Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Neuroscience

In vivo direkt omprogrammering av bosatta gliaceller i interneuroner genom intracerebral injektion av virala vektorer

doi: 10.3791/59465 Published: June 17, 2019

Summary

Detta protokoll syftar till att generera direkt omprogrammeras interneuroner in vivo, med hjälp av en AAV-baserade virus system i hjärnan och en FLEX synapsin-driven GFP reporter, som möjliggör cell identifiering och ytterligare analys in vivo.

Abstract

Omvandla Resident glia i hjärnan till funktionella och subtypspecifika nervceller in vivo ger ett steg framåt mot utvecklingen av alternativa cell Replacement terapier samtidigt skapa verktyg för att studera cell öde på plats. Hittills har det varit möjligt att få nervceller via in vivo omprogrammering, men den exakta fenotyp av dessa nervceller eller hur de mogna har inte analyserats i detalj. I detta protokoll beskriver vi en effektivare omvandling och cellspecifik identifiering av in vivo omprogrammerade neuroner, med hjälp av ett AAV-baserat virusvektor system. Vi tillhandahåller också ett protokoll för funktionell bedömning av de omprogrammerade cellernas neuronala mognad. Genom att injicera flip-excision (FLEX) vektorer, som innehåller omprogrammering och synapsin-driven reporter gener till specifika celltyper i hjärnan som fungerar som mål för cell omprogrammering. Denna teknik möjliggör enkel identifiering av nyligen omprogrammerade neuroner. Resultaten visar att de erhållna omprogrammeras nervceller funktionellt mogna över tid, ta emot synaptiska kontakter och Visa elektrofysiologiska egenskaper hos olika typer av interneuroner. Med hjälp av transkriptionsfaktorerna Ascl1, Lmx1a och Nurr1 har majoriteten av de omprogrammerade cellerna egenskaper snabb-spiking, parvalbumin-innehållande interneuroner.

Introduction

Det övergripande målet med denna metod är att effektivt omvandla hjärnans hemvist glia in vivo till funktionella och subtypspecifika nervceller som parvalbumin-uttrycker interneuroner. Detta ger ett steg framåt mot utvecklingen av en alternativ cell substitutionsterapi för hjärnsjukdomar utan behov av en exogen cell källa. Det skapar också ett verktyg för att studera cell omvandling växlar in situ.

Hjärnan har endast en begränsad kapacitet för att generera nya nervceller. Därför, i neurologiska sjukdomar, det finns ett behov av exogena cell källor för hjärn reparation. För detta har olika källor av celler utsatts för intensiv forskning genom åren, inklusive celler från primär vävnad, stamceller-härledda celler och omprogrammerade celler1,2,3. Direkt omprogrammering av inhemska hjärnceller till nervceller är en ny metod som kan ge en attraktiv metod för hjärn reparation som den använder patientens egna celler för att generera nya nervceller inne i hjärnan. Hittills har flera rapporter visat in vivo omprogrammering genom viral vektor leverans i hjärnan4,5,6,78,9 i olika hjärnregioner såsom hjärnbarken, ryggmärgen, striatum och mellanhjärnan5,10,11, samt i intakt och bort hjärna5,8,11,12. Både hämmande och excitatoriska nervceller har erhållits4,8, men den exakta fenotyp eller funktionalitet av dessa celler har ännu inte analyserats i detalj.

I detta protokoll beskriver vi en effektivare omprogrammering och cellspecifik identifiering av in vivo omprogrammerade neuroner. Vi tillhandahåller ett protokoll för funktionell bedömning av neuronala mognad och fenotyp karakterisering baserat på funktionalitet och immunohistokemiska drag.

Vi använde en CRE-inducible AAV vektor och en GFP reporter för att identifiera in vivo omprogrammerade neuroner. Detta val av virala vektorer har fördelen att infektera både dividera och icke-skiljande celler i hjärnan, öka antalet riktade celler, som ett alternativ till användning av retrovirus7,8. En neuron-specifika synapsin-driven FLEX reporter (GFP), gjorde det möjligt för oss att specifikt upptäcka den nyligen genererade nervceller. Tidigare studier har använt subtypspecifika initiativtagare för in vivo omprogrammering7,9, som också tillåter uttrycket av omprogrammering gener och reportrar i specifika celltyper. Emellertid, denna metod kräver ytterligare identifiering av omprogrammerade neuroner genom efter döden analys av co-uttryck av reporter och neuronala markörer. Användningen av en neuron-specifik reporter, såsom den som beskrivs häri, möjliggör en direkt identifiering. Detta ger ett direkt bevis på en lyckad omvandling och tillåter en levande cell identifiering som krävs för patch-Clamp elektrofysiologi.

Protocol

Alla experimentella förfaranden genomfördes enligt Europeiska unionens direktiv (2010/63/EU) och godkändes av etikkommittén för användning av försöksdjur vid Lunds universitet och jordbruksdepartementet (Jordbruksverket). Möss är inhysta i en 12 h ljus/mörker cykel med AD libitum tillgång till mat och vatten.

1. virala vektorer

  1. Kloning av AAV-vektorer
    1. För att skapa CRE-inducible AAV5 vektorer, sätt cDNA för GFP, Ascl1, Lmx1a och NR4A2 (Nurr1) i en omvänd orientering flankerad av två par heterotypiska, antiparallel LoxP flip-excision (FLEX) sekvenser (tabell över material). För cDNA insättning, Använd en ryggrad som paav-CBA-Flex eller en med en liknande struktur, som innehåller Flex sekvenser och en Chicken beta aktin (CBA) promotor.
    2. Sätt i varje enskild cDNA (t. ex. Ascl1) i ryggraden genom polymeras kedjereaktion (PCR) och restriktionsenzymer. Express GFP under kontroll av en synapsin promotor och Ascl1, Lmx1a, Nurr1 under kontroll av en ubiquitously uttryckt CBA promotor.
      Anmärkning: Se till att ha endotoxin fritt DNA med hjälp av specifika endotoxin-fria plasmid DNA isolerings satser.
    3. Utföra sekvensering och begränsning analys på konstruktioner före användning, för att kontrollera framgången för kloning steg.
  2. AAV5 viral vektor produktion
    Försiktighet: Se lokala biosäkerhets riktlinjer vid hantering av Adeno-associerat virus (AAV). I Sverige kräver AAV som används i detta protokoll biosäkerhetsnivå 2 (BSL-2).
    1. Seed HEK293T celler med standardkultur media (DMEM + Glutamax + 10% FBS + penicillin (100 U/ml) streptomycin (100 μg/mL), se tabell över material) i T175 flaskor med en densitet av 3 x 106 celler per kolv. Redogöra för 5 flaskor per bunt av AAV och planera för 6 omgångar i taget.
    2. När cellerna når 50-70% confluency, Förbered följande blandning för transfektion (per 175 cm2 kolv).
      1. I en 50 ml Centrifugera röret, tillsätt ekvimolära mängder av vektor plasmid och PDG-serien Helper plasmid (pDP5, pDP6), med ett sammanlagt belopp av 72 μg per 175 cm2 kolv.
      2. Tillsätt Tris-EDTA buffert (TE-buffert, 10 mM Tris-HCl, 1 mM EDTA) till en slutlig volym på 144 mL.
      3. Tillsätt ultrarent vatten så att den totala volymen blir 1296 ml och blanda.
      4. Tillsätt 144 μL av 2,5 M CaCl2 och blanda. Tillsätt 1,92 μL HEPES buffrad saltlösning (HBS) (1,5 mM na2HPO4 , 140 mm NaCl, 50 mm Hepes) till DNA-lösningen och blanda omedelbart genom vortexing.
      5. Inkubera vid rumstemperatur (RT) för exakt 60 s. överför lösningen till 28 mL färsk cellkultur media och blanda.
    3. Byt ut mediet i kolvar med cellodlingsmedium som innehåller transfektionblandning.
    4. Tre dagar efter transfektion, skörda cellerna genom att hälla bort THR medium från flaskorna i en engångsbehållare för avfall och tillsätt 5 mL skördebuffert (EDTA tillsätts fosfatbuffrad saltlösning, se tabell över material, dpbs till en slutlig koncentration 5 mm) till en koncentration av 5 mM) i varje kolv för att möjliggöra cell avlossning.
    5. Häll cell lösningen i ett 50 mL centrifugertub. Tillsätt ytterligare 4 mL DPBS till varje kolv för att skölja resterande celler och pool med första cell lösning. Centrifugera de skördade cellerna vid 1 000 x g i 5 min vid 4 ° c.
    6. Efter centrifugering, avlägsna supernatanten och lös upp pelletsen i 15 mL lyseringsbuffert (50 mM Tris-HCl pH 8,5, 150 mM NaCl, 1 mM MgCl2) genom vortexing.
    7. Frys dem i CO2-Ice/etanol Bath för 15 min och förvara i a-20 ° c frys. Tina den skördade cellen lysate i en 37 ° c vattenbad före användning.
  3. AAV5 viral Vector rening
    1. Utför AAV-rening genom iodixanol lutning ultracentrifugation13 och Använd första tätnings rör med centrifugering vid 350 000 x g för 1 h och 45 min vid RT.
    2. Använd en 10 mL spruta med en 18 g nål och sätt in ca 2 mm under 40/60%-fasgränsen med fasningen vänd uppåt för att extrahera AAV-innehållande fas. Se till att sluta innan du når protein bandet efter 5-6 mL har extraherats.
    3. Förvara gradientextrakten i autoklaverade glasflaskor vid 4 ° c. Undvik att lagra tider längre än natten.
    4. Späd ut iodixanol-gradienten 3-faldigt genom att långsamt Pipettera i 12 mL iodixanol eluering (IE) buffert (20 mM Tris-HCl pH 8,0, 15 mM NaCl) medan virvlande.
    5. Rena och koncentrera den utspädda iodixanol lutningen genom ett anjonbyte filter. Skjut den långsamt med en hastighet som inte är snabbare än 1 droppe/s. Tryck in 3 mL IE-buffert långsamt genom filtret för att tvätta det.
    6. Eluera i en centrifugalfilterenhet med 1-2 mL elueringbuffert (20 mM Tris-HCl pH 8.0; 250 mM NaCl). Lägg till DPBS till enheten till en slutlig volym på 4 mL. Centrifugera vid 2 000 x g vid RT tills mindre än 0,5 ml finns kvar i filtret. Ta bort vätskan från botten av röret, Fyll på med 4 mL DPBS och centrifugera igen. Upprepa detta steg två gånger. Se till att volymen koncentrerad vektor på filtret är ca 200 μL efter det sista centrifugeringssteget.
    7. Ta bort 200 Μlkoncentrerad vektor med hjälp av en pipett och tryck in koncentratet genom ett 0,22 mm filter för att sterilisera det. Aliquot 200 Μlintill en 9 mm glas flaska med mellanlåst skär (tabell över material).
      Anmärkning: De AAV5 vektorer lagren kan lagras i-80 ° c frysar för lång lagring, eller vid 4 ° c om de används inom 2 veckor.
  4. AAV5 viral Vector titer beslutsamhet
    1. Bestäm AAV5 titer med standard kvantitativ polymeras kedjereaktion (qPCR) med primers för inverterad Terminal REPEAT (ITR) sekvens och en 5 ́fam/3 ́bhq1 sond för ITR sekvens (tabell över material). Använd en standardkurva som uppnås med kända mängder ITR som innehåller plasmid. Varje AAV-vektor bör ha en räckvidd på 1E+ 14 – 1e+ 15 arvs kopior per milliliter om ITR-sekvens används för titerbestämning.
      Anmärkning: En lyckad AAV5 virus produktion ger lager med titrar i det minsta utbudet av 3E+ 13 – 7e+ 13 enheter/ml.

2. injektion av Omprogrammeringskoefficienter i hjärnan

  1. Animal setup, stereotaxic placering och borrning
    Observera:Detta protokoll fokuserar på användningen av Ascl1, Lmx1a och Nurr1 (ALN) för omprogrammering av NG2 glia till interneuroner. Enligt vår erfarenhet, interneuroner av en liknande fenotyp kan erhållas med hjälp av andra faktor kombinationer11.
    1. Före operationen, Förbered viral mix som innehåller vektorer CBA-FLEX-Ascl1, CBA-FLEX-Lmx1a, CBA-FLEX-Nurr1 och reporter Vector syn-FLEX-GFP. Tillsätt vart och ett av de bestånd som bereds i avsnitt 1 till den slutliga blandningen, så att den slutliga virus lösningen har 5% av var och en av omprogrammeringskoefficienter (Ascl1, Lmx1a och Nurr1) och 10% av rapportörens konstruktion (5% A, 5% L, 5% N och 10% GFP).
      Anmärkning: AAV5 vektor mixar kan förvaras vid 4 ° c och förvaras för framtida bruk in vivo.
    2. Anaesthetize musen med 2% isofluran i en blandning av luft och lustgas (N2O) vid en 4:1 förhållande. Övervaka djurets andning genom att observera membranens rörelser. Under operationen, underhålla anestesi med 1 – 1,5% isofluran.
      Anmärkning: Musmodellen beskrivs härmed består av en mus stam som uttryckligen uttrycker CRE i NG2 glia. In vivo omprogrammering kan uppnås med hjälp av olika mus stammar som uttrycker CRE i andra populationer av gliaceller (t. ex. astrocyter14).
    3. När djuret är helt sövda (t. ex., fullständig muskelavslappning och inget svar på en nypa i fotdyna), raka området runt snittet platsen och föra djuret till stereotaxic ram.
    4. För att bibehålla djurets kroppstemperatur under operationen, bifoga en värmedyna till basen av stereotaxic ramen. Placera musen på en ren, torr pappershandduk.
    5. Placera försiktigt musens huvud i öron listerna. Om korrekt placerad, ingen lateral förflyttning av huvudet bör observeras. Ställ den vänstra öron listen till 4 mm, innan du börjar Placera musen i stereotaxic ramen.
    6. Fäst tand listen på plats och dra sedan åt nosstapeln. Se till att huvudet inte rör sig i någon dimension och peka rakt fram (mittlinjen är vinkelrät mot planet av örat barer). Applicera oftalmologiska salva för ögonskydd.
    7. Före början av operationen, administrera lämplig analgesi (t. ex. 0,05 mg/kg buprenorfin, sub-kutan).
    8. Rengör snittet området med en bomull gasväv eller en torka indränkt med 70% EtOH, utan att närma sig området runt ögonen.
      Anmärkning: För intracerebral viral injektion, en 5 eller 10 mL spruta anpassad med en drog glas kapillär används. Glas kapillärer dras med hjälp av en micropipett avdragare, vilket resulterar i en kapillär med en mycket fin spets, vilket kommer att minimera invasivitet av förfarandet. För att anpassa kapillär i sprutan, Använd en bit av gummislangar över kopplingen mellan nålen på sprutan och glaset kapillär och smälta den med hjälp av en värmekälla (t. ex. en tändare). En tät koppling mellan de två bitarna kommer att se till att det inte finns några vätske läckor under injektionen. Innan operationen påbörjas, testa detta genom att fylla sprutan med saltlösning och trycka ut vätskan ur sprutan.
    9. Gör ett snitt på cirka 0,5-0,8 cm längs mittlinjen av huvudet. Skär genom både kutana och sub-kutana lager, med en skalpell.
    10. Vidga huden klaffar på varje sida av snittet. Rengör snittet av något blod och skrapa tillbaka de subkutana lagren med en bomulls knopp.
    11. Flytta M/L-D/V-armen på stereotaxic-ramen på plats (ovanför djuret) och fäst den.
      Anmärkning: Den stereotaxic ram tillåter justering av sprutan längs den främre/bakre (A/P, Y-axeln), medial/lateral (M/L, X-axeln) och dorsal/ventral (D/V, Z-axeln) axel.
    12. Flytta sprutan längs den olika axeln av stereotaxic ramen, för att få spetsen av glaset kapillär strax ovanför bregma (Knutpunkten där de olika skalle plattorna möts).
    13. Se till att kapillärspetsen är helt rak i både A/P-och M/L-flygplan. I händelse av en tvetydig bregma, ta genomsnittet av de laterala och mittlinjen suturer.
    14. När spetsen på kapillär är korrekt placerad ovanför bregma, återställa både M/L och A/P värden till 0,0 på den digitala koordinaten räknaren.
    15. För att säkerställa att huvudet på djuret är i ett helt plant läge, Använd den digitala koordinaten för att mäta D/V-koordinatvärdet, när A/P-armen är på + 2,0 och-2,0 (M/L = 0,0), samt när M/L-armen är på + 2,0 och-2,0 (A/P = 0,0). Justera höjden på tand stång och öron stänger därefter.
    16. Flytta sprutan till önskade koordinater för injektion av virusvektorer i striatum (A/P = + 1,0; M/L =-2,0, i förhållande till bregma).
    17. Höj sprutan något och, genom att titta på injektionsstället genom mikroskopet, borra ett hål med hjälp av en tandborren vid injektions koordinaterna. Börja borra på plats, arbetar i cirkulär och skonsam sätt.
      Anmärkning: Lägg inte för mycket tryck nedåt, eftersom borr biten bör vara skarp nog att gå igenom benet utan extra kraft. Undvik lång, ihållande borrning eftersom detta skapar värme.
    18. Vid slutet av borrningen, kontrollera att dura mater förblir intakt och exponerad för injektion.
  2. Förberedelse av sprutställ
    1. Placera en bit bomull gasväv över det öppna snittet och spola sprutan med saltlösning.
    2. Efter spolning, ta upp en luftbubbla av 1 – 2 μL, följt av 1 μL lösning som innehåller virusvektorer, undvika oavsiktliga bubblor. Se till att virus lösningen lätt kan visualiseras under luftbubblan, samtidigt som den injiceras.
  3. Viral injektion
    1. Ta bort bomulls gasväv från över snitt platsen, och sänk sprutan med D/V-armen på stereotaxic-ramen. Som ytan av skallen närmar sig, noggrant Titta igenom mikroskopet och mäta D/V-nivå av dura mater-det bör utbuktning något under lätt tryck.
    2. När du vidrör dura mater med spetsen på kapillär, Ställ in D/V-koordinaten till 0,0.
    3. Sänk sprutan, långsamt framåt till önskat djup (D/V =-2,7, i förhållande till dura mater). Se till att banan är klar för benfragment, så att ingen böjning av nålen/kapillär observeras.
      Anmärkning: De presenterade koordinaterna avser en injektion av omprogrammeringskoefficienter i striatum hos NG2-CRE-möss. Koordinater som motsvarar andra hjärnregioner kan användas. Testa alltid koordinaterna för injektion först med ett färgämne (t. ex. Trypan blå), färgad pärla injektion eller en reporter viral Vector före injektion av omprogrammering faktorer i hjärnan av en ny mus stam. Om injicera Trypan blå, djuren måste offras omedelbart efter operationen och hjärnan dissekeras ut. Färska hjärnor kan klippas med en mikrotom, medan frysta, och platsen för injektion bestäms av visualisering av färgämnet position i hjärnan. Om testning koordinater med färgade pärlor, är det möjligt att bestämma injektionsstället på parfymera och skär hjärnor en vecka efter injektion. Alternativt kan en injektion med en viral vektor som transporterar en reporter gen användas, och injektionsstället bestäms i parfymera snitt hjärnor.
    4. Injicera 1 μL av virus lösningen med en hastighet av 0,4 μL/min. När hela volymen injiceras, medge en diffusions period på 2 min innan sprutan tillbakadragande.
    5. Efter diffusion, sakta dra tillbaka sprutan tills spetsen av kapillär är helt ur hjärnan.
    6. Placera en bit bomull gasväv över såret och spola sprutan med saltlösning.
    7. Flytta M/L-D/V-armen på stereotaxic-ramen ut ur arbetsområdet.
  4. Stängning av såret och postoperativa procedurer
    1. Försiktigt suturen snittet med suturtråd.
      Anmärkning: Alla suturtrådar som används i injicerade djur bör kastas i en kopp/injektionsflaska innehållande antivirala rengöringsmedel lösning. Samma lösning används för att rengöra alla ytor som omger operationsområdet som har varit i kontakt med kirurgiska material. Alla kirurgiska verktyg är grundligt tvättas och autoklaveras i slutet av varje operation dag.
    2. Ta bort djuret från stereotaxic-ramen och placera det i en postoperativ Station, som innehåller en ren, uppvärmd bur, tillgång till mat och vatten, och där djuret stannar tills den är helt vaken. Under denna period, övervaka djuret noga tills medvetandet är återfått.
    3. Hus inte drivs djur med icke-drivna djur tills den förra har helt återhämtat sig från kirurgi.
    4. Övervaka handmanövrerade djur dagligen. Beroende på de suturer som används, se till att de avlägsnas vid behov. Alla djur fick Bupenorphinum (Temgesic på 1ml/kg) subkutan som postoperativ vård.
      Anmärkning: Om du använder samma spruta i två på varandra följande dagar, spola den med vatten, följt av etanol 70% och vatten igen. Låt sprutan fyllas med vatten över natten, för att möjliggöra upplösning av eventuella rester.

3. elektrofysiologiska inspelningar

  1. Vävnads skiva förberedelse för elektrofysiologi
    Försiktighet: En väl utförd vävnads beredning är nödvändig för att uppnå goda elektrofysiologiska inspelningar. Förbered rummet noggrant och placera verktyg för perfusion och dissektion på isen.
    1. Förbered Ice-Cold och som (95% O2 och 5% Co2) Krebs lösning för perfusion, dissektion och skärning (förbereda detta på samma dag från 10X beståndet genom att späda beståndet lösningen i ultrarent vatten och lägga NaHCO3 och glukos). Komponenterna i Krebs-lösningen i mM (efter spädning till 1x) är: 126 NaCl, 2,5 KCl, 1,2 NaH2Po4· H2o, 1,3 mgcl2· 6H2o, och 2,4 CaCl2· 6H2o, 22 NaHCO3, 10 glukos. Justera lösningens pH till 7,4.
    2. Utför en kalibrering (Vibracheck) för vibratome med ett nytt rakblad.
    3. Starta kylblocket av vibratome (eller fyll den omgivande kammaren med is), Fyll skärkammaren med Krebs lösning för syresättning med 95% O2 och 5% Co2 minst 30 min före användning.
    4. Sätt en petriskål på is och fyll den med som Krebs lösning. Placera bladet, saxen och monteringsplattan på isen.
      Försiktighet: Ta buren med musen till rummet minst 1 h innan du påbörjar förfarandet för acklimatisering. Stress har en negativ effekt på tillståndet i hjärnvävnad sektioner.
    5. Obotisera musen genom att injicera en överdos av pentobarbital och låt djuret somna.  När blinkreflex är ute och djur inte reagerar på smärt stimuli, transcardially BEGJUTA djuret med iskalla Krebs lösning för 2-3 min (med en hastighet av 10-20 ml/min).
    6. Snabbt, men försiktigt, dissekera hjärnan och lägga den upp och ner i Petri-skålen som är placerad på is (som innehåller Krebs lösning).
      Anmärkning: För att jämföra den funktionella mogningen av de omprogrammerade neuronerna, offra djuren för inspelningar vid olika tidpunkter efter viral injektion. Bedöma bränning egenskaper av olika subtyper av nervceller baserat på befintlig litteratur15 .
    7. Gör en koronala snitt längs mitten lillhjärnan och limma denna sida på monteringsplattan (också iskalla) för vibratome skärning.
    8. Doppa den limmade hjärnan noggrant i buffertkammaren i vibratome.
      Försiktighet: Var noga med att inte röra rakbladet för din egen säkerhet, och så att bladet kommer att förbli kalibrerad.
    9. Klipp från den mest rostrala delen av hjärnan ner till striatala nivå vid en hög hastighet. Skär sedan striatum Coralt vid 275 mm vid låg hastighet (0,10 mm/s).
    10. Efter varje snitt, ta försiktigt bort den icke-injicerade striatala sidan (t. ex. med en böjd nål) och överför den injicerade sidan till en annan injektionsflaska i ett vattenbad som innehåller ett bottennät (oxygenized Krebs vid RT) placerat i ett vattenbad. Förvara detta på RT tills alla sektioner skärs.
    11. Sakta öka temperaturen på vattenbadet till 37 ° c och lämna den i 30 min. Stäng sedan av aggregatet och låt svalna tills RT.
      ANMÄRKNINGAR: vid denna punkt kan du pausa tills du börjar spela in. Avsnitten varar för 4-6 h.
  2. Hela-cell patch-klämma inspelningar
    1. Överför den första vävnads sektionen till inspelnings kammaren nedsänkt i ett kontinuerligt flöde av Krebs lösning. Montera avsnittet med hjälp av ljus vikter och sänk målet.
    2. Identifiera den striatala regionen i mikroskopet och Sök efter GFP-positiva (omprogrammerade) nervceller. Välj en neuron som är omfattande i morfologi och inte täcks av fiber paket eller blodkärl.
    3. Förbered borosilikatglaspipetter (3 – 7 MΩ) för patchning och fyllning med följande intracellulära lösning (i mM): 122,5 kaliumglukonat, 12,5 KCl, 0,2 EGTA, 10 HEPES, 2 MgATP, 0,3 na3GTP och 8 NaCl, justerat till pH 7,3 med Koh.
    4. För biocytin fyllning, tillsätt 1 mg biocytin salt till 1 mL intern lösning och Vortex.
      Försiktighet: Se till att filtrera den interna lösningen med biocytin eftersom detta annars kan täppa till elektroden.
    5. Fäst glaspipetten i inspelnings elektroden och doppa den i lösningen. Dubbelkolla resistensen hos elektroden. Sedan långsamt närma sig cellen med pipetten, hålla ett svagt positivt tryck i elektroden för att undvika att plugga spetsen.
      Försiktighet: Var noga med att hålla koll på din cell medan du stiger av elektroden och inte bleka fluorescensen i cellen (dvs. Stäng av fluorescenslampan när du inte behöver den).
    6. Skölj den omgivande vävnaden noggrant med hjälp av det positiva trycket från elektroden och närma dig cellen med elektroden. Lokalisera elektroden rätt på toppen av cellen och sjunka tills elektroden touchd membranet. Gör en Giga-Ω-tätning mellan elektrod-och cellmembranet, och med negativa tryck pulser, ruptur membranet för att skapa en hel-cell patch.
      Försiktighet: Omprogrammerade neuroner är känsliga. Var försiktig när du korrigerar och Lägg inte för mycket negativt tryck när du når en Giga-Ω-tätning eller öppnar cellmembranet. Också, lapp på djur som är äldre kräver övning och tålamod som deras bindväv är tjockare och det är svårare att visualisera nervceller.
    7. Kontrollera vilo membranets potentialer omedelbart efter inbrott i ström-klämma läge och skriva ner för analys.
    8. I nuvarande klämma, underhålla cellen mellan-60 mV till-80 mV och injicera 500 ms strömmar från-20 pA till + 90 pA, med 10 pA steg för att inducera åtgärder potentialer.
    9. Överför till spännings klämma och mät inåtgående natrium och fördröjd rättelse av kalium strömmar vid depolariserande steg på 10 mV.
      Anmärkning: Spänningen-Clamp inspelningar bedöms bättre med hjälp av en annan intern lösning, som består av kemikalier som mer effektivt klämma membranet. Men för omprogrammerade neuroner, antalet celler som du kan spela in från är få och antalet vävnad sektioner med dessa nervceller är begränsad. Därför är det en fördel att spela in både i ström-klämma och spännings-klämma från samma cell.
    10. I spännings-klämma läge, rekord spontan postsynaptisk aktivitet vid-70 mV. Skilj hämmande postsynaptiska händelser med en membran potential på 0 mV från excitatoriska händelser vid-70 mV.
    11. Efter att ha nått en stabil baslinje, tillsätt Picrotoxin, GABAa -receptorantagonist, till Krebs lösning som strömmar in i inspelnings kammaren, att extrahera excitatoriska händelser (tillsätt en stamlösning av picrotoxin till en slutlig koncentration av 50 mm i separata buffertspruta som är ansluten till kammar perfusion. Anslut utflödet av buffert från kammaren till en vakuum påse för säkert bortskaffande).
    12. Efter 20 min, tillsätt CNQX (20 mM), en AMPA-antagonist, till Krebs lösning som strömmar in i inspelnings kammaren, att blockera de hämmande händelserna (med samma förfarande som för Picrotoxin). Låt verka i ytterligare 20 minuter och tvätta sedan ur med Krebs lösning. Ta bort vävnads sektionen från kammaren.
    13. Efter avslutad inspelningar, gör en offline analys av spontana excitatoriska post-synaptiska strömmar (EPSC) och hämmande efter Synaptic strömmar (IPSC) med hjälp av en tröskel-händelsedetektion (> 5 pA) i analysprogrammet.
    14. Under hela inspelningen kommer cellen att fyllas långsamt med den biocytin-innehållande interna lösningen. Förvara plåstret i minst 20 minuter innan du tar bort elektroden långsamt för att uppnå fullständig fyllning av cellen.
      Försiktighet: Var noga med att inte ha något positivt tryck i elektroden som kan förstöra den konsekutiva morfologiska analysen av cellerna efteråt.
    15. För biocytin-visualisering, placera vävnads sektionen i 4% PARAFORMALDEHYD (PFA) över natten vid 4 ° c. Skölj sektionen i 0,02 M kaliumfosfatbuffert (KPBS) med 0,1% Triton. Sedan, fläcken för streptavidin-Cy3 (1:600 i KPBS-T, 2 h), för identifiering av den biocytin-fyllda cellen och morfologisk visualisering av den omprogrammerade neuron.
      Anmärkning: Biocytin fyllning kan användas för Morfologisk analys och illustrationer av lappade nervceller.

4. immunohistokemi, Stereologi och kvantifiering

Anmärkning: Ägna en specifik grupp av möss för immunohistokemi, som vävnad sektioner som används för elektrofysiologi är inte optimala för immunohistokemi.

  1. Anestetisera möss med en i.p. injektion av en överdos av pentobarbital och montera djuret för perfusion.
  2. Transcardially BEGJUTA möss, först med en saltlösning för att ta bort blod, och sedan med iskalla 4% PFA.
  3. Dissekera hjärnor och efter Fix för minst 12 h i 4% PFA.
  4. Placera hjärnorna i 25% sackaroslösning (för kryoskydd) i cirka 12 timmar.
    Anmärkning: Hjärnorna är redo att skäras när de sjunker i 25% sackaroslösning, vilket indikerar att sackaros har trängt igenom hela mus hjärnan.
  5. Gör en Koronal skära över lillhjärnan, använda den platta, mest caudal del av hjärna att placera hjärnan på en mikrotom och fixa det på plats med hjälp av optimal skärtemperatur förening (OCT).
  6. Skär hjärnan i Koronal skivor med en tjocklek av 35 mm och dela hjärnan i konsekutiv serie placeras i flaskor eller brunnar som innehåller 0,02 M KPBS.
  7. Bearbeta avsnitten för immunohistokemi med hjälp av antikroppar mot GFP och euron markörer såsom GAD65/67, PV, Chat (kolin acetyltransferas) och NPY (neuropeptid Y), enligt standardprotokoll16, 17.
    Anmärkning: Hjärn skivor kan förvaras vid 4 ° c eller-20 ° c i frostskyddsvätska under långa perioder.
  8. Efter färgning är klar, montera sektionerna på en glasfiber Slide och täck med en glastäckslip, med hjälp av en monteringslösning för att fixa det på plats. Låt täckglasen torka över natten.
    Anmärkning: För våra studier, hela hjärnor skärs i 1:8-serien (dvs, varje flaska som innehåller sektioner kommer att hålla en åttondel av mushjärna11).
  9. Analysera avsnitten med hjälp av en inverterad fluorescens och/eller konfokala Mikroskop.
    Försiktighet: Fluorescerande mikroskopi är användbart för en allmän översikt av resultaten och fånga bilder för att beräkna omprogrammering effektivitet. För en mer detaljerad analys av fenotypisk identitet genom observation av dubbel positiva celler, bör konfokal avbildning användas.
  10. För kvantifiering av olika markörer uttryckta i GFP+ neuroner i striatum, räkna antalet dubbel-positiva celler i förhållande till det totala antalet GFP+ -celler (dvs. de omprogrammerade neuronerna), i minst två fält av varje striatala sektion.
  11. För bestämning av den ungefärliga extrapolerade totala antalet omprogrammerade neuroner per hjärna, räkna GFP+ neuroner som finns i striatum av en av hjärn serien klippa tidigare, och sedan multiplicera med det totala antalet serier.
    Anmärkning: Olika metoder för kvantifiering kan användas för att uttrycka omprogrammering effektivitet, antal omprogrammerade neuroner per djur och procent av nervceller som uttrycker vissa fenotypiska markörer. Mer information finns i föregående publikation11.
  12. Analysera skillnaderna mellan förhållanden med hjälp av diagram pad Prisma eller liknande.
    Anmärkning: För effektivitets beräkning, injicerade vi NG2-CRE möss med CRE-beroende ALN konvertering vektorer och GFP reporter. För att uppskatta konverterings effektiviteten injicerade vi även djur med en CRE-beroende GFP under den allestädiga CBA-promotorn, vilket gör alla riktade celler GFP+. Med denna jämförelse, vi uppskattade att 66,81% ± 38,38% av riktade celler omvandlas till nervceller. För validering av uttrycket för var och en av generna, kan kompletterande dubbel immunofluorescent-färgning utföras för GFP/Ascl1, GFP/Lmx1a och GFP/Nurr1. Dessutom kan Genomsekvensering som Single cell RNA-sekvensering avslöja närvaron av var och en av generna i de omprogrammerade cellerna.

Representative Results

Injektionen av AAV-vektorer används för att framgångsrikt omprogrammera Resident NG2 glia-celler till neuroner i NG2-CRE-musstriatum (figur 1a). För att specifikt rikta NG2 glia, är FLEX vektorer med omprogrammering/reporter gener, infogas i en antisense riktning och flankerad av två par antiparallel, heterotypic loxP platser (figur 1b). Var och en av de tre omprogrammeringgener (Ascl1, Lmx1a och Nurr1) placeras under kontroll av den allestädes närvarande CBA promotorn på enskilda vektorer. För att se till att GFP-uttrycket är begränsat till omprogrammerade neuroner från en CRE-uttrycker cell, är GFP placerad under kontroll av neuron-specifika synapsin promotor, (även i en FLEX vektor).

Användningen av kombinationen av omprogrammering och reporter konstruktioner möjliggör generering av GFP-positiva nervceller i mus striatum (figur 1c, C '). Användningen av reportern konstruera utan förekomst av omprogrammering gener ger inte GFP-positiva neuroner (figur 1d).

De omprogrammerade nervceller som är biocytin fyllda är synliga efter obduktion Immuno-färgning (figur 2A). Om omvandlingen är framgångsrik, bör det finnas omfattande neuronala morfologi. De elektrofysiologiska inspelningar av omprogrammerade neuroner visar förekomst av postsynaptiska funktionella anslutningar med spontana aktivitetsåtgärder (figur 2b, C). Detta kan blockeras med antingen jonotropa GABAergic eller glutamatergic blockerare (picrotoxin eller cnqx), vilket tyder på både excitatoriska och hämmande synaptisk input till omprogrammerade nervceller. Förekomsten av spontan aktivitet ökar med tiden efter viral injektion (figur 2D), indikerar en gradvis mognad.

Ström-inducerad åtgärd potentialer finns i funktionella nervceller. Åtgärden potentialer öka i antal över tiden efter konvertering (figur 2e). Detta indikerar ytterligare mogningen i neuronala funktion. I en omogen neuron, nuvarande kommer att inducera antingen ingen eller mycket få åtgärder potentialer (figur 2F).

Den bränning mönster av en neuron är celltyp specifika eftersom det beror på faktorer som morfologin av cellerna och kanal uttrycket15. De inspelade mönstren i de in vivo omprogrammerade neuronerna kan särskiljas i grupper och jämföras med den hos endogena neuronala subtyper, t ex snabbspiking interneuroner (celltyp B, figur 3b) eller andra celltyper (figur 3a, C, D ). De observerade elektrofysiologiska skillnaderna kan bekräftas av närvaron av specifika subtypmarkörer och samuttryck med GFP (figur 3E-H). Sammantaget visar dessa data att de omprogrammerade neuronerna som finns i striatum har egenskaper hos olika typer av interneuroner, såsom parvalbumin-, ChAt-och NPY-uttryckande interneuroner, liksom striatala medium taggig neuron identitet (DARPP32 +) ( Figur 3E -H).

Figure 1
Figur 1: in vivo omprogrammering av Resident NG2 glia till neuroner. (A) schematisk representation av AAV-virumedierad in vivo-omprogrammering av striatala NG2 glia. (B) schematisk representation av AAV5 Flex konstruktioner som används för in vivo omprogrammering, där genuttryck regleras av CRE uttryck i de riktade cellerna. (C och c) in vivo omprogrammerade neuroner, till följd av syn-GFP + ALN-injektion i striatum. (D) avsaknad av omprogrammerade neuroner när inga omprogrammering faktorer läggs in i viral cocktail, och endast reporter konstruera injiceras in vivo. Skalstreck = 100 mm (C), 25 mm (C '), 25 mm (D). Vänligen klicka här för att se en större version av denna siffra.

Figure 2
Figur 2: in vivo omprogrammerade neuroner är funktionella och visar mognad över tid. (A) biocytin-fyllda omprogrammerade neuron, visar mogen neuronala morfologi, inklusive dendritiska taggar. Spår visar (B) hämmande (GABAergic) aktivitet som är blockerad med picrotoxin, en GABAa -receptorantagonist och (C) excitatoriska aktivitet som är blockerad med cnqx, en AMPA-receptorantagonist. (D) antalet neuroner med postsynaptisk aktivitet ökar med tiden. (E) lappade nervceller visar repetitiva bränning redan vid 5 veckor efter injektion (w.p.i.) och fortsätter att visa att vid 8 och 12 W.p.i. (F) ström-inducerad åtgärd potential och postsynaptisk aktivitet av en omogen neuron, visar några synaptiska händelser och få actionpotentialer jämfört med B och D. Scale bar = 25 mm vänligen klicka här för att se en större version av denna siffra.

Figure 3
Figur 3: in vivo omprogrammerade neuroner visar immunohistokemiska och elektrofysiologiska egenskaper av striatala interneuroner. (a-D) Den bränning mönster av in vivo omprogrammerade nervceller kan vara av olika typer: (a) typ A liknar endogena medium taggig neuron (DARPP32 +); (B) liknar snabb-spiking (PV +) interneuroner; (C) liknar låg tröskel tillsatta nervceller med framstående SAG (NPY +); (D) neuroner avfyras med stora efter hyperpolarisering (chat +). (E-H) Konfokala bilder som visar samlokalisering av GFP och euron markörer PV (E), Chat (F), NPY (G), och projektion neuron markör DARPP32 (H). Alla skalstreck = 50 mm. vänligen klicka här för att se en större version av denna siffra.

Discussion

In vivo direkt omprogrammering kan uppnås med hjälp av AAV FLEX vektorer i CRE-uttrycker mus stammar. Det är viktigt att notera att skillnader mellan mus stammar när det gäller omprogrammering effekt har observerats. För in vivo-omprogrammering i striatum har NG2-CRE-muslinjen visat sig vara mer effektiv jämfört med andra stammar. Innan du börjar använda en ny djur stam, är det viktigt att kontrollera mus leverantörens riktlinjer om CRE uttryck över tiden, som ålder av djur ofta påverkar specificiteten av detta proteinuttryck. I våra studier användes inte djur som var äldre än 12 veckor för in vivo-omprogrammering eftersom det fanns en risk för CRE-uttryck i andra celler än NG2 glia. Konstant närvaro och övervakning av kontrolldjur injiceras endast med Synapsin-FLEX-GFP konstruera rekommenderas. Detta möjliggör övervakning av djuren för GFP-positiva celler som inte bör förekomma om inga omprogrammering gener (ALN) används.

För att identifiera de nyligen omprogrammerade neuronerna är en neuron-specifik identifieringsmetod som den som beskrivs i detta protokoll av yttersta vikt. Detta möjliggör en korrekt identifiering och åtskillnad av omprogrammerade neuroner från endogena omgivande celler som är av särskild relevans när omprogrammering i en homotopiska region.

Det är också viktigt att rikta den korrekta strukturen för viral injektion. Därför är stereotaxic kirurgi för viral injektion viktigt och måste kontaktas med noggrannhet, särskilt när man riktar mindre strukturer i hjärnan.

Vi har tidigare visat11 att det inte är tillförlitligt att förutsäga resultatet av in vivo omprogrammering baserat på in vitro-omprogrammering experiment med samma omprogrammering faktorer. Alla faktorer av intresse måste därför testas in vivo. I våra händer, många olika faktor kombinationer ger samma subtyp av nervceller (dvs, Interneuron11 in vivo) trots att dessa gener har varit inblandade i utvecklingen av andra nervceller.

Hela-cell patch klämma för omprogrammerade nervceller är en känslig teknik och vävnad bearbetning är viktigt för ett bra resultat. Perfusion med iskall Krebs lösning förbättrar vävnads kvaliteten. Också, lappade nervceller måste behandlas noggrant. Även om mognad och fenotypisk identitet omprogrammerade neuroner kan bedömas något med hjälp av hela cell patch Clamp, dessa celler är inte helt jämförbar med deras endogena motsvarigheter. Ytterligare typer av analyser, såsom Genomsekvensering (t. ex. RNA-sekvensering), bör användas för att ytterligare bekräfta omprogrammerad cell identitet.

Den teknik som beskrivs häri kan övervägas för utveckling av framtida terapier där neuronala ersättning behövs i hjärnan. Även om in vivo omprogrammering är fortfarande i ett tidigt skede och översättningen till människor är ännu inte förutses, denna teknik kan ge en metod för att bedöma exogena genfunktion i hjärnan och studera cell mognad in vivo.

Disclosures

Författarna har inget att avslöja.

Acknowledgments

Marcella Birtele har finansierats av Europeiska unionens Horizon 2020-program (Horisont 2020-MSCA-ITN-2015) inom ramen för Marie Skłodowska-Curie innovativa utbildningsnätverk och bidragsavtal nr 676408. Daniella Rylander Ottosson har finansierats av Vetenskapsrådet (2017-01234).

Materials

Name Company Catalog Number Comments
REAGENTS FOR AAV5 CLONING AND VIRAL VECTOR PREPARATION
pAAV-CA-FLEX AddGene 38042
Ascl1 AddGene 67291 NM_008553.4
Lmx1a AddGene 33013 NM_0033652.5
Nurr1 AddGene 35000 NM_013613.2
GFP-syn AddGene 30456
LoxP (FLEX) sequence 1 GATCTccataacttcgtataaagtatcctatac
gaagttatatcaaaataggaagaccaatgcttc
accatcgacccgaattgccaagcatcaccatcg
acccataacttcgtataatgtatgctatacgaa
gttatactagtcccgggaaggcgaagacgcgga
agaggctctaga
LoxP (FLEX) sequences 2 tactagtataacttcgtataggatactttatac
gaagttatcattgggattcttcctattttgatc
caagcatcaccatcgaccctctagtccacatct
caccatcgacccataacttcgtatagcatacat
tatacgaagttatgtccctcgaagaggttcgaa
ttcgtttaaacGGTACCCTCGAC
pDP5 Plasmid Factory PF435
pDP6 Plasmid Factory PF436
Phosphate-Buffered Saline (PBS) Thermo Fisher Scientific 10010023
FBS (Fetal bovine serum) Thermo Fisher Scientific 10500064
Penicillin streptomycin Thermo Fisher Scientific 15140122
DMEM (Dulbecco's Modified Eagle Medium)+ Glutamax Thermo Fisher Scientific 61965026
DPBS (Dulbecco's Phosphate Buffer Saline) Thermo Fisher Scientific 14190094
HEK293 cells Thermo Fisher Scientific 85120602-1VL
Flasks BD Falcon 10078780 175 cm2
Tris H-CL Sigma Aldrich 10812846001 For TE buffer use 10 mM, pH 8.0; for lysis buffer use 50mM, pH 8.5; for IE buffer use 20 mM, pH 8.0; for elution buffer use 20 mM, pH 8.0
EDTA EDTA: Invitrogen EDTA: AM9260G For TE buffer use 1 mM EDTA
Ultrapure water see Ultrapure water system
CaCl2 SigmaAldrich C5080 2.5 M
Dulbecco´s phosphate-buffered saline (DPBS) Thermo Fisher Scientific 14190136
NaCl Sigma-Aldrich S3014 FOR HBS use 140 mM; for Lysis Buffer use 150 mM; for IE buffer use 15 mM; for elution buffer use 250 mM
MgCl2 Sigma-Aldrich M8266-100G For lysis Buffer: 1 mM
Ultracentrifuge sealing tubes Beckman Coulter Quick-Seal® Polypropylene Tube
OptiPrep™ Density Gradient Medium Sigma Aldrich D1556-250ML
10-mL syringe-18G needle BD 305064
Laboratory glass bottles VWR ?
Anion exchange filter PALL laboratory MSTG25Q6 Acrodisc unit with Mustang Q membrane
Centrifugal filter unit Merck Z740210-24EA Amicon Ultra-4 device
Endotoxin-Free Plasmid DNA Isolation Kits Thermo Fisher Scientific A33073
Na2PO4 Sigma-Aldrich S7907
HEPES Sigma-Aldrich H7523 15 mL
Falcon tube Thermo Fisher Scientific Corning 352196
Falcon tube Thermo Fisher Scientific Corning 352070
Glass Vials Novatech 30209-1232 CGGCCTCAGFGAGCGA
Forward Primer for Inverted Terminal Repeat (ITR) sequence GGAACCCCTAGTGATGGAGTT
Reverse Primer for Inverted Terminal Repeat (ITR) sequence CACTCCCTCTCTGCGCGCTCG
5´FAM / 3´BHQ1 probe Jena Bioscience
0.22 mm filter Merck SLGV004SL Millex-GV filter
EQUIPMENT AAV5 VIRAL VECTOR PREPARATION
Freezer -20 °C
Freezer -80 °C
Fridge +4 °C
AAV viral room
Ultrapure Water system Merck Milli-Q® IQ 7000
Vortex mixer VWR 444-0004
Ultracentrifuge Beckman Coulter Beckman Optima LE-80K Ultracentrifuge
Autoclave Tuttnauer 2540 EL
Polymerase Chain Reaction (PCR) BioRad C1000 Touch Thermal Cycler
Quantitative PCR (qPCR) Roche LightCycler® 480 System
Centrifuge Thermo Fisher Scientific Sorvall ST16
Water Bath Thermo Fisher Scientific TSGP02
ANIMAL MODEL
NG2-Cre mice Jackson NG2-CrexB6129, Stock #008533
REAGENTS FOR INJECTION OF REPROGRAMMING FACTORS INTO THE BRAIN
Water
Saline Apoteket AB 70%
Ethanol Solveco
Isolfurane Apoteket AB Dilute to 1% solution with warm water.
Virkon Viroderm 7511 
Pentobarbital Apoteket AB P0500000 i.p. for terminal procedure at the dose of 60 mg/ml.
Sucrose Merck S0389-500G
Trypan Blu Thermo Fisher Scientific 15250061
Retrobeads Lumafluor R170
Buprenorphine Apoteket AB
EQUIPMENT FOR INJECTION OF REPROGRAMMING FACTORS INTO THE BRAIN From RSG Solingen.
Scissors VWR 233-1552 From Biochem.
Tweezers VWR 232-0007
Forcep VWR 232-0120
Scalpel holder VWR RSGA106.621 Number 20.
Scalpel VWR RSGA106.200
Stereotaxic frame Stoelting Europe 51500D
Mouse ear bars Stoelting Europe 51648 5 ul
Syringe with Removable needle Hamilton Company 65 0,75 inner diameter and 1.5 outer diameter.
Glass capilaries Stoelting 50811
Glass capillary puller Sutter company P-1000
Dental drill Agnthos AB 1464
Shaver Agnthos AB GT420
Isoflurane Chamber and pump Agnthos AB 8323101 2 mL
Syringes Merck Z118400-30EA 25G
Needles Merck Z192414 Aldrich
Mouse and neonatal rat adaptor for stereotaxic fram Stoelting 51625
Heating pad Braintree scientific, inc 53800M From Covidien 2187.
Cotton gauze Fisher Scientific 22-037-902
Rubber tube Elfa Distrelec HFT-A-9.5/4.8 PO-X BK 150
Cotton swabs Fisher Scientific 18-366-473
REAGENTS FOR WHOLE-CELL PATCH CLAMP RECORDINGS
NaCl Sigma-Aldrich S3014
KCl Sigma-Aldrich P9333
NaH2PO4-H2O Sigma-Aldrich S9638
MgCl2-6 H2O Sigma-Aldrich M2670
CaCl2-6 H2O Sigma-Aldrich C8106
MgSO4-7 H2O Sigma-Aldrich 230391
NaHCO3 Sigma-Aldrich S5761
Glucose Sigma-Aldrich G7021 see Ultrapure Water system
Ultrapure Water Prepare 1 or 2M.
KOH Sigma-Aldrich P5958-500G
K-D-gluconate Sigma-Aldrich G4500 Sigma
KCl Sigma-Aldrich P9541
KOH-EGTA (Etilene glycol-bis-N-tetracetic acid) Sigma-Aldrich E3889 Sigma
KOH- Hepes acid (N-2-hydroxyethylpiperazine-N’-2-ethanesulfonic acid) Sigma-Aldrich H7523
NaCl Sigma-Aldrich S3014
Mg2ATP Sigma-Aldrich A9187
Na3GTP Sigma-Aldrich G8877
Biocytin Sigma-Aldrich B4261
Picrotoxin Merck P1675 Sigma
CNQX Merck C239 Sigma
Ice
EQUIPMENT FOR WHOLE-CELL PATCH CLAMP RECORDINGS
Borosilicate glass pipette Sutter Company B150-86-10
Glass capillary puller Sutter company P-1000
Vibratome Leica Leica VT1000 S
WaterBath Thermo Fisher Scientific TSGP02
Clampfit software Molecular Devices
Multiclamp software Molecular Devices
REAGENTS FOR IMMUNOHISTOCHEMISTRY Use at a concentration of 4%. CAUTION: PFA is a potent fixative. Avoid ingestion and contact with skin.
Paraformaldehyde (PFA) Merck Millipore 1040051000 Use at a concentration of 0.1%.
Triton X-100 Fisher Scientific 10254640 Donkey.Use at a concentration of 1 : 400.
Serum Merck Millipore S30-100ML Reconstitute the powder in Milli-Q water to 1 mg/mL. Aliquot and store at -20°C, light sensitive. Use at a concentration of 1 : 500.
4′,6-Diamidino-2′-phenylindole dihydrochloride (DAPI) Sigma Aldrich D9542 1: 600 in KPBS-T.
streptavidin- Cy3 Thermo Fisher Scientific 434315 1:5000, rabbit.
Anti-GAD65/67 Abcam 1:2000, mouse.
Anti-PV Sigma P3088 1:200, goat.
Anti-Chat Merk AB143 1:5000, rabbit.
Anti-NPY Immunostar 22940
K2HPO4 Sigma-Aldrich P3786
NaCl Sigma-Aldrich S3014
KH2PO4 Sigma-Aldrich NIST200B 1:1000, chicken.
Anti-GFP Abcam ab13970
Mounting solution Merck 10981 Polyvinyl alcohol mounting medium with DABCO®, antifading
OCT Agar Scientific
Glycerol Sigma-Aldrich G9012-100ML
Distilled water
Anti-freeze solution Tissue Pro Technology AFS05-1000N, 1000 mL/ea.
EQUIPMENT FOR IMMUNOHISTOCHEMISTRY
Inverted fluorescence microscope Leica DMI6000 B
Confocal microscope Leica TCS SP8 laser scanning confocal microscope.
Prism GraphPad
Microtome Leica SM2010R

DOWNLOAD MATERIALS LIST

References

  1. Barker, R. A., Parmar, M., Studer, L., Takahashi, J. Human Trials of Stem Cell-Derived Dopamine Neurons for Parkinson's Disease: Dawn of a New Era. Cell Stem Cell. 21, (5), 569-573 (2017).
  2. Southwell, D. G., et al. Interneurons from embryonic development to cell-based therapy. Science. 344, (6180), 1240622 (2014).
  3. Parmar, M., Torper, O., Drouin-Ouellet, J. Cell-based therapy for Parkinson's disease: A journey through decades toward the light side of the Force. European Journal of Neuroscience. (2018).
  4. Torper, O., et al. In Vivo Reprogramming of Striatal NG2 Glia into Functional Neurons that Integrate into Local Host Circuitry. Cell Reports. 12, (3), 474-481 (2015).
  5. Su, Z., Niu, W., Liu, M. L., Zou, Y., Zhang, C. L. In vivo conversion of astrocytes to neurons in the injured adult spinal cord. Nature Communication. 5, 3338 (2014).
  6. Liu, Y., et al. Ascl1 Converts Dorsal Midbrain Astrocytes into Functional Neurons In Vivo. Journal of Neuroscience. 35, (25), 9336-9355 (2015).
  7. Guo, Z., et al. In vivo direct reprogramming of reactive glial cells into functional neurons after brain injury and in an Alzheimer's disease model. Cell Stem Cell. 14, (2), 188-202 (2014).
  8. Grande, A., et al. Environmental impact on direct neuronal reprogramming in vivo in the adult brain. Nature Communication. 4, 2373 (2013).
  9. Niu, W., et al. In vivo reprogramming of astrocytes to neuroblasts in the adult brain. Nature Cell Biology. 15, (10), 1164-1175 (2013).
  10. Weinberg, M. S., Criswell, H. E., Powell, S. K., Bhatt, A. P., McCown, T. J. Viral Vector Reprogramming of Adult Resident Striatal Oligodendrocytes into Functional Neurons. Molecular Therapy. 25, (4), 928-934 (2017).
  11. Pereira, M., et al. Direct Reprogramming of Resident NG2 Glia into Neurons with Properties of Fast-Spiking Parvalbumin-Containing Interneurons. Stem Cell Reports. 9, (3), 742-751 (2017).
  12. Rivetti di Val Cervo, P., et al. Induction of functional dopamine neurons from human astrocytes in vitro and mouse astrocytes in a Parkinson's disease model. Nature Biotechnology. 35, (5), 444-452 (2017).
  13. Crosson, S. M., Dib, P., Smith, J. K., Zolotukhin, S. Helper-free Production of Laboratory Grade AAV and Purification by Iodixanol Density Gradient Centrifugation. Molecular Therapy Methods & Clinial Development. 10, 1-7 (2018).
  14. Torper, O., et al. Generation of induced neurons via direct conversion in vivo. Proceedings of the National Academy of Sciences of the United States of America. 110, (17), 7038-7043 (2013).
  15. Kawaguchi, Y., Kubota, Y. Correlation of physiological subgroupings of nonpyramidal cells with parvalbumin- and calbindinD28k-immunoreactive neurons in layer V of rat frontal cortex. Journal of Neurophysiology. 70, (1), 387-396 (1993).
  16. Grealish, S., et al. The A9 dopamine neuron component in grafts of ventral mesencephalon is an important determinant for recovery of motor function in a rat model of Parkinson's disease. Brain. 133, (Pt 2), 482-495 (2010).
  17. Thompson, L., Barraud, P., Andersson, E., Kirik, D., Bjorklund, A. Identification of dopaminergic neurons of nigral and ventral tegmental area subtypes in grafts of fetal ventral mesencephalon based on cell morphology, protein expression, and efferent projections. Journal of Neuroscience. 25, (27), 6467-6477 (2005).
In vivo direkt omprogrammering av bosatta gliaceller i interneuroner genom intracerebral injektion av virala vektorer
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Pereira, M., Birtele, M., Rylander Ottosson, D. In Vivo Direct Reprogramming of Resident Glial Cells into Interneurons by Intracerebral Injection of Viral Vectors. J. Vis. Exp. (148), e59465, doi:10.3791/59465 (2019).More

Pereira, M., Birtele, M., Rylander Ottosson, D. In Vivo Direct Reprogramming of Resident Glial Cells into Interneurons by Intracerebral Injection of Viral Vectors. J. Vis. Exp. (148), e59465, doi:10.3791/59465 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter