuron मार्करों पीवी (), ChAT (एफ), NPY (जी), और प्रक्षेपण न्यूरॉन मार्कर DARPP32 (एच) दिखा confocal छवियों . सभी पैमाने पर सलाखों - 50 मिमी. कृपया यहाँ क्लिक करें इस आंकड़े का एक बड़ा संस्करण देखने के लिए.

Discussion

विवो प्रत्यक्ष reprogramming में क्रे-एक्सप्रेसिंग माउस उपभेदों में एएवी FLEX सदिशों का उपयोग कर प्राप्त किया जा सकता है। यह नोट करना महत्वपूर्ण है कि माउस उपभेदों के बीच reprogramming प्रभावकारिता के संबंध में मतभेद देखा गया है. के लिए vivo striatum में reprogramming, NG2-Cre माउस लाइन और अधिक कुशल जब अन्य उपभेदों के साथ तुलना में साबित कर दिया है. एक नया पशु तनाव का उपयोग शुरू करने से पहले, यह समय के साथ क्रे अभिव्यक्ति के बारे में माउस प्रदाता दिशा निर्देशों की जांच करने के लिए महत्वपूर्ण है, जानवरों की उम्र के रूप में अक्सर इस प्रोटीन अभिव्यक्ति की विशिष्टता को प्रभावित करता है. हमारे अध्ययन में, 12 सप्ताह से पुराने जानवरों के लिए vivo reprogramming में इस्तेमाल नहीं किया गया के रूप में वहाँ NG2 glia के अलावा अन्य कोशिकाओं में क्रे अभिव्यक्ति के लिए एक जोखिम था. नियंत्रण जानवरों की निरंतर उपस्थिति और निगरानी केवल Synapsin-FLEX-GFP निर्माण के साथ इंजेक्शन की सलाह दी है. यह GFP-सकारात्मक कोशिकाओं के लिए जानवरों की निगरानी की अनुमति देता है कि अगर कोई reprogramming जीन (ALN) का उपयोग किया जाता है मौजूद नहीं होना चाहिए.

नए reprogrammed न्यूरॉन्स की पहचान करने के लिए, इस प्रोटोकॉल में वर्णित एक के रूप में एक न्यूरॉन विशेष पहचान विधि अत्यंत महत्वपूर्ण है. यह एक उचित पहचान और अंतर्जात आसपास की कोशिकाओं है कि विशेष प्रासंगिकता की है जब एक homotopic क्षेत्र में reprogramming से reprogrammed न्यूरॉन्स के भेद के लिए अनुमति देता है.

वायरल इंजेक्शन के लिए सही संरचना को लक्षित करना भी महत्वपूर्ण है। इसलिए, वायरल इंजेक्शन के लिए stereotaxic सर्जरी महत्वपूर्ण है और सटीकता के साथ संपर्क किया जाना चाहिए, खासकर जब मस्तिष्क के छोटे संरचनाओं को लक्षित.

हम पहले से पता चला है11 कि यह एक ही reprogramming कारकों का उपयोग कर इन विट्रो reprogramming प्रयोगों के आधार पर vivo reprogramming में के परिणाम की भविष्यवाणी करने के लिए विश्वसनीय नहीं है. ब्याज के सभी कारकों इसलिए vivo में परीक्षण किया जाना चाहिए. हमारे हाथों में, कई अलग अलग कारक संयोजन न्यूरॉन्स के एक ही उपप्रकार दे (यानी, interneurons11 vivo में) तथ्य यह है कि इन जीन अन्य न्यूरॉन्स के विकास में फंसाया गया है के बावजूद.

reprogrammed न्यूरॉन्स के लिए पूरे सेल पैच दबाना एक नाजुक तकनीक है और ऊतक प्रसंस्करण एक अच्छा परिणाम के लिए महत्वपूर्ण है. बर्फ ठंडा Krebs समाधान के साथ भ्रम ऊतक की गुणवत्ता में सुधार. इसके अलावा, समझौता न्यूरॉन्स ध्यान से इलाज किया जाना चाहिए. यहां तक कि अगर परिपक्वता और reprogrammed न्यूरॉन्स के phenotypic पहचान कुछ हद तक पूरे सेल पैच दबाना का उपयोग कर मूल्यांकन किया जा सकता है, इन कोशिकाओं को पूरी तरह से उनके अंतर्जात समकक्षों के लिए तुलनीय नहीं हैं. विश्लेषण के अतिरिक्त प्रकार, जैसे जीनोम अनुक्रमण (जैसे, आरएनए अनुक्रमण) का उपयोग पुनः प्रोग्राम किए गए सेल पहचान की पुष्टि करने के लिए किया जाना चाहिए।

यहाँ वर्णित तकनीक भविष्य के उपचार जहां न्यूरॉन प्रतिस्थापन मस्तिष्क में की जरूरत है के विकास के लिए विचार किया जा सकता है. हालांकि विवो reprogramming में अपनी प्रारंभिक अवस्था में अब भी है और मनुष्यों में अनुवाद अभी तक पूर्वानुमान नहीं है, इस तकनीक मस्तिष्क में exogenous जीन समारोह का आकलन और विवो में अध्ययन कोशिका परिपक्वता के लिए एक विधि प्रदान कर सकता है.

Disclosures

लेखकों को खुलासा करने के लिए कुछ भी नहीं है.

Acknowledgments

Marcela Birtele यूरोपीय संघ क्षितिज 2020 कार्यक्रम (H2020-MSCA-ITN-2015) मैरी Sk$odowska-Curie अभिनव प्रशिक्षण नेटवर्क और अनुदान समझौते नंबर 676408 के तहत द्वारा वित्त पोषित किया गया है. डेनिएला Rylander Ottosson स्वीडिश अनुसंधान परिषद (2017-01234) द्वारा वित्त पोषित किया गया है.

Materials

Name Company Catalog Number Comments
REAGENTS FOR AAV5 CLONING AND VIRAL VECTOR PREPARATION
pAAV-CA-FLEX AddGene 38042
Ascl1 AddGene 67291 NM_008553.4
Lmx1a AddGene 33013 NM_0033652.5
Nurr1 AddGene 35000 NM_013613.2
GFP-syn AddGene 30456
LoxP (FLEX) sequence 1 GATCTccataacttcgtataaagtatcctatac
gaagttatatcaaaataggaagaccaatgcttc
accatcgacccgaattgccaagcatcaccatcg
acccataacttcgtataatgtatgctatacgaa
gttatactagtcccgggaaggcgaagacgcgga
agaggctctaga
LoxP (FLEX) sequences 2 tactagtataacttcgtataggatactttatac
gaagttatcattgggattcttcctattttgatc
caagcatcaccatcgaccctctagtccacatct
caccatcgacccataacttcgtatagcatacat
tatacgaagttatgtccctcgaagaggttcgaa
ttcgtttaaacGGTACCCTCGAC
pDP5 Plasmid Factory PF435
pDP6 Plasmid Factory PF436
Phosphate-Buffered Saline (PBS) Thermo Fisher Scientific 10010023
FBS (Fetal bovine serum) Thermo Fisher Scientific 10500064
Penicillin streptomycin Thermo Fisher Scientific 15140122
DMEM (Dulbecco's Modified Eagle Medium)+ Glutamax Thermo Fisher Scientific 61965026
DPBS (Dulbecco's Phosphate Buffer Saline) Thermo Fisher Scientific 14190094
HEK293 cells Thermo Fisher Scientific 85120602-1VL
Flasks BD Falcon 10078780 175 cm2
Tris H-CL Sigma Aldrich 10812846001 For TE buffer use 10 mM, pH 8.0; for lysis buffer use 50mM, pH 8.5; for IE buffer use 20 mM, pH 8.0; for elution buffer use 20 mM, pH 8.0
EDTA EDTA: Invitrogen EDTA: AM9260G For TE buffer use 1 mM EDTA
Ultrapure water see Ultrapure water system
CaCl2 SigmaAldrich C5080 2.5 M
Dulbecco´s phosphate-buffered saline (DPBS) Thermo Fisher Scientific 14190136
NaCl Sigma-Aldrich S3014 FOR HBS use 140 mM; for Lysis Buffer use 150 mM; for IE buffer use 15 mM; for elution buffer use 250 mM
MgCl2 Sigma-Aldrich M8266-100G For lysis Buffer: 1 mM
Ultracentrifuge sealing tubes Beckman Coulter Quick-Seal® Polypropylene Tube
OptiPrep™ Density Gradient Medium Sigma Aldrich D1556-250ML
10-mL syringe-18G needle BD 305064
Laboratory glass bottles VWR ?
Anion exchange filter PALL laboratory MSTG25Q6 Acrodisc unit with Mustang Q membrane
Centrifugal filter unit Merck Z740210-24EA Amicon Ultra-4 device
Endotoxin-Free Plasmid DNA Isolation Kits Thermo Fisher Scientific A33073
Na2PO4 Sigma-Aldrich S7907
HEPES Sigma-Aldrich H7523 15 mL
Falcon tube Thermo Fisher Scientific Corning 352196
Falcon tube Thermo Fisher Scientific Corning 352070
Glass Vials Novatech 30209-1232 CGGCCTCAGFGAGCGA
Forward Primer for Inverted Terminal Repeat (ITR) sequence GGAACCCCTAGTGATGGAGTT
Reverse Primer for Inverted Terminal Repeat (ITR) sequence CACTCCCTCTCTGCGCGCTCG
5´FAM / 3´BHQ1 probe Jena Bioscience
0.22 mm filter Merck SLGV004SL Millex-GV filter
EQUIPMENT AAV5 VIRAL VECTOR PREPARATION
Freezer -20 °C
Freezer -80 °C
Fridge +4 °C
AAV viral room
Ultrapure Water system Merck Milli-Q® IQ 7000
Vortex mixer VWR 444-0004
Ultracentrifuge Beckman Coulter Beckman Optima LE-80K Ultracentrifuge
Autoclave Tuttnauer 2540 EL
Polymerase Chain Reaction (PCR) BioRad C1000 Touch Thermal Cycler
Quantitative PCR (qPCR) Roche LightCycler® 480 System
Centrifuge Thermo Fisher Scientific Sorvall ST16
Water Bath Thermo Fisher Scientific TSGP02
ANIMAL MODEL
NG2-Cre mice Jackson NG2-CrexB6129, Stock #008533
REAGENTS FOR INJECTION OF REPROGRAMMING FACTORS INTO THE BRAIN
Water
Saline Apoteket AB 70%
Ethanol Solveco
Isolfurane Apoteket AB Dilute to 1% solution with warm water.
Virkon Viroderm 7511 
Pentobarbital Apoteket AB P0500000 i.p. for terminal procedure at the dose of 60 mg/ml.
Sucrose Merck S0389-500G
Trypan Blu Thermo Fisher Scientific 15250061
Retrobeads Lumafluor R170
Buprenorphine Apoteket AB
EQUIPMENT FOR INJECTION OF REPROGRAMMING FACTORS INTO THE BRAIN From RSG Solingen.
Scissors VWR 233-1552 From Biochem.
Tweezers VWR 232-0007
Forcep VWR 232-0120
Scalpel holder VWR RSGA106.621 Number 20.
Scalpel VWR RSGA106.200
Stereotaxic frame Stoelting Europe 51500D
Mouse ear bars Stoelting Europe 51648 5 ul
Syringe with Removable needle Hamilton Company 65 0,75 inner diameter and 1.5 outer diameter.
Glass capilaries Stoelting 50811
Glass capillary puller Sutter company P-1000
Dental drill Agnthos AB 1464
Shaver Agnthos AB GT420
Isoflurane Chamber and pump Agnthos AB 8323101 2 mL
Syringes Merck Z118400-30EA 25G
Needles Merck Z192414 Aldrich
Mouse and neonatal rat adaptor for stereotaxic fram Stoelting 51625
Heating pad Braintree scientific, inc 53800M From Covidien 2187.
Cotton gauze Fisher Scientific 22-037-902
Rubber tube Elfa Distrelec HFT-A-9.5/4.8 PO-X BK 150
Cotton swabs Fisher Scientific 18-366-473
REAGENTS FOR WHOLE-CELL PATCH CLAMP RECORDINGS
NaCl Sigma-Aldrich S3014
KCl Sigma-Aldrich P9333
NaH2PO4-H2O Sigma-Aldrich S9638
MgCl2-6 H2O Sigma-Aldrich M2670
CaCl2-6 H2O Sigma-Aldrich C8106
MgSO4-7 H2O Sigma-Aldrich 230391
NaHCO3 Sigma-Aldrich S5761
Glucose Sigma-Aldrich G7021 see Ultrapure Water system
Ultrapure Water Prepare 1 or 2M.
KOH Sigma-Aldrich P5958-500G
K-D-gluconate Sigma-Aldrich G4500 Sigma
KCl Sigma-Aldrich P9541
KOH-EGTA (Etilene glycol-bis-N-tetracetic acid) Sigma-Aldrich E3889 Sigma
KOH- Hepes acid (N-2-hydroxyethylpiperazine-N’-2-ethanesulfonic acid) Sigma-Aldrich H7523
NaCl Sigma-Aldrich S3014
Mg2ATP Sigma-Aldrich A9187
Na3GTP Sigma-Aldrich G8877
Biocytin Sigma-Aldrich B4261
Picrotoxin Merck P1675 Sigma
CNQX Merck C239 Sigma
Ice
EQUIPMENT FOR WHOLE-CELL PATCH CLAMP RECORDINGS
Borosilicate glass pipette Sutter Company B150-86-10
Glass capillary puller Sutter company P-1000
Vibratome Leica Leica VT1000 S
WaterBath Thermo Fisher Scientific TSGP02
Clampfit software Molecular Devices
Multiclamp software Molecular Devices
REAGENTS FOR IMMUNOHISTOCHEMISTRY Use at a concentration of 4%. CAUTION: PFA is a potent fixative. Avoid ingestion and contact with skin.
Paraformaldehyde (PFA) Merck Millipore 1040051000 Use at a concentration of 0.1%.
Triton X-100 Fisher Scientific 10254640 Donkey.Use at a concentration of 1 : 400.
Serum Merck Millipore S30-100ML Reconstitute the powder in Milli-Q water to 1 mg/mL. Aliquot and store at -20°C, light sensitive. Use at a concentration of 1 : 500.
4′,6-Diamidino-2′-phenylindole dihydrochloride (DAPI) Sigma Aldrich D9542 1: 600 in KPBS-T.
streptavidin- Cy3 Thermo Fisher Scientific 434315 1:5000, rabbit.
Anti-GAD65/67 Abcam 1:2000, mouse.
Anti-PV Sigma P3088 1:200, goat.
Anti-Chat Merk AB143 1:5000, rabbit.
Anti-NPY Immunostar 22940
K2HPO4 Sigma-Aldrich P3786
NaCl Sigma-Aldrich S3014
KH2PO4 Sigma-Aldrich NIST200B 1:1000, chicken.
Anti-GFP Abcam ab13970
Mounting solution Merck 10981 Polyvinyl alcohol mounting medium with DABCO®, antifading
OCT Agar Scientific
Glycerol Sigma-Aldrich G9012-100ML
Distilled water
Anti-freeze solution Tissue Pro Technology AFS05-1000N, 1000 mL/ea.
EQUIPMENT FOR IMMUNOHISTOCHEMISTRY
Inverted fluorescence microscope Leica DMI6000 B
Confocal microscope Leica TCS SP8 laser scanning confocal microscope.
Prism GraphPad
Microtome Leica SM2010R

DOWNLOAD MATERIALS LIST

References

  1. Barker, R. A., Parmar, M., Studer, L., Takahashi, J. Human Trials of Stem Cell-Derived Dopamine Neurons for Parkinson's Disease: Dawn of a New Era. Cell Stem Cell. 21, (5), 569-573 (2017).
  2. Southwell, D. G., et al. Interneurons from embryonic development to cell-based therapy. Science. 344, (6180), 1240622 (2014).
  3. Parmar, M., Torper, O., Drouin-Ouellet, J. Cell-based therapy for Parkinson's disease: A journey through decades toward the light side of the Force. European Journal of Neuroscience. (2018).
  4. Torper, O., et al. In Vivo Reprogramming of Striatal NG2 Glia into Functional Neurons that Integrate into Local Host Circuitry. Cell Reports. 12, (3), 474-481 (2015).
  5. Su, Z., Niu, W., Liu, M. L., Zou, Y., Zhang, C. L. In vivo conversion of astrocytes to neurons in the injured adult spinal cord. Nature Communication. 5, 3338 (2014).
  6. Liu, Y., et al. Ascl1 Converts Dorsal Midbrain Astrocytes into Functional Neurons In Vivo. Journal of Neuroscience. 35, (25), 9336-9355 (2015).
  7. Guo, Z., et al. In vivo direct reprogramming of reactive glial cells into functional neurons after brain injury and in an Alzheimer's disease model. Cell Stem Cell. 14, (2), 188-202 (2014).
  8. Grande, A., et al. Environmental impact on direct neuronal reprogramming in vivo in the adult brain. Nature Communication. 4, 2373 (2013).
  9. Niu, W., et al. In vivo reprogramming of astrocytes to neuroblasts in the adult brain. Nature Cell Biology. 15, (10), 1164-1175 (2013).
  10. Weinberg, M. S., Criswell, H. E., Powell, S. K., Bhatt, A. P., McCown, T. J. Viral Vector Reprogramming of Adult Resident Striatal Oligodendrocytes into Functional Neurons. Molecular Therapy. 25, (4), 928-934 (2017).
  11. Pereira, M., et al. Direct Reprogramming of Resident NG2 Glia into Neurons with Properties of Fast-Spiking Parvalbumin-Containing Interneurons. Stem Cell Reports. 9, (3), 742-751 (2017).
  12. Rivetti di Val Cervo, P., et al. Induction of functional dopamine neurons from human astrocytes in vitro and mouse astrocytes in a Parkinson's disease model. Nature Biotechnology. 35, (5), 444-452 (2017).
  13. Crosson, S. M., Dib, P., Smith, J. K., Zolotukhin, S. Helper-free Production of Laboratory Grade AAV and Purification by Iodixanol Density Gradient Centrifugation. Molecular Therapy Methods & Clinial Development. 10, 1-7 (2018).
  14. Torper, O., et al. Generation of induced neurons via direct conversion in vivo. Proceedings of the National Academy of Sciences of the United States of America. 110, (17), 7038-7043 (2013).
  15. Kawaguchi, Y., Kubota, Y. Correlation of physiological subgroupings of nonpyramidal cells with parvalbumin- and calbindinD28k-immunoreactive neurons in layer V of rat frontal cortex. Journal of Neurophysiology. 70, (1), 387-396 (1993).
  16. Grealish, S., et al. The A9 dopamine neuron component in grafts of ventral mesencephalon is an important determinant for recovery of motor function in a rat model of Parkinson's disease. Brain. 133, (Pt 2), 482-495 (2010).
  17. Thompson, L., Barraud, P., Andersson, E., Kirik, D., Bjorklund, A. Identification of dopaminergic neurons of nigral and ventral tegmental area subtypes in grafts of fetal ventral mesencephalon based on cell morphology, protein expression, and efferent projections. Journal of Neuroscience. 25, (27), 6467-6477 (2005).
वायरल वेक्टर्स के इंट्रासेरेब्रल इंजेक्शन द्वारा इंटरन्यूरॉन्स में निवासी ग्लिल सेल के विवो डायरेक्ट रीप्रोग्रामिंग में
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Pereira, M., Birtele, M., Rylander Ottosson, D. In Vivo Direct Reprogramming of Resident Glial Cells into Interneurons by Intracerebral Injection of Viral Vectors. J. Vis. Exp. (148), e59465, doi:10.3791/59465 (2019).More

Pereira, M., Birtele, M., Rylander Ottosson, D. In Vivo Direct Reprogramming of Resident Glial Cells into Interneurons by Intracerebral Injection of Viral Vectors. J. Vis. Exp. (148), e59465, doi:10.3791/59465 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter