Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Neuroscience

In vivo doğrudan reprogramming Resident glial hücreler Interneurons viral vektörler ıntracerebral enjeksiyon ile

doi: 10.3791/59465 Published: June 17, 2019

Summary

Bu protokol, beyinde AAV tabanlı bir viral sistem ve hücre tanımlaması ve daha fazla analiz için izin veren bir FLEX synapsin odaklı GFP muhabiri kullanarak doğrudan yeniden programlanmış internöronlar içinde vivo üretmeye yönelik hedefler.

Abstract

Fonksiyonel ve Subtype özgü nöronların içine beyin Resident glia dönüştürme aynı zamanda situ hücre kaderi çalışmak için araçlar oluştururken, alternatif hücre replasman tedavilerin gelişimine doğru bir adım sağlar. Bugüne kadar, in vivo yeniden programlama ile nöronlar elde etmek mümkün olmuştur, ancak bu nöronların veya nasıl olgun hassas fenotipi ayrıntılı olarak analiz edilmedi. Bu protokolde, AAV tabanlı bir viral vektör sistemi kullanarak, in vivo yeniden programlanmış nöronların daha verimli bir dönüşüm ve hücreye özgü kimliğini tanımladık. Ayrıca, yeniden programlanmış hücrelerin nöronal olgunlaşma fonksiyonel değerlendirme için bir protokol sağlar. Flip-eksizyon (Flex) vektörler enjekte ederek, hücre yeniden programlama için hedef olarak hizmet beyin belirli hücre türlerine yeniden programlama ve synapsin odaklı muhabir genler içeren. Bu teknik, yeni yeniden programlanmış nöronların kolay tanımlanması için izin verir. Sonuçlar, elde edilen yeniden programlanmış nöronların işlevsel olarak zaman içinde olgun olduğunu, sinaptik kontakları almasını ve farklı türde internöronların elektrofizyolojik özelliklerini gösterdiğimi göstermektedir. Ascl1, Lmx1a ve Nurr1 transkripsiyon faktörlerini kullanarak, yeniden programlanmış hücrelerin çoğunluğu hızlı spiking, parvalbumin içeren interneurons özellikleri vardır.

Introduction

Bu yöntemin genel hedefi verimli bir şekilde beyin yerleşik glia in vivo fonksiyonel ve Subtype özgü nöronlar gibi parvalbumin-interneurons ifade dönüştürmek için. Bu bir eksojen hücre kaynağına gerek kalmadan beyin hastalıkları için alternatif bir hücre replasman tedavisinin gelişmesine yönelik bir adım ileri sağlar. Aynı zamanda hücre kader anahtarları situ çalışma için bir araç oluşturur.

Beyin yeni nöronlar üretmek için sadece sınırlı bir kapasiteye sahiptir. Bu nedenle, nörolojik hastalıklarda, beyin tamiri için eksojen hücre kaynaklarına ihtiyaç vardır. Bunun için, birincil dokudan hücreler, kök hücre türetilen hücreler ve yeniden programlanmış hücreler dahil olmak üzere yıllar boyunca farklı hücre kaynakları yoğun araştırmaya maruz kalmıştır1,2,3. Doğrudan nöronlar içine Resident beyin hücrelerinin yeniden programlama beyin içinde roman nöronlar oluşturmak için hastanın kendi hücrelerini kullanır gibi beyin tamiri için çekici bir yöntem sağlayabilir son bir yaklaşımdır. Bugüne kadar, birkaç rapor içinde vivo yeniden programlama beyin Viral vektör teslimat ile göstermiştir4,5,6,78,9 gibi farklı beyin bölgelerinde korteks, omurilik, striatum ve orta beyin5,10,11, yanı sıra bozulmamış ve lezioned beyin5,8,11,12. İnhibitör ve uyarıcı nöronlar elde edilmiştir4,8, ancak bu hücrelerin hassas fenotipi veya işlevselliği henüz ayrıntılı olarak analiz edilmedi.

Bu protokolde, in vivo yeniden programlanmış nöronların daha verimli bir şekilde yeniden programlanması ve hücreye özgü tanımlaması açıklanmaktadır. İşlevsellik ve immünohistokimyasal özelliklere dayalı nöronal olgunlaşma ve fenotip karakterizasyonu işlevsel değerlendirme için bir protokol sağlıyoruz.

Biz bir CRE-indüklenebilir AAV vektör ve bir GFP muhabir in vivo yeniden programlanmış nöronlar tanımlamak için kullanılır. Viral vektörler bu seçim retrovirüs7,8kullanımına alternatif olarak, hedeflenen hücrelerin sayısını artırarak, hem bölme ve beyin bölünmeyen hücreleri bulaşan avantajına sahiptir. Bir nöron özgü synapsin odaklı FLEX muhabiri (GFP), özellikle yeni oluşturulan nöronlar algılamak için bize sağladı. Önceki çalışmalar, aynı zamanda belirli hücre türlerinde yeniden programlama genler ve gazetecilerin ifade izin in vivo yeniden programlama7,9için Subtype özgü Rehberleri kullandık. Ancak, bu yöntem muhabir ve nöronal işaretçileri ortak ifade postmortem analizi ile yeniden programlanmış nöronların daha fazla tanımlanması gerekir. Burada açıklanan bir neuron-specific muhabir, kullanımı, doğrudan bir kimlik sağlar. Bu başarılı bir dönüşüm doğrudan bir kanıtı sağlar ve yama kelepçe Elektrofizyoloji için gerekli olan bir canlı hücre kimlik sağlar.

Protocol

Tüm deneysel prosedürler Avrupa Birliği Direktifi (2010/63/EU) kapsamında gerçekleştirildi ve Lund Üniversitesi 'nde Laboratuvar hayvanlarının kullanımı için Etik Komite ve Isveç tarım bölümü (Jordbruksverket) tarafından onaylanmıştır. Fareler, gıda ve suya reklam Isteğe bağlı erişimi ile 12 saat ışık/karanlık bir döngüde yer almaktadır.

1. viral vektörler

  1. AAV vektörler klonlama
    1. CRE-indüklenebilir AAV5 vektörler oluşturmak için, GFP, Ascl1, Lmx1a ve NR4A2 (Nurr1) için cDNA 'yı iki çift heterotilal, antiparalel LoxP Flip-eksizyon (FLEX) dizileri (malzeme tablosu) ile çevrelenmiş bir ters yönde yerleştirin. CDNA ekleme için, paav-cba-Flex gibi bir omurga veya Flex dizileri ve bir tavuk Beta aktin (CBA) Promoter içeren benzer bir yapıya sahip biri kullanın.
    2. Polimeraz zincir reaksiyonu (PCR) ve kısıtlama enzimleri ile her bir cDNA 'yı (örneğin, Ascl1) omurgasına takın. Express Gfp bir synapsin organizatör ve Ascl1, Lmx1a, Nurr1 kontrolü altında bir ubiquitously cba Organizatör ifade kontrol altında.
      Not: Spesifik endotoksin Içermeyen Plasmid DNA yalıtım kitleri kullanılarak endotoksin içermeyen DNA 'ya sahip olduğunuzdan emin olun.
    3. Kopyalama adımının başarısını denetlemek için, kullanmadan önce yapıdaki sıralamayı ve kısıtlama analizini gerçekleştirin.
  2. AAV5 Viral vektör üretimi
    Dikkat: Adeno ilişkili virüsü (AAV) ele aldığınızda yerel Biyogüvenlik yönergelerine bakın. Isveç 'te, bu protokolde kullanılan AAV Biosafety seviye 2 (BSL-2) gerektirir.
    1. Tohum HEK293T hücreler standart kültür medyası ile (DMEM + Glutamax + 10% FBS + penisilin (100 U/ml) streptomisin (100 μg/mL), bkz: malzeme tablosu) T175 flsorlar içinde 3 x 106 hücreler ağırlığı. AAV toplu başına 5 şişeler için hesap ve bir defada 6 gruplar için plan.
    2. Hücreleri% 50-70 konfluency ulaştığında, transfeksiyon için aşağıdaki karışımı hazırlayın (başına 175 cm2 Flask).
      1. Bir 50 mL santrifüj tüpte, 175 cm2 Flask başına toplam 72 μg miktarda vektör plazmid ve PDG serisi Helper Plasmid (PDP5, pDP6) equimolar tutarları ekleyin.
      2. 144 mL son hacmine Tris-EDTA tampon (TE tampon, 10 mM Tris-HCl, 1 mM EDTA) ekleyin.
      3. Toplam hacmi 1296 ml ve mix haline böylece ultra saf su ekleyin.
      4. 2,5 M CaCl2 ve mix 144 μL ekleyin. Eklemek 1,92 μL HEPES tamponlu tuzlu (HBS) (1,5 mM na2HPO4 , 140 mm NACL, 50 mm HEPES) DNA çözümü ve mix hemen vorotoplama ile.
      5. Tam 60 s için oda sıcaklığında (RT) inküye. çözümü 28 mL taze hücre kültürü ortamına aktarın ve karıştırın.
    3. Transfeksiyon karışımı içeren hücre kültürü orta ile şişeler içinde orta değiştirin.
    4. Transfeksiyon sonra üç gün, atık için tek kullanımlık bir kap içine şişeler gelen THR orta dışarı dökülen hücreleri hasat ve eklemek 5 hasat tampon ml (EDTA fosfat-tamponlu tuzlu ekledi, bkz malzeme tablosu, son bir konsantrasyon için dpbs 5 mm) bir konsantrasyon 5 mM) her Flask hücre dekolmanı izin vermek için.
    5. 50 mL santrifüj tüpünde hücre çözümünü dökün. İlk hücre çözeltisi ile kalan hücreleri ve havuzu durulamak için her Flask için başka bir 4 mL DPBS ekleyin. Hasat edilen hücreleri 4 °C ' de 5 dakika için 1.000 x g 'de santrifüjler.
    6. Santrifüjden sonra, süpernatant çıkarın ve 15 ml liziz tamponu (50 mm Tris-HCl pH 8,5, 150 mm NaCl, 1 mm MgCl2) peletleri çözülür.
    7. 15 dakika boyunca CO2-buz/etanol banyosunda dondurun ve 20 °c ' lik dondurucuda saklayın. Kullanmadan önce 37 °C su banyosunda hasat edilen hücre lysate çözülür.
  3. AAV5 Viral vektör arıtma
    1. Iodixanol gradyan ile AAV arıtma gerçekleştirin13 ve 350.000 x g santrifüjleme ile ultracent, sızdırmazlık tüpleri kullanın 1 saat ve 45 dk RT.
    2. 18G iğne ile 10 mL şırınga kullanın ve AAV içeren faz ayıklamak için eğim yukarı bakacak şekilde% 40/60 faz kenarlık yaklaşık 2 mm altında takın. 5-6 mL ayıklandıktan sonra protein bandında ulaşmadan önce durtığınızdan emin olun.
    3. Gradyan özleri 4 °c ' de Otoklavlanmış cam şişelerde saklayın. Bir gecede daha uzun zaman depolama kaçının.
    4. Iodixanol gradyan ekstresi seyreltme 3-kat yavaşça ıodixanol elüsyon (IE) tampon 12 mL (20 mM Tris-HCl pH 8,0, 15 mM NaCl) içinde pipetleme ile dolarken.
    5. Seyreltilmiş ıodixanol degradesini bir anyon değişimi filtresinde arındırın ve konsantre olun. 1 damla/s daha hızlı bir hız ile yavaş bir şekilde itin. IE tampon 3 mL yavaşça filtre aracılığıyla yıkamak için Itin.
    6. 1-2 mL 'Lik elüsyon tampon ile Santrifüjlü filtre ünitesine (20 mM Tris-HCl pH 8.0; 250 mM NaCl) kadar elute. 4 mL son hacmine aygıta DPBS ekleyin. 2.000 x g 'de Santrifüjden less den 0,5 ml 'den az olana kadar filtrede bırakılır. Tüpün altındaki sıvıyı çıkarın, 4 mL DPBS ve santrifüj ile yeniden doldurun. Bu adımı iki kez daha tekrarlayın. Son santrifüjleme adımının ardından filtre üzerindeki konsantre vektörünün hacminin yaklaşık 200 μL olduğundan emin olun.
    7. 200 Μlkonsantre vektörü bir pipet kullanarak çıkarın ve konsantrasyonda 0,22 mm 'lik bir filtreden geçerek sterilize edin. Aliquot 200 μlinto 9 mm cam şişe ile Interlocked kesici uç (malzeme tablosu).
      Not: AAV5 vektörler stokları, uzun depolama için-80 °C dondurucular veya 2 hafta içinde kullanıldığında 4 °C ' de depolanabilir.
  4. AAV5 Viral vektör titresi belirlenmesi
    1. Standart nicel polimeraz zincirini (qPCR) ters Terminal REPEAT (ITR) dizisi için astar ve ITR dizisi için 5 ' FAM/3 ' BHQ1 prob (malzeme tablosu) kullanarak AAV5 titresi belirleyin. Plazmid içeren bilinen ıTR miktarlarıyla elde edilen standart bir eğrisi kullanın. Her AAV vektörü, ITR dizisi titre belirlenmesi için kullanılırsa, mililitre başına 1E+ 14 – 1e+ 15 genom kopyası olmalıdır.
      Not: Başarılı bir AAV5 virüs üretimi minimum 3E+ 13 – 7E+ 13 adet/ml aralığında Titanlar ile hisse senetleri verir.

2. beyin içine yeniden programlama faktörleri enjeksiyon

  1. Hayvan kurulumu, stereotaktik yerleştirme ve sondaj
    Not:Bu protokol, NG2 glia 'nın internöron içine yeniden programlanması için Ascl1, Lmx1a ve Nurr1 (ALN) kullanımına odaklanır. Deneyimimizde, benzer bir fenotip interneurons diğer faktör kombinasyonları kullanılarak elde edilebilir11.
    1. Ameliyattan önce, vektörler cba-FLEX-Ascl1, cba-FLEX-Lmx1a, cba-FLEX-Nurr1 ve Reporter vector SYN-FLEX-GFP içeren viral karışımı hazırlayın. Son karışım için Bölüm 1 ' de hazırlanan stokların her birini ekleyin, böylece nihai viral çözüm yeniden programlama faktörlerinin her birinin% 5 ' i (Ascl1, Lmx1a ve Nurr1) ve muhabir yapının% 10 ' unda (% 5 A,% 5 L,% 5 N ve% 10 GFP) vardır.
      Not: AAV5 vektör karışımları 4 °C ' de depolanabilir ve gelecekteki kullanım için tutulur.
    2. 4:1 bir oranda hava ve nitrojen oksit (N2O) karışımında% 2 isofluran kullanarak fareyi anesteziye atın. Diyaframın hareketlerini izleyerek hayvanın nefes almasını izleyin. Cerrahi sırasında, anestezi% 1-1,5 Isoflurane kullanarak koruyun.
      Not: Burada açıklanan fare modeli özellikle NG2 glia CRE ifade eden bir fare gerinim oluşur. In vivo yeniden programlama glial hücrelerin diğer nüfuslarında CRE ifade farklı fare suşları kullanılarak elde edilebilir (örneğin, astrositler14).
    3. Bir kez hayvan tamamen anestezi (örneğin, tam kas gevşeme ve ayak pedi bir tutam hiçbir yanıt), kesi site çevresindeki alanı tıraş ve stereotaktik çerçeveye hayvan getirmek.
    4. Cerrahi sırasında hayvanın vücut sıcaklığını korumak için, stereotaktik çerçevenin tabanına bir ısıtma yastığı takın. Fareyi temiz, Kuru bir kağıt havlusu üzerine yerleştirin.
    5. Fareyi dikkatle kulak çubuklarına yerleştirin. Doğru yerleştirilirse, başının lateral hareketi gözlenmemelidir. Fareyi stereotaktik çerçeveye koyarak başlamadan önce sol kulak çubuğunu 4 mm 'ye ayarlayın.
    6. Diş çubuğunu yerine sabitleyin ve ardından burun çubuğunu sıkın. Baş herhangi bir boyut ve nokta düz ileriye hareket etmez emin olun (orta çizgi kulak çubukları düzlemine dik olmak). Göz koruması için oftalmik merhem uygulayın.
    7. Ameliyattan önce, uygun analjezi yönetmek (örneğin, 0,05 mg/kg Buprenorfik, alt-kutanöz).
    8. Bir pamuk gazlı bez ile kesi alanını temizleyin veya% 70 EtOH ile ıslatılmış bir silme, göz bölgesine yaklaşmadan.
      Not: İntraserebral viral enjeksiyon için, çekilen cam kapiller ile uyarlanmış 5 veya 10 ml şırınga kullanılır. Cam kapiller bir mikropipet çektirme kullanılarak çekilir, çok ince bir ucu ile bir kılcal sonucu, hangi prosedürün invaziv en aza indirecek. Kapiller şırıngaya adapte etmek için, şırınga ve cam kapiller iğne arasındaki bağlantı üzerinde kauçuk tüp bir parça kullanın ve bir ısı kaynağı (örneğin, bir çakmak) kullanarak eritmek. İki parça arasında sıkı bir bağlantı enjeksiyon sırasında hiçbir sıvı sızıntıları olduğundan emin olacaktır. Ameliyatı başlatmadan önce, şırıngayı tuz ile doldurarak ve şırıngadan sıvıyı iterek test edin.
    9. Baş orta çizgi boyunca yaklaşık 0,5-0.8 cm kesi yapın. Hem kutanöz hem de alt-kutanöz katmanları, bir neşter ile keser.
    10. Kesi her tarafında cilt flep genişletin. Herhangi bir kanın kesi temizleyin ve bir pamuk tomurcuk ile subkutan katmanları geri kazımak.
    11. Stereotaktik çerçevenin M/L-D/V kolunu yerine (hayvanın üstünde) taşıyın ve sabitleyin.
      Not: Stereotaktik çerçeve ön/posterior (A/P, Y ekseni), medial/lateral (M/L, X ekseni) ve dorsal/ventral (D/V, Z ekseni) ekseninde şırınganın ayarlanması sağlar.
    12. Şırıngayı stereotaktik çerçevenin farklı ekseni boyunca hareket ettirin, sadece kemiğinin üzerinde cam kapiller ucunu getirmek için (farklı kafatası plakalarının buluşabileceği kavşak noktası).
    13. Kapiller ucunun hem A/P hem de M/L düzlemlerinde mükemmel bir şekilde düz olduğundan emin olun. Belirsiz bir bregma durumunda, lateral ve orta çizgi sütürler ortalamasını alın.
    14. Kapiller ucu doğru bregma üzerine yerleştirildiğinde, dijital koordinat sayacı üzerinde 0,0 için hem M/L ve A/P değerlerini sıfırlayın.
    15. Hayvanın kafasının mükemmel düz bir konumda olduğundan emin olmak için, A/P kolu + 2,0 ve-2,0 (M/L = 0,0) olduğu zaman M/L kolu + 2,0 ve-2,0 (A/P = 0,0) olduğunda D/V koordinat değerini ölçmek için dijital koordinat sayacı kullanın. Diş çubuğunun ve kulak çubuklarının yüksekliğini buna göre ayarlayın.
    16. Striatum viral vektörler enjeksiyon için istenilen koordinatlara şırıngayı taşıyın (A/P = + 1,0; M/L =-2,0, bregma 'ya göre).
    17. Şırınga hafifçe kaldırın ve, mikroskopla enjeksiyon sitesine bakarak, enjeksiyon koordinatlarında bir diş matkap kullanarak bir delik matkap. Dairesel ve nazik bir şekilde çalışma, sitede matkap başlayın.
      Not: Matkap biti ek kuvvet olmadan kemikten geçmek için yeterince keskin olması gerektiği için çok fazla aşağı basınç koymayın. Bu ısı yaratır gibi uzun, sürekli sondaj kaçının.
    18. Sondaj sonunda, Dura mater bozulmamış ve enjeksiyon için maruz kalır kontrol edin.
  2. Şırınga Kurulum hazırlığı
    1. Açık kesi üzerine bir pamuk gazlı bez parçası yerleştirin ve tuz çözeltisi ile şırınga floş.
    2. Temizleme işleminden sonra, 1 – 2 μL hava kabarcığı alın, ardından viral vektörler içeren 1 μL solüsyonu takip ederek kasıtsız kabarcıkların önlenmesi. Viral çözümün kolayca hava balonu altında görüntülendiğinden emin olun, enjekte edilirken.
  3. Viral enjeksiyon
    1. Pamuk gazlı bezle kesi bölgesinden çıkarın ve stereofik çerçevenin D/V kolunu kullanarak şırıngayı indirin. Kafatasının yüzeyi yaklaştıkça, dikkatle mikroskop üzerinden bakmak ve Dura mater D/V seviyesini ölçmek-biraz nazik basınç altında çıkıntı gerekir.
    2. Kapiller ucu ile Dura mater dokunmadan iken, 0,0 için D/V koordinatını ayarlayın.
    3. Şırıngayı indirin, yavaşça istenilen derinliğe ilerler (D/V =-2,7, Dura mater 'a göre). Yörünge kemik parçaları açık olduğundan emin olun, böylece iğne/kapiller bükme görülmez.
      Not: Sunulan koordinatlar NG2-CRE fareler striatum içine yeniden programlama faktörleri bir enjeksiyon bakın. Diğer beyin bölgelerine karşılık gelen koordinatlar kullanılabilir. Her zaman bir boya kullanarak ilk enjeksiyon için koordinatları test (örneğin tripan mavi), renkli boncuk enjeksiyon veya yeni bir fare gerinim beyin içine yeniden programlama faktörleri enjeksiyon önce bir muhabir Viral vektör. Tripan mavi enjekte ederseniz, hayvanların ameliyattan hemen sonra kurban edilmesi gerekir ve beyin dışarı disseke. Taze beyin bir mikrotome kullanarak kesilebilir, dondurulmuş iken, ve enjeksiyon site beynin boya konumunun görselleştirme tarafından belirlenir. Test koordinatları renkli boncuk kullanarak, bu perfüze enjeksiyon site belirlemek ve iğne sonra bir hafta beyin kesilmiş mümkündür. Alternatif olarak, bir muhabir gen taşıyan bir viral vektör ile bir enjeksiyon kullanılabilir, ve enjeksiyon sitesi perfüze kesilmiş beyin belirlenir.
    4. 0,4 μL/dak hızında viral çözelti 1 μL enjekte edilir. Tüm hacim enjekte edildiğinde, şırınga çekilmeden önce 2 dk difüzyon süresi için izin verin.
    5. Difüzyon sonrası, kapiller ucu tamamen beynin dışında olana kadar şırıngayı yavaşça geri çekin.
    6. Yaranın üzerine bir parça pamuk gazlı bez yerleştirin ve şırıngayı tuz çözeltisi ile yıkayın.
    7. Stereotaktik çerçevenin M/L-D/V kolunu çalışma alanının dışına taşıyın.
  4. Yara kapanış ve ameliyat sonrası prosedürler
    1. Sütür ipliği kullanarak kesi dikkatle sütür.
      Not: Enjekte edilen hayvanlarda kullanılan tüm dikiş ipliği, Anti-viral deterjan çözeltisi içeren bir bardak/şişede atılmalıdır. Aynı çözüm, cerrahi malzemeyle temas eden cerrahi alanı çevreleyen tüm yüzeyleri temizlemek için kullanılır. Tüm cerrahi aletler iyice yıkanır ve her cerrahi günün sonunda otoklav yapılır.
    2. Hayvan stereotaktik çerçeveden çıkarın ve temiz, ısıtmalı kafes, yiyecek ve su erişimi içeren bir post-operatif istasyona yerleştirin ve hayvan tam uyanık kadar kalır. Bu dönemde, bilinç geri gelene kadar hayvanı yakından izleyin.
    3. Eski tamamen ameliyattan kurtarıldı kadar olmayan çalışan hayvanlar ile işletilen hayvanları ev yok.
    4. Her gün çalışan hayvanları denetleyecek. Kullanılan sütürler bağlı olarak, gerekirse kaldırıldığından emin olun. Tüm hayvanlar, postoperatif bakım olarak Bupenorphinum (1ml/kg 'da Temgesiç) subkutan verildi.
      Not: Aynı şırıngayı ardışık iki günde kullanırsanız, su ile boşaltın, ardından etanol 70% ve su tekrar temizleyin. Herhangi bir olası kalıntıların dağılmasına izin vermek için şırıngayı gece boyunca suyla dolu bırakın.

3. elektrofizyolojik kayıtlar

  1. Elektrofizyoloji için doku dilim hazırlığı
    Dikkat: İyi elektrofizyolojik kayıtlar elde etmek için iyi yürütülen bir doku hazırlığı gereklidir. Dikkatle Oda hazırlayın ve buz üzerinde perfüzyon ve diseksiyon için Araçlar yerleştirin.
    1. Buz-soğuk ve oxygenized hazırlayın (95% O2 ve 5% Co2) Krebs perfüzyon, diseksiyon ve kesim için çözüm (ultra saf suda stok çözümünü seyreltilerek ve NaHCO3 ve glikoz ekleyerek 10X stoktan aynı gün hazırlamak). Krebs çözeltisi mM (1x seyreltme sonra) bileşenleri şunlardır: 126 NaCl, 2,5 KCl, 1,2 NaH2Po4· H2o, 1,3 MgCl2· 6h2o, ve 2,4 CAcl2· 6h2o, 22 NaHCO3, 10 glikoz. Çözeltinin pH değerini 7,4 olarak ayarlayın.
    2. Yeni bir razor blade ile vibratome için bir kalibrasyon (Vibracheck) gerçekleştirin.
    3. Vibratomun soğutma bloğunu başlatın (veya çevresindeki odayı buzla doldurun), kesme odasını kullanmadan önce% 95 O2 ve% 5 Co2 Ile oksijenasyon için Krebs çözeltisi ile doldurun.
    4. Buzda bir petri tabağı koyun ve oksijenlenmiş Krebs solüsyonu ile doldurun. Blade, makas ve montaj plakasını buzun üzerine yerleştirin.
      Dikkat: İklimlendirme prosedürü başlamadan önce en az 1 saat odaya fareyi içeren Kafes getirin. Stres beyin dokusu bölümlerinin durumu üzerinde olumsuz bir etkiye sahiptir.
    5. Ölümcül pentobarbital bir aşırı doz enjekte ederek fare anestezize ve hayvan uykuya düşmek izin.  Blink refleks dışarı ve hayvan ağrı uyaranlara yanıt vermezse, transcardially 2-3 dk (10-20 ml/dak hızında) için buz soğuk Krebs solüsyonu ile hayvan serpmek.
    6. Hızla, ama dikkatle, beyin dışarı sökme ve Petri içinde baş aşağı koymak-buz (Krebs çözüm içeren) yerleştirilir çanak.
      Not: Yeniden programlanmış nöronların fonksiyonel olgunlaşma karşılaştırmak için, farklı zaman noktaları Post-viral enjeksiyon kayıtlar için hayvanları feda. Mevcut literatürü temel alarak nöronların farklı alt türlerinin ateş özelliklerini değerlendir15 .
    7. Orta serebellum boyunca bir koronal kesim yapın ve vibratome kesme için montaj plakası (Ayrıca buz soğuk) üzerine bu tarafı tutkal.
    8. Yapıştırılmış beyin dikkatle vibratome tampon odasına daldırın.
      Dikkat: Kendi güvenliğiniz için jilet dokunmamaya dikkat edin ve böylece bıçak kalibre kalacaktır.
    9. Yüksek hızda striatal seviyeye aşağı beynin en rostral bölümünden kes. Daha sonra yavaş hızda (0,10 mm/s) 275 mm 'de yatay striatum kesilmiş.
    10. Her kestikten sonra, dikkatlice non-enjekte striatal tarafı (örneğin, bir saplanmış iğne ile) kaldırmak ve bir su banyosunun bir alt net (RT oksijenize Krebs) içeren su banyosunda başka bir şişe içine enjekte yan transfer. Tüm bölümler kesilinceye kadar bunu RT 'de saklayın.
    11. Su banyosunun sıcaklığını 37 °C ' ye yavaşça yükseltin ve 30 dakika boyunca bırakın. Sonra ısıtıcı kapatın ve RT kadar soğumaya bırakın.
      Not: Bu noktada, kayıt başlayana kadar duraklatabilirsiniz. Bölümler için son 4-6 h.
  2. Tam hücreli yama kelepçe kayıtları
    1. İlk doku bölümünü, sürekli bir Krebs çözeltisi akışında yer alan kayıt odasına aktarın. Işık ağırlıkları kullanarak bölümü monte edin ve amacı daldırın.
    2. Mikroskop striatal bölge tanımlamak ve GFP-pozitif (yeniden programlanmış) nöronlar için arama. Morfoloji kapsamlı bir nöron seçin ve fiber demetleri veya kan damarlarının kapsanan değil.
    3. Yama ve aşağıdaki hücre içi solüsyon ile doldurmak için borosilikat cam pipetleri (3 – 7 MΩ) hazırlayın (mM): 122,5 potasyum glukonat, 12,5 KCl, 0,2 EGTA, 10 HEPES, 2 MgATP, 0,3 na3GTP ve 8 NACL, Koh ile pH 7,3 olarak ayarlandı.
    4. Biocytin dolum için, 1 mL iç solüsyon ve Vortex için 1 mg biocytin tuz ekleyin.
      Dikkat: Bu aksi elektrot tıkanabilir gibi biocytin ile iç çözüm filtre emin olun.
    5. Cam pipeti kayıt elektrodına takın ve çözüme dalın. Elektrotın direncini iki kez kontrol edin. Sonra yavaşça pipet ile hücre yaklaşımı, ipucu takmamak için elektrot hafif bir pozitif basınç tutarak.
      Dikkat: Elektrot azalan ve hücredeki floresan çamaşır suyu değil (yani, eğer gerek yok floresan lamba kapatmak) hücre takip etmek için dikkatli olun.
    6. Çevreleyen dokusu dikkatle elektrot pozitif basınç kullanarak durulayın ve elektrot ile hücreye yaklaşın. Hücrenin üstünde elektrot sağ bulun ve elektrot membran touchd kadar iner. Elektrot ve hücre membranı arasında bir giga-Ω Seal yapın, ve negatif basınç darbeleri ile, bir bütün hücre yama oluşturmak için membran rüptürü.
      Dikkat: Yeniden programlanmış nöronlar duyarlıdır. Yama sırasında dikkatli olun ve bir giga-Ω mührü ulaştığında veya hücre zarını açarken çok fazla negatif basınç koymayın. Ayrıca, onların bağ dokusu kalın ve nöronları görselleştirmek için daha zordur gibi eski hayvanlar üzerine yama uygulama ve sabır gerektirir.
    7. Mevcut kelepçe modunda kırma sonra hemen istirahat membran potansiyelleri kontrol ve analiz için yazın.
    8. Geçerli kelepçe, arasında hücre korumak-60 mV için-80 mV ve enjekte 500 MS akımları-20 pA için + 90 pA, 10 pA artışlarla eylem potansiyelleri neden.
    9. Voltaj kelepçe içine transfer ve 10 mV depolarizan adımlarla içe sodyum ve Gecikmeli önleyici potasyum akımları ölçmek.
      Not: Voltaj-kelepçe kayıtları daha verimli membran kelepçe kimyasallardan oluşan farklı bir iç çözüm kullanılarak değerlendirilir. Ancak, yeniden programlanmış nöronlar için, kayıt yapabilirsiniz hücre sayısı az ve bu nöronlar ile doku bölümleri sayısı sınırlıdır. Bu nedenle, aynı hücreden geçerli kelepçe ve voltaj kelepçe hem de kaydetmek için bir avantajdır.
    10. Gerilim-kelepçe modunda, kayıt spontan postsinaptik aktivite at-70 mV. Bir membran potansiyeline inhibitör postsinaptik olayları ayırt 0 mV-70 mV içinde uyarıcı olaylar.
    11. İstikrarlı bir temel ulaştıktan sonra, Picrotoksin eklemek, GABAbir reseptör antagonisti, kayıt odasına akar Krebs çözüm, uyarıcı olayları ayıklamak için (son bir konsantrasyon picrotoksin bir stok çözümü eklemek 50 mm ayrı Oda perfüzyon bağlı tampon şırınga. Tamponun dış akışını, güvenli bir şekilde bertaraf etmek için odadan bir vakum çantasına bağlayın).
    12. 20 dakika sonra, (Picrotoksin gibi aynı prosedürü kullanarak) inhibitör olayları engellemek için, kayıt odasına akar Krebs çözüme CNQX (20 mM), bir AMPA antagonisti ekleyin. Başka bir 20 dakika içinde bırakın ve sonra Krebs çözüm ile yıkayın. Oda doku bölümünü çıkarın.
    13. Kayıtları bitirdikten sonra, analiz programında bir eşik-olay algılama (> 5 pA) kullanarak spontan uyarıcı sonrası sinaptik akımlar (EPSC) ve inhibitör sonrası sinaptik akımlar (ıPSC) çevrimdışı bir analiz yapın.
    14. Tüm kayıt sırasında, hücre yavaşça biocytin içeren iç solüsyon ile doldurulur. Hücrenin tam doldurma elde etmek için yavaşça elektrot çıkarmadan önce en az 20 dakika için yama tutun.
      Dikkat: Daha sonra hücrelerin ardışık morfolojik analizini yok edebilir elektrot herhangi bir olumlu basınç değil dikkatli olun.
    15. Biyosittin görselleştirme için, 4 °c ' de bir gecede% 4 civarında formaldehite (PFA) doku bölümünü koyun. 0,02 M potasyum fosfat tamponunun (KPBS) bölümünde% 0,1 Triton ile durulayın. Sonra, streptavidin-Cy3 için leke (1:600 KPBS-T, 2 h), biyosittin dolu hücre ve yeniden programlanmış neuron morfolojik görselleştirme tanımlanması için.
      Not: Biocytin dolum morfolojik analiz ve yamalı nöronların çizimler için kullanılabilir.

4. immünhistokimya, stereoloji ve ölçüme

Not: Elektrofizyoloji için kullanılan doku bölümleri immunohistokimya için en uygun değildir gibi, immünhistokimya için belirli bir fare grubunu adatın.

  1. Aşırı dozda pentobarbital bir ı.p. enjeksiyonu ile ve hayvan perfüzyon için monte etmeli fareler anestezize.
  2. Transcardially fareleri serpmek, ilk bir tuz çözeltisi ile kan kaldırmak için, ve sonra buz-soğuk ile 4% PFA.
  3. Beyin ve post-Fix en az 12 h% 4 PFA için incelemek.
  4. Yaklaşık 12 h için% 25 sakaroz çözeltisi (kriyokoruma için) beyin koyun.
    Not: Beyin, sakaroz tüm fare beyni nüfuz olduğunu belirten% 25 sakaroz solüsyonu lavabo zaman kesilmiş olmaya hazırdır.
  5. Serebellum boyunca bir koronal kesim yapmak, beyin bir mikrotome yerleştirmek ve optimum kesme sıcaklığı bileşik (OCT) kullanarak yerinde düzeltmek için beyin düz, en kaudal parçası kullanın.
  6. 35 mm kalınlığında koronal dilimleri içine beyin kesme ve şişe veya 0,02 M KPBS içeren kuyuları yerleştirilen ardışık serisi içine beyin bölmek.
  7. Standart protokoller16, 17göre, GAD65/67, PV, sohbet (Kolin asetiltransferaz) ve NPY (neuropeptid Y) gibi Gfp ve interneuron işaretçileri karşı antikorlar kullanarak immünhistokimya için bölümleri işlemek.
    Not: Beyin dilimleri uzun süre anti-Freeze çözeltisi 4 °C veya-20 °C tutulabilir.
  8. Boyama tamamlandıktan sonra, bir cam slayt üzerinde bölümler monte ve bir cam coverslip ile kapak, yerinde düzeltmek için bir montaj çözümü kullanarak. Gece boyunca kurutmak için kapak kaymaları bırakın.
    Not: Bizim çalışmalar için, tüm beyin 1:8 serisi (yani, her şişe içeren bölümler fare beyin11bir sekizinci tutacak) kesilir.
  9. Ters floresan ve/veya Konfokal mikroskop kullanarak bölümleri analiz edin.
    Dikkat: Floresan Mikroskobu sonuçları genel bir bakış ve yeniden programlama verimliliği hesaplamak için görüntüleri yakalama için yararlıdır. Çift pozitif hücrelerin gözlem ile fenotipi kimlik daha ayrıntılı bir analiz için, Konfokal görüntüleme kullanılmalıdır.
  10. Striatum içinde GFP+ nöronlar içinde ifade edilen farklı işaretçilerin ölçülme IÇIN, Gfp+ hücrelerin toplam sayısına göre çift pozitif hücrelerin sayısını saymak (yani, yeniden programlanmış nöronlar), her biri en az iki alanda striatal bölüm.
  11. Beyin başına yeniden programlanmış nöronlar yaklaşık ekstrapole toplam sayısını belirlemek için, Gfp Count+ nöronlar beyin serisinin biri striatum mevcut daha önce kesilmiş, ve sonra seri toplam sayısı ile çarpın.
    Not: Farklı ölçümleştirme yöntemleri, yeniden programlama verimliliğini, hayvan başına yeniden programlanmış nöronların sayısını ve belirli fenotipik işaretçileri ifade eden nöronların yüzdesini ifade etmek için kullanılabilir. Daha fazla bilgi için bkz: önceki yayın11.
  12. Grafik Pad Prism veya benzeri kullanarak koşullar arasındaki farklılıkları analiz edin.
    Not: Verimlilik hesaplaması için, CRE 'ye bağımlı ALN Dönüşüm vektörler ve GFP muhabiri ile NG2-CRE fareler enjekte ettik. Dönüşüm verimliliğini tahmin etmek için, tüm hedeflenen hücreler GFP+render, her yerde cba Promoter altında bir CRE BAĞıMLı Gfp ile hayvanları enjekte. Bu karşılaştırmayı kullanarak, hedeflenen hücrelerin% 66,81 ± 38,38 ' inin nöronlara dönüştürüldüğünü tahmin ettik. Genlerin her birinin ifadesinin doğrulanması için, GFP/Ascl1, GFP/Lmx1a ve GFP/Nurr1 için tamamlayıcı çift immünofluorescent-boyama yapılabilir. Ayrıca, tek hücreli RNA sıralaması gibi genom sıralaması, yeniden programlanmış hücrelerdeki genlerin her birinin varlığını ortaya çıkarabilir.

Representative Results

AAV vektörler enjeksiyon NG2-CRE fare striatum (Şekil 1a) nöronlar IÇINE yerleşik NG2 glia hücrelerini başarıyla yeniden programlamak için kullanılır. Özellikle NG2 glia hedef için, yeniden programlama/muhabir genler ile Flex vektörler, bir antisens yönde eklenir ve iki çift antiparallel, heterotypic loxp siteleri (Şekil 1B) ile çevrelenmiş. Her üç yeniden programlama genler (Ascl1, Lmx1a ve Nurr1) bireysel vektörler üzerinde her yerde cba Organizatör kontrolü altında yerleştirilir. Emin GFP ifade bir CRE-ifade hücreden kaynaklanan nöronlar yeniden programlanan sınırlıdır yapmak için, GFP nöron özel synapsin Promoter kontrolü altında yerleştirilir, (aynı zamanda bir FLEX vektör).

Yeniden programlama ve muhabir yapıları kombinasyonu kullanımı fare striatum GFP-pozitif nöronların üretimi için izin verir (Şekil 1C, C '). Gazetecinin yeniden programlama genler varlığı olmadan inşa kullanımı GFP-pozitif nöronlar vermezse (Şekil 1D).

Biocytin dolu olan yeniden programlanmış nöronlar, mortem sonrası immüno-boyama sonrası görülebilir (Şekil 2a). Dönüşüm başarılı olursa, geniş nöronal morfoloji olmalıdır. Yeniden programlanmış nöronların elektrofizyolojik kayıtları, spontan aktivite önlemleri ile postsinaptik fonksiyonel bağlantıların varlığını göstermektedir (Şekil 2B, C). Bu iyonotropik gabaergic veya glutamaterjik engelleyici ile bloke edilebilir (picrotoksin veya cnqx), yeniden programlanmış nöronlara hem uyarıcı ve inhibitör sinaptik giriş düşündürmektedir. Zaman sonrası viral enjeksiyon ile spontan aktivite artar oluşumu (Şekil 2D), kademeli bir olgunlaşma gösteren.

Fonksiyonel nöronlar mevcut akım kaynaklı eylem potansiyelleri vardır. Eylem potansiyelleri, dönüşümden sonra zaman içinde sayı artışı (Şekil 2E). Bu daha da nöronal fonksiyon olgunlaşma gösterir. Olgunlaşmamış bir nöron, akım ya hiçbiri veya çok az eylem potansiyelleri (Şekil 2F) teşvik edecektir.

Bir nöron tetikleme kalıpları hücre türü spesifik olarak hücreler ve kanal ifadesi15morfoloji gibi faktörlere bağlıdır. İn vivo yeniden programlanmış nöronların içinde kaydedilen desenler gruplara ayırt edilebilir ve endojen nöronal alt tiplere kıyasla, örneğin hızlı spiking internöronlar (hücre tipi B, Şekil 3B) veya diğer hücre tipleri (Şekil 3A, C, D ). Gözlenen elektrofizyolojik farklar belirli alt tip işaretçileri ve GFP ile ortak ifade varlığı ile teyit edilebilir (Şekil 3E-H). Tamamen, bu veriler striatum içinde mevcut yeniden programlanmış nöronların, parvalbumin-, sohbet-ve NPY-interneurons, yanı sıra striatal orta dikenli nöron kimlik (DARPP32 +) gibi farklı türde interneurons özellikleri var olduğunu gösterir ( Şekil 3E -H).

Figure 1
Şekil 1: in vivo yeniden programlama NG2 glia nöron içine. (A) STRIATAL NG2 glia 'nın vivo yeniden programlanması için AAV virüsü aracılı şematik temsili. (B) Gen ifadesinin hedeflenen hücrelerdeki CRE ifadesiyle düzenlendiği, in vivo yeniden programlama IÇIN kullanılan AAV5 Flex yapılarından oluşan şematik temsili. (C ve c ') In vivo yeniden programlanmış nöronlar, SYN-Gfp kaynaklanan + striatum içine aln enjeksiyon. (D) yeniden programlanmış nöronların olmaması, viral kokteyllere hiçbir yeniden programlama faktörü eklediyseniz ve sadece muhabir yapı içinde vivo enjekte edilir. Ölçek çubukları = 100 mm (C), 25 mm (C '), 25 mm (D). Bu figürün daha büyük bir versiyonunu görmek Için lütfen tıklayınız.

Figure 2
Şekil 2: In vivo yeniden programlanmış nöronlar fonksiyonel ve zamanla olgunlaşma gösterir. (A) biocytin dolu yeniden programlanmış nöron, Olgun nöronal morfoloji gösterir, dendritik sinler dahil. İzleri gösterir (B) Inhibitör (GABAergic) picrotoksin ile engellenen aktivite, bir GABA reseptör antagonisti ve (C) cnqx Ile engellenen uyarıcı aktivite, bir AMPA reseptör antagonisti. (D) postsinaptik aktivite ile nöronların sayısı zaman içinde artar. (E) yamalı nöronlar zaten 5 hafta sonrası enjeksiyon (w.p.i.) zaten tekrarlayan ateş göstermek ve 8 ve 12 W.p.i. (F) geçerli kaynaklı eylem potansiyeli ve olgunlaşmamış bir nöron postsinaptik aktivite göstermeye devam, birkaç sinaptik gösteren olaylar ve B ve D. ölçek çubuğuna kıyasla birkaç eylem potansiyelleri = 25 mm Bu rakam daha büyük bir sürümünü görüntülemek Için lütfen buraya tıklayın.

Figure 3
Şekil 3: In vivo yeniden programlanmış nöronlar, striatal internöronların immünhistokimyasal ve elektrofizyolojik özelliklerini gösterir. (A-D) In vivo yeniden programlanmış nöronların ateş kalıpları farklı türden olabilir: (a) tip a endojen orta dikenli nöron benzer (DARPP32 +); (B) hızlı SPIKING (PV +) interneurons benzer; (C) düşük eşik olarak belirgin sag (NPY +) ile nöronlar spiking benzer; (D) nöronlar büyük sonra hiperpolarizasyon (chat +) ile ateş. (E-H) GFP 'nin ortak lokalizasyonu ve PV (E), sohbet (F), NPY (G) ve projeksiyon nöron Marker DARPP32 (H) gibi interneuron belirteçleri gösteren Konfokal görüntüler. Tüm ölçek çubukları = 50 mm. Bu rakam daha büyük bir sürümünü görüntülemek Için lütfen buraya tıklayın .

Discussion

In vivo doğrudan yeniden programlama CRE-fare suşları ifade AAV FLEX vektörler kullanılarak elde edilebilir. Yeniden programlama etkinliğine ilişkin fare suşları arasındaki farklılıkların gözlendiği dikkate alınmalıdır. Striatum içinde vivo yeniden programlama için, NG2-CRE fare hattı diğer suşları ile karşılaştırıldığında daha verimli olduğu kanıtlanmıştır. Yeni bir hayvan gerinim kullanmaya başlamadan önce, hayvanların yaşı genellikle bu protein ifadesinin özgüllüğünü etkilediği için, zaman içinde CRE ifadesi ile ilgili fare sağlayıcı kurallarını kontrol etmek önemlidir. NG2 glia dışındaki hücrelerde CRE ifadesi için bir risk olduğu için çalışmalarda, 12 haftadan büyük hayvanlar in vivo yeniden programlama için kullanılmadı. Sadece Synapsin-FLEX-GFP yapı ile enjekte kontrol hayvanların sürekli varlığı ve izlenmesi tavsiye edilir. Bu, hiçbir yeniden programlama genleri (ALN) kullanılırsa, mevcut olmamalıdır GFP-pozitif hücreler için hayvanların izlenmesi sağlar.

Yeni yeniden programlanmış nöronlar tanımlamak için, bu protokolde açıklanan bir neuron-specific tanımlama yöntemi çok önemlidir. Bu, bir Homotopik bölgede yeniden programlama yaparken, özellikle alaka düzeyi olan endojen çevreleyen hücrelerden yeniden programlanmış nöronların uygun bir şekilde tanımlanması ve ayırt edilmesini sağlar.

Viral enjeksiyon için doğru yapıyı hedeflemek de önemlidir. Bu nedenle, viral enjeksiyon için stereotaktik cerrahi önemlidir ve özellikle beynin küçük yapılarını hedeflerken, doğruluk ile yaklaşmak gerekir.

Daha önce de aynı yeniden programlama faktörleri kullanarak in vitro yeniden programlama deneylerine dayanan in vivo yeniden programlama sonucunu tahmin etmek için güvenilir olmadığını11 göstermiştir. Bu nedenle tüm ilgi faktörleri in vivo olarak test edilmesi gerekir. Bizim ellerimizde, pek çok farklı faktör kombinasyonu, bu genlerin diğer nöronların gelişimine bağlı olmasına rağmen, aynı nöronların alt tipini (yani,11 in vivo interneurons) verir.

Yeniden programlanmış nöronlar için tam hücreli yama kelepçe hassas bir tekniktir ve doku işleme iyi bir sonuç için önemlidir. Buz gibi soğuk Krebs çözeltisi ile perfüzyon doku kalitesini arttırır. Ayrıca, yamalı nöronların dikkatle tedavi edilmesi gerekir. Yeniden programlanmış nöronlar olgunlaşma ve fenotipi kimlik biraz tüm hücreli yama kelepçe kullanılarak değerlendirilebilir olsa bile, bu hücreler tamamen onların endojen meslektaşları ile karşılaştırılabilir değildir. Yeniden programlanmış hücre kimliğini daha fazla onaylamak için genom sıralaması (örn. RNA sıralaması) gibi ek analiz türleri kullanılmalıdır.

Burada açıklanan teknik, nöronal değişimin beyinde gerekli olduğu gelecekteki tedavilerin gelişimi için düşünülebilir. In vivo yeniden programlama hala erken aşamalarında ve insanlara çeviri henüz öngörülmüştür rağmen, bu teknik, beyin ve çalışma hücresi olgunlaşma in vivo eksojen gen fonksiyonunu değerlendirmek için bir yöntem sağlayabilir.

Disclosures

Yazarların ifşa etmesi gereken hiçbir şey yok.

Acknowledgments

Marcella birtele Avrupa Birliği Horizon 2020 programı (H2020-MSCA-ıTN-2015) tarafından Marie Skłodowska-Curie yenilikçi eğitim ağları ve Grant Sözleşmesi No. 676408 altında finanse edilmiştir. Daniella Rylander Ottosson Isveç Araştırma Konseyi (2017-01234) tarafından finanse edilmiştir.

Materials

Name Company Catalog Number Comments
REAGENTS FOR AAV5 CLONING AND VIRAL VECTOR PREPARATION
pAAV-CA-FLEX AddGene 38042
Ascl1 AddGene 67291 NM_008553.4
Lmx1a AddGene 33013 NM_0033652.5
Nurr1 AddGene 35000 NM_013613.2
GFP-syn AddGene 30456
LoxP (FLEX) sequence 1 GATCTccataacttcgtataaagtatcctatac
gaagttatatcaaaataggaagaccaatgcttc
accatcgacccgaattgccaagcatcaccatcg
acccataacttcgtataatgtatgctatacgaa
gttatactagtcccgggaaggcgaagacgcgga
agaggctctaga
LoxP (FLEX) sequences 2 tactagtataacttcgtataggatactttatac
gaagttatcattgggattcttcctattttgatc
caagcatcaccatcgaccctctagtccacatct
caccatcgacccataacttcgtatagcatacat
tatacgaagttatgtccctcgaagaggttcgaa
ttcgtttaaacGGTACCCTCGAC
pDP5 Plasmid Factory PF435
pDP6 Plasmid Factory PF436
Phosphate-Buffered Saline (PBS) Thermo Fisher Scientific 10010023
FBS (Fetal bovine serum) Thermo Fisher Scientific 10500064
Penicillin streptomycin Thermo Fisher Scientific 15140122
DMEM (Dulbecco's Modified Eagle Medium)+ Glutamax Thermo Fisher Scientific 61965026
DPBS (Dulbecco's Phosphate Buffer Saline) Thermo Fisher Scientific 14190094
HEK293 cells Thermo Fisher Scientific 85120602-1VL
Flasks BD Falcon 10078780 175 cm2
Tris H-CL Sigma Aldrich 10812846001 For TE buffer use 10 mM, pH 8.0; for lysis buffer use 50mM, pH 8.5; for IE buffer use 20 mM, pH 8.0; for elution buffer use 20 mM, pH 8.0
EDTA EDTA: Invitrogen EDTA: AM9260G For TE buffer use 1 mM EDTA
Ultrapure water see Ultrapure water system
CaCl2 SigmaAldrich C5080 2.5 M
Dulbecco´s phosphate-buffered saline (DPBS) Thermo Fisher Scientific 14190136
NaCl Sigma-Aldrich S3014 FOR HBS use 140 mM; for Lysis Buffer use 150 mM; for IE buffer use 15 mM; for elution buffer use 250 mM
MgCl2 Sigma-Aldrich M8266-100G For lysis Buffer: 1 mM
Ultracentrifuge sealing tubes Beckman Coulter Quick-Seal® Polypropylene Tube
OptiPrep™ Density Gradient Medium Sigma Aldrich D1556-250ML
10-mL syringe-18G needle BD 305064
Laboratory glass bottles VWR ?
Anion exchange filter PALL laboratory MSTG25Q6 Acrodisc unit with Mustang Q membrane
Centrifugal filter unit Merck Z740210-24EA Amicon Ultra-4 device
Endotoxin-Free Plasmid DNA Isolation Kits Thermo Fisher Scientific A33073
Na2PO4 Sigma-Aldrich S7907
HEPES Sigma-Aldrich H7523 15 mL
Falcon tube Thermo Fisher Scientific Corning 352196
Falcon tube Thermo Fisher Scientific Corning 352070
Glass Vials Novatech 30209-1232 CGGCCTCAGFGAGCGA
Forward Primer for Inverted Terminal Repeat (ITR) sequence GGAACCCCTAGTGATGGAGTT
Reverse Primer for Inverted Terminal Repeat (ITR) sequence CACTCCCTCTCTGCGCGCTCG
5´FAM / 3´BHQ1 probe Jena Bioscience
0.22 mm filter Merck SLGV004SL Millex-GV filter
EQUIPMENT AAV5 VIRAL VECTOR PREPARATION
Freezer -20 °C
Freezer -80 °C
Fridge +4 °C
AAV viral room
Ultrapure Water system Merck Milli-Q® IQ 7000
Vortex mixer VWR 444-0004
Ultracentrifuge Beckman Coulter Beckman Optima LE-80K Ultracentrifuge
Autoclave Tuttnauer 2540 EL
Polymerase Chain Reaction (PCR) BioRad C1000 Touch Thermal Cycler
Quantitative PCR (qPCR) Roche LightCycler® 480 System
Centrifuge Thermo Fisher Scientific Sorvall ST16
Water Bath Thermo Fisher Scientific TSGP02
ANIMAL MODEL
NG2-Cre mice Jackson NG2-CrexB6129, Stock #008533
REAGENTS FOR INJECTION OF REPROGRAMMING FACTORS INTO THE BRAIN
Water
Saline Apoteket AB 70%
Ethanol Solveco
Isolfurane Apoteket AB Dilute to 1% solution with warm water.
Virkon Viroderm 7511 
Pentobarbital Apoteket AB P0500000 i.p. for terminal procedure at the dose of 60 mg/ml.
Sucrose Merck S0389-500G
Trypan Blu Thermo Fisher Scientific 15250061
Retrobeads Lumafluor R170
Buprenorphine Apoteket AB
EQUIPMENT FOR INJECTION OF REPROGRAMMING FACTORS INTO THE BRAIN From RSG Solingen.
Scissors VWR 233-1552 From Biochem.
Tweezers VWR 232-0007
Forcep VWR 232-0120
Scalpel holder VWR RSGA106.621 Number 20.
Scalpel VWR RSGA106.200
Stereotaxic frame Stoelting Europe 51500D
Mouse ear bars Stoelting Europe 51648 5 ul
Syringe with Removable needle Hamilton Company 65 0,75 inner diameter and 1.5 outer diameter.
Glass capilaries Stoelting 50811
Glass capillary puller Sutter company P-1000
Dental drill Agnthos AB 1464
Shaver Agnthos AB GT420
Isoflurane Chamber and pump Agnthos AB 8323101 2 mL
Syringes Merck Z118400-30EA 25G
Needles Merck Z192414 Aldrich
Mouse and neonatal rat adaptor for stereotaxic fram Stoelting 51625
Heating pad Braintree scientific, inc 53800M From Covidien 2187.
Cotton gauze Fisher Scientific 22-037-902
Rubber tube Elfa Distrelec HFT-A-9.5/4.8 PO-X BK 150
Cotton swabs Fisher Scientific 18-366-473
REAGENTS FOR WHOLE-CELL PATCH CLAMP RECORDINGS
NaCl Sigma-Aldrich S3014
KCl Sigma-Aldrich P9333
NaH2PO4-H2O Sigma-Aldrich S9638
MgCl2-6 H2O Sigma-Aldrich M2670
CaCl2-6 H2O Sigma-Aldrich C8106
MgSO4-7 H2O Sigma-Aldrich 230391
NaHCO3 Sigma-Aldrich S5761
Glucose Sigma-Aldrich G7021 see Ultrapure Water system
Ultrapure Water Prepare 1 or 2M.
KOH Sigma-Aldrich P5958-500G
K-D-gluconate Sigma-Aldrich G4500 Sigma
KCl Sigma-Aldrich P9541
KOH-EGTA (Etilene glycol-bis-N-tetracetic acid) Sigma-Aldrich E3889 Sigma
KOH- Hepes acid (N-2-hydroxyethylpiperazine-N’-2-ethanesulfonic acid) Sigma-Aldrich H7523
NaCl Sigma-Aldrich S3014
Mg2ATP Sigma-Aldrich A9187
Na3GTP Sigma-Aldrich G8877
Biocytin Sigma-Aldrich B4261
Picrotoxin Merck P1675 Sigma
CNQX Merck C239 Sigma
Ice
EQUIPMENT FOR WHOLE-CELL PATCH CLAMP RECORDINGS
Borosilicate glass pipette Sutter Company B150-86-10
Glass capillary puller Sutter company P-1000
Vibratome Leica Leica VT1000 S
WaterBath Thermo Fisher Scientific TSGP02
Clampfit software Molecular Devices
Multiclamp software Molecular Devices
REAGENTS FOR IMMUNOHISTOCHEMISTRY Use at a concentration of 4%. CAUTION: PFA is a potent fixative. Avoid ingestion and contact with skin.
Paraformaldehyde (PFA) Merck Millipore 1040051000 Use at a concentration of 0.1%.
Triton X-100 Fisher Scientific 10254640 Donkey.Use at a concentration of 1 : 400.
Serum Merck Millipore S30-100ML Reconstitute the powder in Milli-Q water to 1 mg/mL. Aliquot and store at -20°C, light sensitive. Use at a concentration of 1 : 500.
4′,6-Diamidino-2′-phenylindole dihydrochloride (DAPI) Sigma Aldrich D9542 1: 600 in KPBS-T.
streptavidin- Cy3 Thermo Fisher Scientific 434315 1:5000, rabbit.
Anti-GAD65/67 Abcam 1:2000, mouse.
Anti-PV Sigma P3088 1:200, goat.
Anti-Chat Merk AB143 1:5000, rabbit.
Anti-NPY Immunostar 22940
K2HPO4 Sigma-Aldrich P3786
NaCl Sigma-Aldrich S3014
KH2PO4 Sigma-Aldrich NIST200B 1:1000, chicken.
Anti-GFP Abcam ab13970
Mounting solution Merck 10981 Polyvinyl alcohol mounting medium with DABCO®, antifading
OCT Agar Scientific
Glycerol Sigma-Aldrich G9012-100ML
Distilled water
Anti-freeze solution Tissue Pro Technology AFS05-1000N, 1000 mL/ea.
EQUIPMENT FOR IMMUNOHISTOCHEMISTRY
Inverted fluorescence microscope Leica DMI6000 B
Confocal microscope Leica TCS SP8 laser scanning confocal microscope.
Prism GraphPad
Microtome Leica SM2010R

DOWNLOAD MATERIALS LIST

References

  1. Barker, R. A., Parmar, M., Studer, L., Takahashi, J. Human Trials of Stem Cell-Derived Dopamine Neurons for Parkinson's Disease: Dawn of a New Era. Cell Stem Cell. 21, (5), 569-573 (2017).
  2. Southwell, D. G., et al. Interneurons from embryonic development to cell-based therapy. Science. 344, (6180), 1240622 (2014).
  3. Parmar, M., Torper, O., Drouin-Ouellet, J. Cell-based therapy for Parkinson's disease: A journey through decades toward the light side of the Force. European Journal of Neuroscience. (2018).
  4. Torper, O., et al. In Vivo Reprogramming of Striatal NG2 Glia into Functional Neurons that Integrate into Local Host Circuitry. Cell Reports. 12, (3), 474-481 (2015).
  5. Su, Z., Niu, W., Liu, M. L., Zou, Y., Zhang, C. L. In vivo conversion of astrocytes to neurons in the injured adult spinal cord. Nature Communication. 5, 3338 (2014).
  6. Liu, Y., et al. Ascl1 Converts Dorsal Midbrain Astrocytes into Functional Neurons In Vivo. Journal of Neuroscience. 35, (25), 9336-9355 (2015).
  7. Guo, Z., et al. In vivo direct reprogramming of reactive glial cells into functional neurons after brain injury and in an Alzheimer's disease model. Cell Stem Cell. 14, (2), 188-202 (2014).
  8. Grande, A., et al. Environmental impact on direct neuronal reprogramming in vivo in the adult brain. Nature Communication. 4, 2373 (2013).
  9. Niu, W., et al. In vivo reprogramming of astrocytes to neuroblasts in the adult brain. Nature Cell Biology. 15, (10), 1164-1175 (2013).
  10. Weinberg, M. S., Criswell, H. E., Powell, S. K., Bhatt, A. P., McCown, T. J. Viral Vector Reprogramming of Adult Resident Striatal Oligodendrocytes into Functional Neurons. Molecular Therapy. 25, (4), 928-934 (2017).
  11. Pereira, M., et al. Direct Reprogramming of Resident NG2 Glia into Neurons with Properties of Fast-Spiking Parvalbumin-Containing Interneurons. Stem Cell Reports. 9, (3), 742-751 (2017).
  12. Rivetti di Val Cervo, P., et al. Induction of functional dopamine neurons from human astrocytes in vitro and mouse astrocytes in a Parkinson's disease model. Nature Biotechnology. 35, (5), 444-452 (2017).
  13. Crosson, S. M., Dib, P., Smith, J. K., Zolotukhin, S. Helper-free Production of Laboratory Grade AAV and Purification by Iodixanol Density Gradient Centrifugation. Molecular Therapy Methods & Clinial Development. 10, 1-7 (2018).
  14. Torper, O., et al. Generation of induced neurons via direct conversion in vivo. Proceedings of the National Academy of Sciences of the United States of America. 110, (17), 7038-7043 (2013).
  15. Kawaguchi, Y., Kubota, Y. Correlation of physiological subgroupings of nonpyramidal cells with parvalbumin- and calbindinD28k-immunoreactive neurons in layer V of rat frontal cortex. Journal of Neurophysiology. 70, (1), 387-396 (1993).
  16. Grealish, S., et al. The A9 dopamine neuron component in grafts of ventral mesencephalon is an important determinant for recovery of motor function in a rat model of Parkinson's disease. Brain. 133, (Pt 2), 482-495 (2010).
  17. Thompson, L., Barraud, P., Andersson, E., Kirik, D., Bjorklund, A. Identification of dopaminergic neurons of nigral and ventral tegmental area subtypes in grafts of fetal ventral mesencephalon based on cell morphology, protein expression, and efferent projections. Journal of Neuroscience. 25, (27), 6467-6477 (2005).
In vivo doğrudan reprogramming Resident glial hücreler Interneurons viral vektörler ıntracerebral enjeksiyon ile
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Pereira, M., Birtele, M., Rylander Ottosson, D. In Vivo Direct Reprogramming of Resident Glial Cells into Interneurons by Intracerebral Injection of Viral Vectors. J. Vis. Exp. (148), e59465, doi:10.3791/59465 (2019).More

Pereira, M., Birtele, M., Rylander Ottosson, D. In Vivo Direct Reprogramming of Resident Glial Cells into Interneurons by Intracerebral Injection of Viral Vectors. J. Vis. Exp. (148), e59465, doi:10.3791/59465 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter