Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Neuroscience

In vivo reprogramação direta de células gliais residentes em interneurônios por injeção intracerebral de vetores virais

doi: 10.3791/59465 Published: June 17, 2019

Summary

Este protocolo tem como objetivo gerar interneurônios diretamente reprogramados in vivo, usando um sistema viral baseado em AAV no cérebro e um repórter GFP orientado por synapsin FLEX, que permite a identificação celular e análise mais aprofundada in vivo.

Abstract

Convertendo glia residente no cérebro em neurônios funcionais e subtipo-específicos in vivo fornece um passo em frente para o desenvolvimento de terapias alternativas de reposição celular, criando também ferramentas para estudar o destino da célula in situ. Até à data, foi possível obter neurônios via in vivo reprogramação, mas o fenótipo preciso desses neurônios ou como eles amadurecem não foi analisado em detalhes. Neste protocolo, nós descrevemos uma conversão mais eficiente e uma identificação Cell-specific dos neurônios in vivo reprogramados, usando um sistema viral AAV-baseado do vetor. Também fornecemos um protocolo para avaliação funcional da maturação neuronal das células reprogramadas. Injetando os vetores da aleta-excisão (Flex), contendo os genes reprogramação e do repórter synapsin-conduzidos aos tipos específicos da pilha no cérebro que servem como o alvo para a reprogramação da pilha. Esta técnica permite a fácil identificação de neurônios recém-reprogramados. Os resultados mostram que os neurônios reprogramados obtidos funcionalmente amadurecem ao longo do tempo, recebem contatos sinápticos e mostram Propriedades eletrofisiológicas de diferentes tipos de interneurônios. Usando os fatores de transcrição Ascl1, Lmx1a e Nurr1, a maioria das células reprogramadas tem propriedades de fast-spiking, parvalbumin-contendo interneurônios.

Introduction

O objetivo geral deste método é converter eficientemente a glia residente cerebral in vivo em neurônios funcionais e subtipo-específicos, como interneurônios expressando parvalbumina. Isto fornece uma etapa para a frente para o desenvolvimento de uma terapia alternativa da recolocação da pilha para doenças de cérebro sem a necessidade para uma fonte de pilha exógena. Ele também cria uma ferramenta para estudar o destino da célula switches in situ.

O cérebro tem apenas uma capacidade limitada para gerar novos neurônios. Conseqüentemente, em doenças neurológicas, há uma necessidade de fontes de pilha exógenas para o reparo do cérebro. Para isso, diferentes fontes de células têm sido submetidas a intensa pesquisa ao longo dos anos, incluindo células do tecido primário, células derivadas da célula-tronco e células reprogramadas1,2,3. A reprogramação direta de células cerebrais residentes em neurônios é uma abordagem recente que poderia fornecer um método atraente para o reparo cerebral, pois usa as próprias células do paciente para gerar novos neurônios dentro do cérebro. Até à data, vários relatórios mostraram in vivo reprogramação através da entrega viral do vetor no cérebro4,5,6,78,9 em diferentes regiões do cérebro, como o córtex, a medula espinhal, o estriado e o midbrain5,10,11, bem como no cérebro intacto e lesionado5,8,11,12. Ambos os neurônios inibitórios e excitatórios foram obtidos4,8, mas o fenótipo preciso ou funcionalidade dessas células ainda não foi analisado em detalhes.

Neste protocolo, nós descrevemos uma reprogramação mais eficiente e uma identificação Cell-specific de neurônios in vivo reprogramados. Nós fornecemos um protocolo para a avaliação funcional da maturação neuronal e da caracterização do phenotype baseada na funcionalidade e em traços immunohistochemical.

Nós usamos um vetor CRE-inducible AAV e um repórter de GFP para identificar os neurônios in vivo reprogramados. Essa escolha de vetores virais tem a vantagem de infectar as células de divisão e não-divisoras do cérebro, aumentando o número de células direcionadas, como alternativa ao uso do retrovírus7,8. Um repórter de FLEX (GFP), orientado por synapsin, específico do neurônio, permitiu-nos detectar especificamente os neurônios recém-gerados. Estudos prévios utilizaram promotores específicos do subtipo para a reprogramação in vivo7,9, que também permitem a expressão de reprogramar genes e repórteres em tipos específicos de células. Entretanto, esse método exige a identificação mais adicional de neurônios reprogramados pela análise pós-morte da coexpressão do repórter e dos marcadores neuronal. O uso de um repórter Neuron-específico, tal como esse descrito nisto, permite uma identificação direta. Isto fornece uma prova direta de uma conversão bem sucedida e permite uma identificação viva da pilha que seja exigida para a electrofisiologia da remendo-braçadeira.

Protocol

Todos os procedimentos experimentais foram realizados ao abrigo da diretiva da União Europeia (2010/63/UE) e aprovados pelo Comité de ética para a utilização de animais de laboratório na Universidade de Lund e no departamento de agricultura sueco (Jordbruksverket). Os camundongos estão alojados em um ciclo de luz/escuridão de 12 h com acesso ad libitum à comida e água.

1. vetores virais

  1. Clonagem de vetores AAV
    1. Para criar vetores CRE-inducible AAV5, insira cDNA para GFP, Ascl1, Lmx1a e NR4A2 (Nurr1) em uma orientação inversa ladeada por dois pares de sequências heterotípicas, antiparalelas de flip-excisão (FLEX) de LoxP (tabela de materiais). Para a inserção do cDNA, use uma espinha dorsal como pAAV-CBA-FLEX ou uma com uma estrutura similar, contendo sequências FLEX e um promotor de frango beta actina (CBA).
    2. Insira cada cDNA (por exemplo, Ascl1) na espinha dorsal por reação em cadeia da polimerase (PCR) e enzimas de restrição. Express GFP o controle de um promotor sinapsina e Ascl1, Lmx1a, Nurr1 o controle de um promotor onipresente CBA expresso.
      Nota: Assegure-se de ter o ADN livre da endotoxina usando jogos específicos endotoxina-livres do isolamento do ADN do plasmid.
    3. Execute a análise de sequenciamento e restrição nas construções antes de usar, a fim de verificar o sucesso da etapa de clonagem.
  2. AAV5 produção vetorial viral
    Atenção: Refira directrizes locais da Biossegurança ao segurar o vírus adeno-associado (AAV). Na Suécia, o AAV utilizado neste protocolo requer biossegurança nível 2 (BSL-2).
    1. Células de semente HEK293T com meios de cultura padrão (DMEM + Glutamax + 10% FBS + penicilina (100 U/ml) estreptomicina (100 μg/mL), ver tabela de materiais) em frascos de T175 em uma densidade de 3 x 106 células por frasco. Conta para 5 frascos por lote de AAV e planejar 6 lotes de cada vez.
    2. Quando as células atingem 50-70% de confluência, prepare a seguinte mistura para transfecção (por 175 cm2 balão).
      1. Em um tubo de centrífuga de 50 mL, adicione quantidades equimolar de plasmídeo vetorial e plasmídeo auxiliar da série pDG (pDP5, pDP6), com uma quantidade total de 72 μg por 175 cm2 balão.
      2. Adicionar tampão Tris-EDTA (tampão TE, 10 mM Tris-HCl, 1 mM EDTA) a um volume final de 144 mL.
      3. Adicione água ultrapura para que o volume total se torne 1296 mL e misture.
      4. Adicionar 144 μL de 2,5 M CaCl2 e misturar. Adicione 1,92 μL de soro fisiológico tamponado HEPES (HBS) (1,5 mM na2HPO4 , 140 mm NACL, 50 mm HEPES) à solução de DNA e misture imediatamente por vortexing.
      5. Incubar à temperatura ambiente (RT) para exatamente 60 s. Transfira a solução para 28 mL de mídia de cultura de células frescas e misture.
    3. Substitua o meio nos frascos com meio de cultura celular contendo mistura de transfecção.
    4. Três dias após o transfection, colhem as pilhas derramando fora do meio do thr dos frascos em um recipiente descartável para o desperdício e adicionam 5 mL do amortecedor da colheita (o EDTA adicionou ao Saline fosfato-tamponado, vê a tabela de materiais, dpbs a uma concentração final de 5 mM) a uma concentração de 5 mM) em cada frasco para permitir o descolamento da célula.
    5. Despeje a solução celular em um tubo de centrífuga de 50 mL. Adicione mais 4 mL de DPBS a cada frasco para enxaguar as células restantes e a piscina com a primeira solução de células. Centrifugue as células colhidas a 1.000 x g durante 5 min a 4 ° c.
    6. Após a centrifugação, retire o sobrenadante e dissolva as pelotas em 15 mL de tampão de lise (50 mM Tris-HCl pH 8,5, 150 mM NaCl, 1 mM MgCl2) por vortexing.
    7. Congele-os no banho do CO2-Ice/ethanol por 15 minutos e armazene-o em um congelador de-20 ° c. Descongele o lisado da pilha colhida em um banho de água de 37 ° c antes do uso.
  3. AAV5 de purificação do vetor viral
    1. Executar AAV purificação por iodixanol Gradient Ultracentlee13 e use ultracentlee tubos de vedação com centrifugação em 350.000 x g para 1 h e 45 min em RT.
    2. Use uma seringa de 10 mL com uma agulha de 18G e insira cerca de 2 mm abaixo da borda da fase de 40/60% com o chanfro voltado para cima para extrair a fase contendo AAV. Certifique-se de parar antes de atingir a banda de proteínas após 5-6 mL foi extraído.
    3. Armazene os extratos de gradiente em garrafas de vidro autoclavadas a 4 ° c. Evite armazenar vezes mais do que durante a noite.
    4. Diluir o extrato de gradiente de iodixanol 3 vezes por pipetagem lenta em 12 mL de iodixanol eluição (IE) tampão (20 mM Tris-HCl pH 8,0, 15 mM NaCl) durante a roda.
    5. Purificar e concentrar o gradiente de iodixanol diluído através de um filtro de troca aniónica. Empurre-o lentamente com uma velocidade não mais rápido do que 1 gota/s. Empurre 3 mL do tampão do IE lentamente através do filtro para lavá-lo.
    6. Elute em uma unidade de filtro centrífugo com 1-2 mL de tampão de eluição (20 mM Tris-HCl pH 8,0; 250 mM NaCl). Adicione o DPBS ao dispositivo a um volume final de 4 mL. Centrifugador em 2.000 x g em RT até que menos de 0,5 ml seja deixado no filtro. Retire o líquido da parte inferior do tubo, reabasteça com 4 mL de DPBS e centrifugue novamente. Repita este passo mais duas vezes. Certifique-se de que o volume de vetor concentrado no filtro é de cerca de 200 μL após a última etapa de centrifugação.
    7. Remova o vetor 200 Μlconcentrado usando uma pipeta e empurre o concentrado através de um filtro de 0,22 mm para esterilizá-lo. Alíquota 200 μLinto um frasco de vidro de 9 milímetros com inserção Interlocked (tabela dos materiais).
      Nota: Os estoques dos vetores AAV5 podem ser armazenados em freezers de-80 ° c para o armazenamento longo, ou em 4 ° c se usado dentro de 2 semanas.
  4. AAV5 viral vector Titer determinação
    1. Determine o Titer AAV5 usando a reacção em cadeia quantitativa padrão do polymerase (qPCR) com os primers para a seqüência invertida do terminal REPEAT (ITR) e uma ponta de prova 5 ́fam/3 ́BHQ1 para a seqüência do ITR (tabela dos materiais). Use uma curva padrão alcançada com quantidades conhecidas de ITR contendo plasmídeo. Cada vetor de AAV deve ter uma escala de 1E+ 14 -1e+ 15 cópias do genoma por o mililitro se a seqüência do ITR é usada para a determinação do Titer.
      Nota: Uma produção bem-sucedida de vírus AAV5 dá estoques com títulos na faixa mínima de 3E+ 13 – 7e+ 13 unidades/ml.

2. injeção de fatores de reprogramação no cérebro

  1. Configuração de animais, posicionamento estereotódico e perfuração
    Nota:Este protocolo centra-se no uso de Ascl1, Lmx1a e Nurr1 (ALN) para a reprogramação de NG2 glia em interneurônios. Em nossa experiência, os interneurônios de um phenotype similar podem ser obtidos usando outras combinações do fator11.
    1. Antes da cirurgia, prepare a mistura viral contendo os vectores CBA-FLEX-Ascl1, CBA-FLEX-Lmx1a, CBA-FLEX-Nurr1 e o repórter vector SYN-FLEX-GFP. Acrescente cada uma das unidades populacionais preparadas na seção 1 para a mistura final, de modo que a solução viral final tenha 5% de cada um dos fatores de reprogramação (Ascl1, Lmx1a e Nurr1) e 10% do constructo repórter (5% A, 5% L, 5% N e 10% GFP).
      Nota: As misturas vetoriais AAV5 podem ser armazenadas a 4 ° c e mantidas para uso futuro in vivo.
    2. Anestesiar o rato utilizando isoflurano a 2% numa mistura de óxido nítrico (N2o) a uma proporção de 4:1. Monitore a respiração do animal observando os movimentos do diafragma. Durante a cirurgia, manter a anestesia usando 1 – 1,5% de isoflurano.
      Nota: O modelo do rato descrito por este meio consiste em uma tensão do rato que expresse especificamente CRE em NG2 glia. A reprogramação in vivo pode ser alcançada usando diferentes cepas de camundongo que expressam CRE em outras populações de células gliais (por exemplo, astrócitos14).
    3. Uma vez que o animal é completamente anestesiado (por exemplo, relaxamento muscular completo e nenhuma resposta a uma pitada na almofada do pé), raspar a área ao redor do local da incisão e trazer o animal para o quadro estereotaxico.
    4. Para manter a temperatura do corpo do animal durante a cirurgia, prenda uma almofada de aquecimento à base do frame Stereotaxic. Coloque o mouse sobre uma toalha de papel limpa e seca.
    5. Coloque cuidadosamente a cabeça do rato nas barras de ouvido. Se colocado corretamente, nenhum movimento lateral da cabeça deve ser observado. Defina a barra da orelha esquerda para 4 mm, antes de começar a colocar o mouse no quadro estereotódico.
    6. Fixe a barra do dente no lugar, e aperte então a barra do nariz. Certifique-se de que a cabeça não se mova em qualquer dimensão e aponte para a frente (a linha média é perpendicular ao plano das barras de ouvido). Aplique pomada oftalmológico para proteção ocular.
    7. Antes do início da cirurgia, administrar a analgesia adequada (por exemplo, 0, 5 mg/kg de buprenorfina, subcutânea).
    8. Limpe a área da incisão com uma gaze de algodão ou uma limpeza embebido com 70% de EtOH, sem se aproximar da área dos olhos.
      Nota: Para a injeção viral intracerebral, uma seringa de 5 ou 10 mL adaptada com um capilar de vidro puxado é usada. Capilares de vidro são puxados usando um extrator de micropipeta, resultando em um capilar com uma ponta muito fina, o que minimizará a invasividade do procedimento. Para adaptar o capilar na seringa, use um pedaço de tubo de borracha sobre a conexão entre a agulha da seringa e o capilar de vidro e derreta-o usando uma fonte de calor (por exemplo, um isqueiro). Uma conexão apertada entre as duas partes certificar-se-á de que não há nenhum escape fluido durante a injeção. Antes de iniciar a cirurgia, teste isto preenchendo a seringa com soro fisiológico e empurrando o líquido para fora da seringa.
    9. Faça uma incisão de aproximadamente 0,5-0,8 cm ao longo da linha média da cabeça. Corte através de camadas cutâneas e subcutâneas, com um bisturi.
    10. Amplie as abas da pele de cada lado da incisão. Limpe a incisão de todo o sangue e raspe para trás as camadas subcutaneous com um botão do algodão.
    11. Mova o braço M/L-D/V do quadro estereotódico para o lugar (acima do animal) e fixe-o.
      Nota: O quadro estereotódico permite o ajuste da seringa ao longo do eixo anterior/posterior (A/P, Y), medial/lateral (M/L, eixo X) e dorsal/ventral (D/V, eixo Z).
    12. Mova a seringa ao longo do eixo diferente do quadro estereotódico, para trazer a ponta do capilar de vidro logo acima de Bregma (o ponto de junção onde as diferentes placas do crânio se encontram).
    13. Certifique-se que a ponta capilar é perfeitamente reta em ambos os aviões de A/P e de M/L. Em caso de um Bregma ambíguo, tome a média das suturas laterais e do midline.
    14. Quando a ponta do capilar é coloc corretamente acima de Bregma, restaure os valores de M/L e de a/P a 0,0 no contador digital da coordenada.
    15. Para garantir que a cabeça do animal esteja em uma posição perfeitamente plana, use o contador de coordenadas digitais para medir o valor da coordenada D/V, quando o braço a/P estiver em + 2,0 e-2,0 (M/L = 0,0), bem como quando o braço M/L estiver em + 2,0 e-2,0 (A/P = 0,0). Ajuste a altura da barra do dente e das barras da orelha conformemente.
    16. Mova a seringa para as coordenadas desejadas para injeção de vetores virais no estriado (a/P = + 1,0; M/L =-2,0, em relação a Bregma).
    17. Levante ligeiramente a seringa e, observando o local da injecção através do microscópio, faça um furo utilizando uma broca dentária nas coordenadas de injecção. Comece a perfurar no local, trabalhando de forma circular e gentil.
      Nota: Não põr demasiada pressão descendente, porque a broca-bocado deve ser afiada bastante para atravessar o osso sem força adicional. Evite a perfuração longa e sustentada, pois isso cria calor.
    18. No final da perfuração, verifique se a dura-máter permanece intacta e exposta para injeção.
  2. Preparação da instalação da seringa
    1. Coloque um pedaço de gaze de algodão sobre a incisão aberta e lave a seringa com solução salina.
    2. Após o rubor, pegue uma bolha de ar de 1 – 2 μL, seguida de 1 μL de solução contendo os vetores virais, evitando quaisquer bolhas não intencionais. Certifique-se de que a solução viral pode facilmente ser visualizada abaixo da bolha de ar, enquanto sendo injetada.
  3. Injeção viral
    1. Retire a gaze de algodão sobre o local da incisão e abaixe a seringa usando o braço D/V do quadro estereotódico. À medida que a superfície do crânio é abordada, olhar cuidadosamente através do microscópio e medir o nível D/V de dura-máter — deve protuberância ligeiramente pressão suave.
    2. Ao tocar a dura-máter com a ponta do capilar, defina a coordenada D/V para 0,0.
    3. Abaixe a seringa, progredindo lentamente para a profundidade desejada (D/V =-2,7, em relação à dura-máter). Certifique-se de que a trajetória é clara de fragmentos ósseos, de modo que não se observa curvatura da agulha/capilar.
      Nota: As coordenadas apresentadas referem-se a uma injeção dos fatores de reprogramação no estriado de camundongos NG2-CRE. As coordenadas correspondentes a outras regiões cerebrais podem ser usadas. Sempre teste as coordenadas para injeção primeiro usando um corante (por exemplo, trypan Blue), injeção de talão colorido ou um vetor de repórter viral antes da injeção de fatores de reprogramação no cérebro de uma Nova cepa do mouse. Se injetar trypan Blue, os animais precisam ser sacrificados imediatamente após a cirurgia e o cérebro dissecado. Cérebros frescos podem ser cortados usando um micrótomo, enquanto congelados, e o local de injeção determinado pela visualização da posição do corante no cérebro. Se as coordenadas de teste usando grânulos coloridos, é possível determinar o local de injeção em perfundidos e cortar cérebros uma semana após a injeção. Alternativamente, uma injeção com um vetor viral que carreg um gene do repórter pode ser usada, e o local da injeção determinou em cérebros cortados perfundidos.
    4. Injete 1 μL da solução viral a uma taxa de 0,4 μL/min. Quando o volume inteiro é injetado, permita um período de difusão de 2 minutos antes da retirada da seringa.
    5. Após a difusão, retraia lentamente a seringa até que a ponta do capilar esteja completamente fora do cérebro.
    6. Coloque um pedaço de gaze de algodão sobre a ferida e lave a seringa com solução salina.
    7. Mova o braço M/L-D/V do quadro estereotódico para fora da área de trabalho.
  4. Fechamento de feridas e procedimentos pós-operatórios
    1. Sutura cuidadosamente a incisão usando fio de sutura.
      Nota: Todos os fios de sutura utilizados em animais injetados devem ser eliminados num copo/frasco contendo solução de detergente anti-viral. A mesma solução é usada para limpar todas as superfícies que cercam a área da cirurgia que estiveram no contato com materiais cirúrgicos. Todas as ferramentas cirúrgicas são completamente lavadas e esterilizadas no final de cada dia de cirurgia.
    2. Retire o animal do quadro estereotódico e coloque-o em uma estação pós-operatória, que inclui uma gaiola limpa, aquecida, acesso a alimentos e água, e onde o animal permanece até estar totalmente acordado. Durante este período, monitore o animal de perto até que a consciência seja recuperada.
    3. Não abrigar animais operados com animais não operados até que os primeiros tenham se recuperado completamente da cirurgia.
    4. Supervisionar os animais operados diariamente. Dependendo das suturas utilizadas, certifique-se de que são removidas, se necessário. Todos os animais receberam Bupenorphinum (Temgesic a 1ml/kg) por via subcutânea como cuidados pós-operatórios.
      Nota: Se operando usando a mesma seringa em dois dias consecutivos, lave-o com água, seguido de etanol 70% e água novamente. Deixe a seringa cheia de água durante a noite, para permitir a dissolução de eventuais resíduos.

3. gravações electrofisiológicas

  1. Preparação da fatia do tecido para a electrofisiologia
    Atenção: Uma preparação bem executada do tecido é necessária a fim conseguir boas gravações electrofisiológicas. Prepare o quarto cuidadosamente e coloque ferramentas para perfusão e dissecção no gelo.
    1. Prepare gelo-frio e oxigenado (95% O2 e 5% co2) Krebs solução para perfusão, dissecção e corte (Prepare este no mesmo dia a partir do estoque 10x diluindo a solução de ações em água ultrapura e acrescentando NaHCO3 e glicose). Os componentes na solução de Krebs no milímetro (após a diluição a 1x) são: 126 NaCl, 2,5 KCl, 1,2 NaH2po4· H2o, 1,3 MgCl2· 6h2o, e 2,4 CAcl2· 6h2o, 22 NaHCO3, 10 glicose. Ajuste o pH da solução para 7,4.
    2. Realize uma calibração (vibracheck) para o do com uma nova lâmina de barbear.
    3. Comece o bloco refrigerando do do (ou encha a câmara circunvizinha com gelo), encha a câmara de corte com solução de Krebs para o oxigenação com 95% O2 e 5% co2 pelo menos 30 minutos antes do uso.
    4. Coloque um prato de Petri no gelo e encha-o com a solução oxigenada de Krebs. Coloque a lâmina, a tesoura e a placa de montagem no gelo.
      Atenção: Traga a gaiola contendo o mouse para o quarto pelo menos 1 h antes de iniciar o procedimento para aclimatização. O stress tem um efeito negativo sobre a condição das secções de tecido cerebral.
    5. Terminalmente anestesiam o rato injetando uma overdose de pentobarbital e deixar o animal adormecer.  Quando o reflexo do piscamento está para fora e o animal não responde aos estímulos da dor, perfuse transcardially o animal com a solução Ice-Cold de Krebs para 2-3 minutos (em uma taxa de 10-20 mL/min).
    6. Rapidamente, mas com cuidado, dissecar o cérebro e colocá-lo de cabeça para baixo no petri-prato que é colocado no gelo (contendo Krebs solução).
      Nota: A fim de comparar a maturação funcional dos neurônios reprogramados, Sacrifique os animais para gravações em diferentes tempos-pontos pós-injeção viral. Avaliar as propriedades de queima de subtipos distintos de neurônios com base na literatura existente15 .
    7. Faça um corte coronal ao longo do cerebelo médio e cole este lado na placa de montagem (também gelo-frio) para o corte do.
    8. Mergulhe o cérebro colado com cuidado na câmara do amortecedor no vibratome.
      Atenção: Tenha cuidado para não tocar a lâmina de barbear para a sua própria segurança, e de modo que a lâmina permanecerá calibrada.
    9. Corte da parte mais rostral do cérebro até o nível estriatal em uma alta velocidade. Em seguida, corte o estriatum coronariamente em 275 mm em velocidade lenta (0,10 mm/s).
    10. Após cada corte, Retire cuidadosamente o lado estriado não injetado (por exemplo, com uma agulha dobrada) e transfira o lado injetado para outro frasco para injetáveis num banho de água, contendo uma rede inferior (Krebs oxigenados em RT) colocada num banho de água. Mantenha isso em RT até que todas as seções sejam cortadas.
    11. Aumente lentamente a temperatura do banho de água a 37 ° c e deixe-a por 30 min. Em seguida, desligue o aquecedor e deixe esfriar até RT.
      Observação: neste ponto, você pode pausar até que você iniciar a gravação. As seções duram por 4-6 h.
  2. Gravações do remendo-grampo da todo-pilha
    1. Transfira a primeira seção de tecido para a câmara de gravação submersa em um fluxo contínuo de solução de Krebs. Monte a seção usando pesos leves e submergir o objetivo.
    2. Identifique a região estriatal no microscópio e procure por neurônios GFP-positivos (reprogramados). Selecione um neurônio que é extenso na morfologia e não coberto por feixes de fibra ou vasos sanguíneos.
    3. Preparar pipetas de vidro de borosilicato (3 – 7 MΩ) para aplicação de patches e preenchimento com a seguinte solução intracelular (em mM): 122,5 gluconato de potássio, 12,5 KCl, 0,2 EGTA, 10 HEPES, 2 MgATP, 0,3 na3GTP e 8 NaCl, ajustados para pH 7,3 com Koh.
    4. Para o enchimento do biocytin, adicione 1 magnésio do sal do biocytin a 1 mL da solução interna e do vortex.
      Atenção: Certifique-se filtrar a solução interna com o biocytin porque este pode de outra maneira obstruir o elétrodo.
    5. Fixe a pipeta de vidro ao eléctrodo de gravação e mergulhe na solução. Verifique novamente a resistência do eletrodo. Então aproxime lentamente a pilha com a pipeta, mantendo uma pressão positiva ligeira no elétrodo para evitar obstruir a ponta.
      Atenção: Tenha cuidado para manter o controle de sua célula enquanto desce o eletrodo e não para branqueá-la na célula (ou seja, desligue a lâmpada de fluorescência quando você não precisa dele).
    6. Enxágüe o tecido circundante cuidadosamente usando a pressão positiva do eletrodo e aproxime-se da célula com o eletrodo. Localize o eletrodo bem na parte superior da célula e desça até que o eletrodo toque a membrana. Faça um selo giga-Ω entre o eletrodo e a membrana celular, e com pulsos de pressão negativa, rompa a membrana para criar um adesivo de célula inteira.
      Atenção: Os neurônios reprogramados são sensíveis. Tenha cuidado ao aplicar patches e não coloque demasiada pressão negativa ao atingir um selo giga-Ω ou abrindo a membrana celular. Além disso, remendando sobre os animais que são mais velhos requer prática e paciência como seu tecido conjuntivo é mais espessa e é mais difícil de visualizar os neurônios.
    7. Verifique os potenciais de membrana de repouso imediatamente após a invasão no modo de braçadeira atual e anote para análise.
    8. Na braçadeira atual, manter a célula entre-60 mV para-80 mV e injetar 500 MS correntes de-20 pA para + 90 pA, com incrementos de 10 pA para induzir potenciais de ação.
    9. Transferência na tensão-braçadeira e mede o sódio interno e atrasa retificando correntes do potássio em etapas despolarizantes de 10 milivolt.
      Nota: As gravações da tensão-braçadeira são avaliadas melhor usando uma solução interna diferente, compor dos produtos químicos que grampeam mais eficientemente a membrana. No entanto, para os neurônios reprogramados, o número de células que você pode gravar é poucos e o número de seções de tecido com esses neurônios é limitado. Portanto, é uma vantagem para gravar tanto na corrente-braçadeira e tensão-braçadeira da mesma célula.
    10. Na modalidade da tensão-braçadeira, recorde a atividade pós-sináptica espontânea em-70 milivolt. Distinguir eventos pós-sinápticos inibitórios em um potencial de membrana de 0 mV de eventos excitatórios em-70 mV.
    11. Depois de atingir uma linha de base estável, adicione Picrotoxina , o antagonista do receptor GABA a, para a solução de Krebs que flui para a câmara de gravação, para extrair eventos excitatórios (adicionar uma solução de estoque de Picrotoxina a uma concentração final de 50 mm em separado seringa tampão que está ligada à perfusão da câmara. Conecte o fluxo de saída do tampão da câmara a um saco de vácuo para a eliminação segura).
    12. Após 20 min, adicione CNQX (20 mM), um antagonista de AMPA, à solução de Krebs que flui para a câmara de gravação, para bloquear os eventos inibitórios (usando o mesmo procedimento que para Picrotoxina). Deixe entrar por mais 20 min e depois lave com a solução Krebs. Retire a secção do tecido da câmara.
    13. Após o término das gravações, faça uma análise offline das correntes pós-sinápticas excitatórias espontâneas (EPSC) e das correntes pós-sinápticas inibidora (IPSC), utilizando uma detecção de evento-limiar (> 5 pA) no programa de análise.
    14. Durante toda a gravação, a célula será lentamente preenchida com a solução interna contendo biocitina. Mantenha o remendo por pelo menos 20 minutos antes de remover lentamente o elétrodo a fim conseguir o enchimento completo da pilha.
      Atenção: Tenha cuidado para não ter qualquer pressão positiva no eletrodo que poderia destruir a análise morfológica consecutiva das células depois.
    15. Para o biocytin-visualização, põr a seção do tecido no paraformaldeído de 4% (PFA) durante a noite em 4 ° c. Enxague a seção em tampão fosfato de potássio 0, 2 M (KPBS) com 0,1% Triton. Então, mancha para streptavidin-Cy3 (1:600 em KPBS-T,2 h), para a identificação da pilha biocytin-enchida e a visualização morfológica do Neuron reprogramado.
      Nota: O enchimento do biocytin pode ser usado para a análise morfológica e as ilustrações dos neurônios remendado.

4. Immunohistochemistry, Stereology, e quantificação

Nota: Dedique um grupo específico de camundongos para immunohistochemistry, porque as seções do tecido usadas para a electrofisiologia não são ideais para immunohistochemistry.

  1. Anestesie os camundongos com uma injeção i.p. de uma overdose de pentobarbital e montar o animal para perfusão.
  2. Perfuse transcardially os ratos, primeiramente com uma solução salina para remover o sangue, e então com o gelo-frio 4% PFA.
  3. Dissecar os cérebros e pós-correção para pelo menos 12 h em 4% PFA.
  4. Coloque o cérebro em 25% de solução de sacarose (para crio-proteção) por aproximadamente 12 h.
    Nota: Os cérebros estão prontos para serem cortados quando afundam na solução de sacarose a 25%, indicando que a sacarose penetrou todo o cérebro do rato.
  5. Faça um corte coronal através do cerebelo, use a parte plana, mais caudal do cérebro para colocar o cérebro em um micrótomo e corrigi-lo no lugar usando o composto de temperatura de corte ideal (OCT).
  6. Corte o cérebro em fatias coronais com uma espessura de 35 mm e divida o cérebro em séries consecutivas colocadas em frascos ou poços contendo 0, 2 M KPBS.
  7. Processe as seções para immunohistochemistry usando anticorpos de encontro aos marcadores do GFP e do interneurônios tais como GAD65/67, picovolt, bate-papo (acetiltransferase do choline) e NPY (neuropeptide Y), de acordo com protocolos padrão16, 17.
    Nota: As fatias cerebrais podem ser mantidas a 4 ° c ou-20 ° c em solução anticongelante por longos períodos.
  8. Após a coloração estar completa, monte as secções numa lâmina de vidro e cubra com uma lamínula de vidro, utilizando uma solução de montagem para a fixar no lugar. Deixe os slides de cobertura para secar durante a noite.
    Nota: Para os nossos estudos, cérebros inteiros são cortados em 1:8 série (ou seja, cada frasco contendo seções vai segurar um oitavo do cérebro do mouse11).
  9. Analise as secções utilizando uma fluorescência invertida e/ou microscópio confocal.
    Atenção: A microscopia fluorescente é útil para uma visão geral dos resultados e captura de imagens para calcular a eficiência de reprogramação. Para uma análise mais detalhada da identidade fenotípica pela observação de pilhas dobro-positivas, a imagem latente confocal deve ser usada.
  10. Para a quantificação de diferentes marcadores expressos em GFP+ neurônios no estriado, contar o número de células duplas positivas em relação ao número total de células GFP+ (ou seja, os neurônios reprogramados), em pelo menos dois campos de cada secção estriatal.
  11. Para determinar o número total aproximado extrapolado de neurônios reprogramados por cérebro, conte o GFP+ neurônios presentes no estriado de uma das séries cerebrais cortadas anteriormente e, em seguida, multiplicar pelo número total de séries.
    Nota: Diferentes métodos de quantificação podem ser usados para expressar a eficiência de reprogramação, número de neurônios reprogramados por animal e percentual de neurônios que expressam certos marcadores fenotípicos. Para obter mais informações, consulte a publicação anterior11.
  12. Analise as diferenças entre as condições usando o gráfico Pad Prism ou similar.
    Nota: Para o cálculo da eficiência, injetamos camundongos NG2-CRE com os vetores de conversão ALN dependentes do CRE e o repórter do GFP. Para estimar a eficiência de conversão, também injetamos animais com um GFP CRE-dependente o promotor CBA onipresente, tornando todas as células-alvo GFP+. Usando essa comparação, estimamos que 66,81% ± 38,38% das células-alvo convertidas em neurônios. Para a validação da expressão de cada um dos genes, a imunofluorescência dupla complementar-coloração pode ser realizada para GFP/Ascl1, GFP/Lmx1a e GFP/Nurr1. Adicionalmente, o sequenciamento do genoma, como sequenciamento de RNA de célula única, pode revelar a presença de cada um dos genes nas células reprogramadas.

Representative Results

A injeção de vetores de AAV é usada para reprogramar com sucesso pilhas NG2 do glia do residente nos neurônios no estriado do rato de NG2-CRE (Figura 1a). Para direcionar especificamente NG2 glia, os vetores FLEX com genes de reprogramação/repórter, são inseridos em uma direção antisense e ladeados por dois pares de sites antiparalelos, heterotípicos loxP (Figura 1b). Cada um dos três genes de reprogramação (Ascl1, Lmx1a e Nurr1) é colocado o controle do promotor CBA onipresente em vetores individuais. A fim certificar-se que a expressão de GFP é restrita aos neurônios reprogramados que originam de uma pilha CRE-expressando, GFP está coloc o controle do promotor do sinapsina neurônio-específico, (também em um vetor do Flex).

O uso da combinação de reprogramação e de construções de repórter permite a geração de neurônios GFP-positivos no estriado do rato (Figura 1C, C '). O uso do constructo repórter sem a presença de genes de reprogramação não produz neurônios GFP-positivos (Figura 1D).

Os neurônios reprogramados que são biocitin-preenchidos são visíveis após a imuno-coloração post-mortem (Figura 2a). Se a conversão for bem-sucedida, deve haver extensa morfologia neuronal. As gravações eletrofisiológicas de neurônios reprogramados demonstram presença de conexões funcionais pós-sinápticas com medidas espontâneas de atividade (Figura 2b, C). Isso pode ser bloqueado com um bloqueador de gabaérgica ou glutamatérgico ionotrópico (Picrotoxina ou CNQX), sugerindo entrada sináptica excitatória e inibidora para os neurônios reprogramados. A ocorrência de atividade espontânea aumenta com o tempo pós-injeção viral (Figura 2D), indicando uma maturação gradual.

Os potenciais de ação atuais-induzidos estão atuais em neurônios funcionais. Os potenciais de ação aumentam em número ao longo do tempo após a conversão (Figura 2e). Isto indica ainda a maturação na função neuronal. Em um Neuron imaturo, a corrente induz qualquer um ou muito poucos potenciais de ação (Figura 2F).

Os padrões de queima de um neurônio é o tipo de célula específico, pois depende de fatores como a morfologia das células e a expressão do canal15. Os padrões gravados nos neurônios reprogramados in vivo podem ser distinguidos em grupos e comparados com os subtipos neuronais endógenos, por exemplo, interneurônios de cravamento rápido (célula tipo B, Figura 3B) ou outros tipos de células (Figura 3a, C, D ). As diferenças eletrofisiológicas observadas podem ser confirmadas pela presença de marcadores de subtipo específicos e coexpressão com GFP (Figura 3E-H). Ao todo, esses dados indicam que os neurônios reprogramados presentes no estriado apresentam propriedades de diferentes tipos de interneurônios, como Parvalbumina, ChAt e NPY, expressando interneurônios, bem como a identidade do neurônio médio estriatal (DARPP32 +) ( Figura 3E -H).

Figure 1
Figura 1: reprogramação in vivo de NG2 glia residente em neurônios. (A) representação esquemática da reprogramação in vivo mediada pelo vírus AAV de NG2 glia estriatal. (B) representação esquemática dos CONSTRUCTOS Flex AAV5 utilizados na reprogramação in vivo, em que a expressão gênica é regulada pela expressão CRE nas células visadas. (C e c ') os neurônios reprogramados in vivo, resultantes da injeção de SYN-GFP + ALN no striatum. (D) ausência de neurônios reprogramados quando nenhum fator de reprogramação é adicionado ao coquetel viral, e somente a construção de repórter é injetada in vivo. Barras de escala = 100 mm (C), 25 mm (C '), 25 mm (D). Por favor clique aqui para ver uma versão maior desta figura.

Figure 2
Figura 2: os neurônios reprogramados in vivo são funcionais e mostram a maturação ao longo do tempo. (A) Neuron reprogramado biocytin-enchido, mostra a morfologia neuronal madura, incluindo espinhas dendríticas. Traços mostra (B) atividade inibitória (gabaérgica) que é bloqueada com Picrotoxina, um antagonista do receptor GABAa e (C) atividade excitatórios que é bloqueada com CNQX, um antagonista do receptor de AMPA. (D) o número de neurônios com atividade pós-sináptica aumenta ao longo do tempo. (E) os neurônios remendado mostram o acendimento repetitivo já em 5 semanas após a injeção (w.p.i.) e continuam a mostrar que em 8 e 12 w.p.i. (F) o potencial de ação atual-induzido e a atividade pós-sináptica de um neurônio imaturo, mostrando poucos sináptica eventos e poucos potenciais de ação em comparação com B e D. barra de escala = 25 mm por favor clique aqui para ver uma versão maior desta figura.

Figure 3
Figura 3: os neurônios reprogramados in vivo apresentam propriedades imuno-histoquímicas e eletrofisiológicas de interneurônios estriatal. (A-D) Os padrões de disparo dos neurônios reprogramados in vivo podem ser de tipos distintos: (a) o tipo a é semelhante ao neurônio spiny médio ENDÓGENO (DARPP32 +); (B) semelhantes aos interneurônios de cravagem rápida (PV +); (C) semelhante a neurônios de cravagem de baixo limiar com caída proeminente (NPY +); (D) neurônios disparando com grande pós-hiperpolarização (chat +). (E-H) Imagens confocais mostrando colocalização de GFP e os marcadores de interneurônio PV (e), ChAT (F), NPY (G) e marcador de neurônio de projeção DARPP32 (H). Todas as barras de escala = 50 mm. por favor clique aqui para ver uma versão maior desta figura.

Discussion

A reprogramação direta in vivo pode ser alcançada usando vetores AAV FLEX em estirpes de rato expressando CRE. É importante notar que as diferenças entre as cepas de mouse em relação à eficácia de reprogramação têm sido observadas. Para a reprogramação in vivo no striatum, a linha do mouse NG2-CRE provou ser a mais eficiente quando comparada com outras cepas. Antes de começar a usar uma nova estirpe animal, é importante verificar as diretrizes do provedor de mouse sobre a expressão CRE ao longo do tempo, como a idade dos animais muitas vezes impacta a especificidade desta expressão protéica. Em nossos estudos, os animais com mais de 12 semanas de idade não foram utilizados para a reprogramação in vivo, pois havia um risco para a expressão de CRE em células que não NG2 glia. A presença constante e a monitoração de animais do controle injetados somente com a construção de Synapsin-FLEX-GFP são aconselhadas. Isto permite a monitorização dos animais para células GFP-positivas que não devem estar presentes se não forem utilizados genes de reprogramação (ALN).

Para identificar os neurônios recém-reprogramados, um método de identificação neurônio-específico como o descrito neste protocolo é de extrema importância. Isto permite uma identificação e uma distinção apropriadas dos neurônios reprogramados das pilhas circunvizinhas endógenas que é da relevância particular quando reprogramação em uma região homotópicas.

Também é importante direcionar a estrutura correta para a injeção viral. Conseqüentemente, a cirurgia Stereotaxic para a injeção viral é importante e precisa de ser aproximado com exatidão, especial ao alvejar estruturas menores do cérebro.

Temos mostrado anteriormente11 que não é confiável para prever o resultado da reprogramação in vivo com base em experimentos de reprogramação in vitro usando os mesmos fatores de reprogramação. Por conseguinte, todos os factores de interesse necessitam de ser testados in vivo. Em nossas mãos, muitas combinações de fatores diferentes dão o mesmo subtipo de neurônios (ou seja, interneurônios11 in vivo), apesar do fato de que esses genes têm sido implicados no desenvolvimento de outros neurônios.

A braçadeira de remendo da inteiro-pilha para neurônios reprogramados é uma técnica delicada e o processamento do tecido é importante para um bom resultado. A perfusão com solução de Krebs gelada melhora a qualidade do tecido. Além disso, os neurônios corrigidos precisam ser tratados com cuidado. Mesmo se a maturação e a identidade fenotípica de neurônios reprogramados podem ser um tanto avaliados usando a braçadeira de remendo da inteiro-pilha, estas pilhas não são inteiramente comparáveis a suas contrapartes endógenas. Outros tipos de análise, como sequenciamento do genoma (por exemplo, sequenciamento de RNA) devem ser usados para confirmar ainda mais a identidade da célula reprogramada.

A técnica descrita aqui é poderia ser considerada para o desenvolvimento de terapias futuras onde a recolocação neuronal é precisada no cérebro. Embora a reprogramação in vivo ainda esteja em seus estágios iniciais e a tradução em humanos ainda não esteja prevista, essa técnica pode fornecer um método para avaliar a função gênica exógena no cérebro e estudar a maturação celular in vivo.

Disclosures

Os autores não têm nada a revelar.

Acknowledgments

A Marcella Birtele foi financiada pelo programa Horizonte 2020 da União Europeia (2020-MSCA-ITN-2015) no âmbito das redes de formação inovadoras Marie Skłodowska-Curie e da Convenção de subvenção n. º 676408. Daniella Rylander Ottosson foi financiada pelo Conselho de pesquisa Sueco (2017-01234).

Materials

Name Company Catalog Number Comments
REAGENTS FOR AAV5 CLONING AND VIRAL VECTOR PREPARATION
pAAV-CA-FLEX AddGene 38042
Ascl1 AddGene 67291 NM_008553.4
Lmx1a AddGene 33013 NM_0033652.5
Nurr1 AddGene 35000 NM_013613.2
GFP-syn AddGene 30456
LoxP (FLEX) sequence 1 GATCTccataacttcgtataaagtatcctatac
gaagttatatcaaaataggaagaccaatgcttc
accatcgacccgaattgccaagcatcaccatcg
acccataacttcgtataatgtatgctatacgaa
gttatactagtcccgggaaggcgaagacgcgga
agaggctctaga
LoxP (FLEX) sequences 2 tactagtataacttcgtataggatactttatac
gaagttatcattgggattcttcctattttgatc
caagcatcaccatcgaccctctagtccacatct
caccatcgacccataacttcgtatagcatacat
tatacgaagttatgtccctcgaagaggttcgaa
ttcgtttaaacGGTACCCTCGAC
pDP5 Plasmid Factory PF435
pDP6 Plasmid Factory PF436
Phosphate-Buffered Saline (PBS) Thermo Fisher Scientific 10010023
FBS (Fetal bovine serum) Thermo Fisher Scientific 10500064
Penicillin streptomycin Thermo Fisher Scientific 15140122
DMEM (Dulbecco's Modified Eagle Medium)+ Glutamax Thermo Fisher Scientific 61965026
DPBS (Dulbecco's Phosphate Buffer Saline) Thermo Fisher Scientific 14190094
HEK293 cells Thermo Fisher Scientific 85120602-1VL
Flasks BD Falcon 10078780 175 cm2
Tris H-CL Sigma Aldrich 10812846001 For TE buffer use 10 mM, pH 8.0; for lysis buffer use 50mM, pH 8.5; for IE buffer use 20 mM, pH 8.0; for elution buffer use 20 mM, pH 8.0
EDTA EDTA: Invitrogen EDTA: AM9260G For TE buffer use 1 mM EDTA
Ultrapure water see Ultrapure water system
CaCl2 SigmaAldrich C5080 2.5 M
Dulbecco´s phosphate-buffered saline (DPBS) Thermo Fisher Scientific 14190136
NaCl Sigma-Aldrich S3014 FOR HBS use 140 mM; for Lysis Buffer use 150 mM; for IE buffer use 15 mM; for elution buffer use 250 mM
MgCl2 Sigma-Aldrich M8266-100G For lysis Buffer: 1 mM
Ultracentrifuge sealing tubes Beckman Coulter Quick-Seal® Polypropylene Tube
OptiPrep™ Density Gradient Medium Sigma Aldrich D1556-250ML
10-mL syringe-18G needle BD 305064
Laboratory glass bottles VWR ?
Anion exchange filter PALL laboratory MSTG25Q6 Acrodisc unit with Mustang Q membrane
Centrifugal filter unit Merck Z740210-24EA Amicon Ultra-4 device
Endotoxin-Free Plasmid DNA Isolation Kits Thermo Fisher Scientific A33073
Na2PO4 Sigma-Aldrich S7907
HEPES Sigma-Aldrich H7523 15 mL
Falcon tube Thermo Fisher Scientific Corning 352196
Falcon tube Thermo Fisher Scientific Corning 352070
Glass Vials Novatech 30209-1232 CGGCCTCAGFGAGCGA
Forward Primer for Inverted Terminal Repeat (ITR) sequence GGAACCCCTAGTGATGGAGTT
Reverse Primer for Inverted Terminal Repeat (ITR) sequence CACTCCCTCTCTGCGCGCTCG
5´FAM / 3´BHQ1 probe Jena Bioscience
0.22 mm filter Merck SLGV004SL Millex-GV filter
EQUIPMENT AAV5 VIRAL VECTOR PREPARATION
Freezer -20 °C
Freezer -80 °C
Fridge +4 °C
AAV viral room
Ultrapure Water system Merck Milli-Q® IQ 7000
Vortex mixer VWR 444-0004
Ultracentrifuge Beckman Coulter Beckman Optima LE-80K Ultracentrifuge
Autoclave Tuttnauer 2540 EL
Polymerase Chain Reaction (PCR) BioRad C1000 Touch Thermal Cycler
Quantitative PCR (qPCR) Roche LightCycler® 480 System
Centrifuge Thermo Fisher Scientific Sorvall ST16
Water Bath Thermo Fisher Scientific TSGP02
ANIMAL MODEL
NG2-Cre mice Jackson NG2-CrexB6129, Stock #008533
REAGENTS FOR INJECTION OF REPROGRAMMING FACTORS INTO THE BRAIN
Water
Saline Apoteket AB 70%
Ethanol Solveco
Isolfurane Apoteket AB Dilute to 1% solution with warm water.
Virkon Viroderm 7511 
Pentobarbital Apoteket AB P0500000 i.p. for terminal procedure at the dose of 60 mg/ml.
Sucrose Merck S0389-500G
Trypan Blu Thermo Fisher Scientific 15250061
Retrobeads Lumafluor R170
Buprenorphine Apoteket AB
EQUIPMENT FOR INJECTION OF REPROGRAMMING FACTORS INTO THE BRAIN From RSG Solingen.
Scissors VWR 233-1552 From Biochem.
Tweezers VWR 232-0007
Forcep VWR 232-0120
Scalpel holder VWR RSGA106.621 Number 20.
Scalpel VWR RSGA106.200
Stereotaxic frame Stoelting Europe 51500D
Mouse ear bars Stoelting Europe 51648 5 ul
Syringe with Removable needle Hamilton Company 65 0,75 inner diameter and 1.5 outer diameter.
Glass capilaries Stoelting 50811
Glass capillary puller Sutter company P-1000
Dental drill Agnthos AB 1464
Shaver Agnthos AB GT420
Isoflurane Chamber and pump Agnthos AB 8323101 2 mL
Syringes Merck Z118400-30EA 25G
Needles Merck Z192414 Aldrich
Mouse and neonatal rat adaptor for stereotaxic fram Stoelting 51625
Heating pad Braintree scientific, inc 53800M From Covidien 2187.
Cotton gauze Fisher Scientific 22-037-902
Rubber tube Elfa Distrelec HFT-A-9.5/4.8 PO-X BK 150
Cotton swabs Fisher Scientific 18-366-473
REAGENTS FOR WHOLE-CELL PATCH CLAMP RECORDINGS
NaCl Sigma-Aldrich S3014
KCl Sigma-Aldrich P9333
NaH2PO4-H2O Sigma-Aldrich S9638
MgCl2-6 H2O Sigma-Aldrich M2670
CaCl2-6 H2O Sigma-Aldrich C8106
MgSO4-7 H2O Sigma-Aldrich 230391
NaHCO3 Sigma-Aldrich S5761
Glucose Sigma-Aldrich G7021 see Ultrapure Water system
Ultrapure Water Prepare 1 or 2M.
KOH Sigma-Aldrich P5958-500G
K-D-gluconate Sigma-Aldrich G4500 Sigma
KCl Sigma-Aldrich P9541
KOH-EGTA (Etilene glycol-bis-N-tetracetic acid) Sigma-Aldrich E3889 Sigma
KOH- Hepes acid (N-2-hydroxyethylpiperazine-N’-2-ethanesulfonic acid) Sigma-Aldrich H7523
NaCl Sigma-Aldrich S3014
Mg2ATP Sigma-Aldrich A9187
Na3GTP Sigma-Aldrich G8877
Biocytin Sigma-Aldrich B4261
Picrotoxin Merck P1675 Sigma
CNQX Merck C239 Sigma
Ice
EQUIPMENT FOR WHOLE-CELL PATCH CLAMP RECORDINGS
Borosilicate glass pipette Sutter Company B150-86-10
Glass capillary puller Sutter company P-1000
Vibratome Leica Leica VT1000 S
WaterBath Thermo Fisher Scientific TSGP02
Clampfit software Molecular Devices
Multiclamp software Molecular Devices
REAGENTS FOR IMMUNOHISTOCHEMISTRY Use at a concentration of 4%. CAUTION: PFA is a potent fixative. Avoid ingestion and contact with skin.
Paraformaldehyde (PFA) Merck Millipore 1040051000 Use at a concentration of 0.1%.
Triton X-100 Fisher Scientific 10254640 Donkey.Use at a concentration of 1 : 400.
Serum Merck Millipore S30-100ML Reconstitute the powder in Milli-Q water to 1 mg/mL. Aliquot and store at -20°C, light sensitive. Use at a concentration of 1 : 500.
4′,6-Diamidino-2′-phenylindole dihydrochloride (DAPI) Sigma Aldrich D9542 1: 600 in KPBS-T.
streptavidin- Cy3 Thermo Fisher Scientific 434315 1:5000, rabbit.
Anti-GAD65/67 Abcam 1:2000, mouse.
Anti-PV Sigma P3088 1:200, goat.
Anti-Chat Merk AB143 1:5000, rabbit.
Anti-NPY Immunostar 22940
K2HPO4 Sigma-Aldrich P3786
NaCl Sigma-Aldrich S3014
KH2PO4 Sigma-Aldrich NIST200B 1:1000, chicken.
Anti-GFP Abcam ab13970
Mounting solution Merck 10981 Polyvinyl alcohol mounting medium with DABCO®, antifading
OCT Agar Scientific
Glycerol Sigma-Aldrich G9012-100ML
Distilled water
Anti-freeze solution Tissue Pro Technology AFS05-1000N, 1000 mL/ea.
EQUIPMENT FOR IMMUNOHISTOCHEMISTRY
Inverted fluorescence microscope Leica DMI6000 B
Confocal microscope Leica TCS SP8 laser scanning confocal microscope.
Prism GraphPad
Microtome Leica SM2010R

DOWNLOAD MATERIALS LIST

References

  1. Barker, R. A., Parmar, M., Studer, L., Takahashi, J. Human Trials of Stem Cell-Derived Dopamine Neurons for Parkinson's Disease: Dawn of a New Era. Cell Stem Cell. 21, (5), 569-573 (2017).
  2. Southwell, D. G., et al. Interneurons from embryonic development to cell-based therapy. Science. 344, (6180), 1240622 (2014).
  3. Parmar, M., Torper, O., Drouin-Ouellet, J. Cell-based therapy for Parkinson's disease: A journey through decades toward the light side of the Force. European Journal of Neuroscience. (2018).
  4. Torper, O., et al. In Vivo Reprogramming of Striatal NG2 Glia into Functional Neurons that Integrate into Local Host Circuitry. Cell Reports. 12, (3), 474-481 (2015).
  5. Su, Z., Niu, W., Liu, M. L., Zou, Y., Zhang, C. L. In vivo conversion of astrocytes to neurons in the injured adult spinal cord. Nature Communication. 5, 3338 (2014).
  6. Liu, Y., et al. Ascl1 Converts Dorsal Midbrain Astrocytes into Functional Neurons In Vivo. Journal of Neuroscience. 35, (25), 9336-9355 (2015).
  7. Guo, Z., et al. In vivo direct reprogramming of reactive glial cells into functional neurons after brain injury and in an Alzheimer's disease model. Cell Stem Cell. 14, (2), 188-202 (2014).
  8. Grande, A., et al. Environmental impact on direct neuronal reprogramming in vivo in the adult brain. Nature Communication. 4, 2373 (2013).
  9. Niu, W., et al. In vivo reprogramming of astrocytes to neuroblasts in the adult brain. Nature Cell Biology. 15, (10), 1164-1175 (2013).
  10. Weinberg, M. S., Criswell, H. E., Powell, S. K., Bhatt, A. P., McCown, T. J. Viral Vector Reprogramming of Adult Resident Striatal Oligodendrocytes into Functional Neurons. Molecular Therapy. 25, (4), 928-934 (2017).
  11. Pereira, M., et al. Direct Reprogramming of Resident NG2 Glia into Neurons with Properties of Fast-Spiking Parvalbumin-Containing Interneurons. Stem Cell Reports. 9, (3), 742-751 (2017).
  12. Rivetti di Val Cervo, P., et al. Induction of functional dopamine neurons from human astrocytes in vitro and mouse astrocytes in a Parkinson's disease model. Nature Biotechnology. 35, (5), 444-452 (2017).
  13. Crosson, S. M., Dib, P., Smith, J. K., Zolotukhin, S. Helper-free Production of Laboratory Grade AAV and Purification by Iodixanol Density Gradient Centrifugation. Molecular Therapy Methods & Clinial Development. 10, 1-7 (2018).
  14. Torper, O., et al. Generation of induced neurons via direct conversion in vivo. Proceedings of the National Academy of Sciences of the United States of America. 110, (17), 7038-7043 (2013).
  15. Kawaguchi, Y., Kubota, Y. Correlation of physiological subgroupings of nonpyramidal cells with parvalbumin- and calbindinD28k-immunoreactive neurons in layer V of rat frontal cortex. Journal of Neurophysiology. 70, (1), 387-396 (1993).
  16. Grealish, S., et al. The A9 dopamine neuron component in grafts of ventral mesencephalon is an important determinant for recovery of motor function in a rat model of Parkinson's disease. Brain. 133, (Pt 2), 482-495 (2010).
  17. Thompson, L., Barraud, P., Andersson, E., Kirik, D., Bjorklund, A. Identification of dopaminergic neurons of nigral and ventral tegmental area subtypes in grafts of fetal ventral mesencephalon based on cell morphology, protein expression, and efferent projections. Journal of Neuroscience. 25, (27), 6467-6477 (2005).
In vivo reprogramação direta de células gliais residentes em interneurônios por injeção intracerebral de vetores virais
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Pereira, M., Birtele, M., Rylander Ottosson, D. In Vivo Direct Reprogramming of Resident Glial Cells into Interneurons by Intracerebral Injection of Viral Vectors. J. Vis. Exp. (148), e59465, doi:10.3791/59465 (2019).More

Pereira, M., Birtele, M., Rylander Ottosson, D. In Vivo Direct Reprogramming of Resident Glial Cells into Interneurons by Intracerebral Injection of Viral Vectors. J. Vis. Exp. (148), e59465, doi:10.3791/59465 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter