Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Les lymphocytes T T spécifiques à la cellule souche s'amedisent à supprimer la réplication du VHB chez les souris

doi: 10.3791/60043 Published: September 25, 2019

Summary

Présenté ici est un protocole pour la suppression efficace de la réplication du virus de l'hépatite B (HBV) chez les souris en utilisant le transfert de cellules adoptives (ACT) de cellules souches dérivées des lymphocytes T spécifiques à l'antigène viral (Ag). Cette procédure peut être adaptée pour l'immunothérapie act-basée potentielle de l'infection de HBV.

Abstract

L'infection par le virus de l'hépatite B (VHB) est un problème de santé mondial. Avec plus de 350 millions de personnes touchées dans le monde, l'infection par le VHB demeure la principale cause de cancer du foie. Il s'agit d'une préoccupation majeure, en particulier dans les pays en développement. L'échec du système immunitaire à monter une réponse efficace contre le VHB conduit à une infection chronique. Bien que le vaccin contre le VHB soit présent et que de nouveaux médicaments antiviraux soient créés, l'éradication des cellules de réservoir de virus demeure un sujet de santé majeur. Décrit ici est une méthode pour la génération de l'antigène viral (Ag) -spécifiques CD8- lymphocytes T cytotoxiques (CTLs) dérivés de cellules souches pluripotentes induites (iPSC) (c.-à-d., iPSC-CTLs), qui ont la capacité de supprimer la réplication du VHB. La réplication du VHB est efficacement induite chez la souris par injection hydrodynamique d'un plasmide d'expression HBV, pAAV/HBV1.2, dans le foie. Ensuite, hBV surface Ag-spécifique souris iPSC-CTLs sont transférés d'adoption, ce qui supprime considérablement la réplication du VHB dans le foie et le sang ainsi que empêche l'expression HBV surface Ag dans les hépatocytes. Cette méthode démontre la réplication du VHB chez les souris après injection hydrodynamique et que les CTL viraux dérivés de cellules souches peuvent supprimer la réplication du VHB. Ce protocole fournit une méthode utile pour l'immunothérapie de HBV.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

À la suite d'une infection aigue, le système immunitaire adaptatif (c.-à-d. l'immunité humoristique et cellulaire) contrôle la majeure partie de l'hépatite aigue liée au VHB. Pourtant, un certain nombre de personnes dans les régions où le VHB est endémique ne peuvent pas éliminer les virus et se convertir par la suite en tant qu'individus chroniques. Plus de 25 % des patients chroniques (250 millions de personnes dans le monde) développent une maladie hépatique progressive, entraînant une cirrhose du foie et/ou un carcinome hépatocellulaire (HCC)1. En conséquence, l'éradication des cellules infectées avec insistance reste un problème de santé générale, même s'il existe un vaccin2 disponible et de nombreux médicaments antiviraux sont en cours de développement. Le traitement standard de l'infection par le VHB comprend les analogues ifN-MD, nucléoside et nucléotide. Ces agents ont une activité antivirale directe et des capacités modulatrices immunitaires. Néanmoins, la séroconversion de l'antigène HBe (Ag)- porteurs avec anticorps anti-HBe (Ab) et la perte de sérum HBV acide désoxyribonucléique (ADN) apparaissent individuellement dans environ 20% des patients traités, et le contrôle immunologique entier du virus par la privation de la HBsAg n'est pas plus de 5%3. En outre, la réponse au traitement n'est souvent pas durable. La vaccination prophylactique avec les HBs Recombinants Ag est très efficace dans la prévention de l'infection, mais la vaccination thérapeutique HBs Ag n'est pas efficace. De toute évidence, les réponses immunitaires à médiation cellulaire T jouent un rôle essentiel dans le contrôle de l'infection par le VHB et de l'altération du foie; cependant, dans les patients chroniques d'hépatite, les cellules T HBV-réactives sont souvent supprimées, dysfonctionnelles, ou convertissentépuisé4,5,6. Par conséquent, chez les personnes atteintes d'une infection persistante au VHB, aucune tentative de rétablir l'immunité spécifique au VHB (c.-à-d. l'immunité à base de lymphocytes T) au moyen d'un remède antiviral, de cytokines immunomodulateurs ou d'immunisation curative n'a été efficace.

Le transfert de cellules adoptives (ACT) des lymphocytes T HBV Ag-spécifiques est un traitement efficace visant à éradiquer éventuellement les hépatocytes restants wih HBV7,8. L'ACT des CTL HBV-spécifiques dans les souris HBV-infectées a été montrée pour causer l'hépatite transitoire et douce, et une baisse dramatique des transcriptions d'acide ribonucléique de HBV (ARN) dans des hépatocytes. Dans ces études, les CTL n'ont pas inhibé la transcription des gènes du VHB, mais ont amélioré la dégradation des transcriptions du VHB9. Les CTL spécifiques au VHB sont importants pour prévenir l'infection virale et pour établir une médiation dans le déminage du VHB10,11. Pour les remèdes à base d'ACT, l'expansion in vitro des lymphocytes T spécifiques au VHB avec une forte réactivité pour la réinstallation in vivo a été suggérée comme une méthode idéale12,13,14; néanmoins, les approches actuelles sont limitées en ce qui concerne leurs capacités à générer, séparer et cultiver des quantités et des qualités appropriées de lymphocytes T spécifiques au VHB des patients pour les thérapies potentielles.

Bien que les essais cliniques présentent l'innocuité, la praticabilité et l'activité thérapeutique prospective des traitements à base de cellules au moyen de lymphocytes T conçus qui sont spécifiques aux hépatocytes infectés par le virus Du VHB, on s'inquiète des effets défavorables. se produisant des réponses autoimmunes en raison de la réactivité croisée du récepteur de cellule T de mauvais désespoir (TCR)15,16, reconnaissance hors cible d'Ag par TCR17 non spécifique et sur-cible hors-toxicité par un récepteur chimérique d'Ag (CAR) 18 ans, états-unis qui , 19 avec des tissus sains. Actuellement, les lymphocytes T génétiquement modifiés, qui n'ont qu'une persistance in vivo à court terme, sont généralement des lymphocytes T intermédiaires ou plus tard effecteurs. À ce jour, les cellules souches pluripotentes (CSP) sont la seule source disponible pour générer un grand nombre de cellules T naïves de type uniqueAg-spécifique 20,21,22,23. Les CSP induits (iPSC) sont simplement convertis à partir des cellules somatiques d'un patient grâce à l'utilisation de la transduction génique de plusieurs facteurs de transcription. En conséquence, les iPSC ont des caractéristiques similaires à celles des cellules souches embryonnaires (ESC)24. En raison de la flexibilité et de la possibilité pour la capacité infinie de se renouveler, en plus du remplacement de tissu, les traitements iPSC-basés peuvent être largement appliqués dans la médecine régénérative. En outre, les régiments sous-jacents iPSCs peuvent considérablement améliorer les thérapies cellulaires actuelles.

L'objectif global de cette méthode est de générer une grande quantité de CTL spécifiques au VHB à partir d'iPSC (c.-à-d. iPSC-CTL) pour l'immunothérapie à base d'ACT. Les avantages par rapport aux techniques alternatives sont que les iPSC-CTL spécifiques au VHB ont un tCR de type unique et un phénotype naïf, ce qui entraîne un développement plus de cellules T de mémoire après l'ACT. Il est démontré que l'ACT des iPSC-CTL spécifiques au VHB augmente la migration des cellules Fonctionnelles CD8et T dans le foie et réduit la réplication du VHB dans le foie et le sang des souris administrées. Cette méthode révèle une utilisation potentielle de l'iPSC-CTL virale spécifique à l'Ag pour l'immunothérapie du VHB et peut être adaptée pour générer d'autres cellules virales spécifiques à l'iPSC-T pour l'immunothérapie virale.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Toutes les expériences sur les animaux sont approuvées par le Texas A -amp;M University Animal Care Committee (IACUC; #2018-0006) et sont menées conformément aux lignes directrices de l'Association for the Assessment and Accreditation of Laboratory Animal Care. Les souris sont utilisées pendant l'âge de 6 à 9 semaines.

1. Génération de cellules virales Spécifiques à l'Ag CD8et T à partir d'iPSC (iPSC-CD8et lymphocytes T)

  1. Création des constructions rétrovirales
    REMARQUE : Les gènes TCR et MD sont liés à la séquence d'auto-cleaving 2A. Le vecteur rétroviral MSCV-IRES-DsRed (MiDR) est DsRed23 .
    1. Sous-clone HBs183-191 (FLLTRILTI)-spécifique A2-restricted human-murine hybride TCR (s183 TCR) gènes (V 34 et V -28) dans le MiDR pour créer la construction S183 MiDR (Figure 1A)25.
  2. Transduction rétrovirale
    REMARQUE : Les cellules Platinum-E (Plat-E) sont utilisées pour l'emballage des rétrovirus (porteurs de gènes TCR s183), qui seront utilisés pour la transduction rétrovirale. Les cellules De Plat-E sont des cellules d'emballage rétrovirus efficaces sous-jacentes aux cellules 293T, qui ont été développées au moyen de constructions d'emballage uniques par l'intermédiaire du promoteur EF1MD pour exprimer la protéine rétrovirale de structure, y compris le bâillon, le pol, et l'env écotropique.
    1. Sur un plat de culture de 100 mm, graines 3 x 106 cellules De plat-E dans 8 ml de milieu de culture DMEM contenant 10 % de sérum fœtal de veau (FCS) dans un incubateur à 37 oC avec 5 % de CO2, 1 jour avant la transfection.
    2. Le jour 0, transfect le S183 MiDR construire dans les cellules Plat-E à l'aide d'un réactif de transfection de l'ADN25.
    3. Le jour 1, graines 1 x 106 iPSC (GFP) dans une plaque de culture pré-enrobée de gélatine.
    4. Les jours 2 à 3, collectez des supernatants contenant des rétrovirus de la culture cellulaire De Plat-E pour transduire les iPSC avec le TCR s183 en présence de la solution 1,6-dibromohexane25.
    5. Le jour 4, trypsiniser les iPSC transducés par les gènes TCR s183, centrifugeuse à 400 x g pour 5 min et graines 3 à 105 iPSC dans un plat de culture de 100 mm pré-enduit de 3 x 106 SNL76/7 irradiés (irSNL76/7) cellules d'alimentation25.
    6. Le jour 5 ou 6 de la confluence, trypsiniser les cellules, centrifugeuse à 400 x g pendant 5 min et traiter pour le tri cellulaire. Gating sur les cellules vivantes, trier les cellules GFP et DsRED à double positif (les iPSC transduscés par les gènes S183 TCR) à l'aide d'un trieur de cellules à grande vitesse. Semblable à l'étape 1.2.5, co-culture des cellules triées sur irSNL76/7 cellules d'alimentation pour une utilisation future25.
  3. Différenciation des cellules iPSC-CD8 spécifiques au VHB
    REMARQUE : Les cellules stromales OP9-DL1/DL4 surexpriment à la fois les ligands Notch DL1 et DL4, et les iPSC co-culturisants avec les iPSC peuvent promouvoir la différenciation des lymphocytes T à médiation Notch26.
    1. Cultivez s183 iPSC s183 transduced gène TCR (s183/iPSCs) dans la monocouche de cellules OP9-DL1-DL4 dans le milieu essentiel -minimum (MEM) média contenant 20% de sérum bovin fœtal (FBS)27. Inclure le ligand flt3 murine (mFlt-3L; concentration finale de 5 ng/mL) dans la culture.
    2. Le jour 0, graines 0,5 à 1,0 x 105 S183/iPSC dans un plat de culture de 10 cm précédemment cultivé avec des cellules OP9-DL1-DL4. Validez que les cellules OP9-DL1-DL4 sont dans un état de confluence de 80% à 90%.
    3. Le jour 5, rincez les iPSC avec 10 ml de saline tamponnée de phosphate (PBS), aspirez au PBS, ajoutez ceci à 4 ml de trypsine de 0,25%, et incubez dans un incubateur de 37 oC pendant 10 min. Par la suite, ajoutez un supplément de 8 ml de support iPSC pour mettre fin à la digestion de la trypsine. Accumuler toutes les solutions digestives contenant les cellules et centrifugeuse à 400 x g pendant 5 min à 15-30 oC.
    4. Aspirez les cellules supernatant et resuspend dans 10 mL de médias iPSC. Transférer la suspension cellulaire dans une nouvelle plaque Petri de 10 cm et couver dans un incubateur pendant 30 min à 37 oC.
    5. Après 30 min, collectez le support iPSC contenant les cellules flottantes. Passez la suspension cellulaire à travers une passoire cellulaire de 70 m et calculez le numéro de la cellule.
    6. Seed 5 x 105 cellules dans le plat de culture précédemment cultivé OP9-DL1-DL4 cellules avec une condition de 80%-90% confluent tel que décrit à l'étape 1.3.1.
      REMARQUE : Pour la différenciation des lymphocytes T, tous les deux jours et 3 jours, les cellules dérivées de l'iPSC doivent semer à nouveau avec une nouvelle couche des cellules OP9-DL1-DL4.
  4. évaluation
    1. Changements morphologiques de différenciage des iPSC
      1. Observez les cellules au microscope sur plusieurs jours.
        REMARQUE : Au jour 5, les colonies ont des caractéristiques de mesoderm-comme, présentant une morphologie classique de fuseau-forme ressemblant aux fibroblastes dermiques humains et à la croissance soutenue in vitro. Au jour 8, de petits groupes ronds de cellules commencent à apparaître.
    2. Analyse de la différencié des iPSC par cytométrie de flux
      1. Lors de divers jours de co-culture, analyser les cellules dérivées de l'iPSC telles que décrites précédemment25 (Figure 1B,C).
    3. Analyse fonctionnelle des iPSC différenciants
      1. Le jour 28 de la co-culture, collecter les cellules iPSC-CD8et T des cultures en récoltant les cellules flottantes, trypsiniser les cellules restantes avec 0,25% de trypsine, re-suspendre dans 8 mL de support iPSC, centrifugeuse pendant 5 min à 400 x g à 15-30 oC, enlever le support, puis resuspendre les cellules dans 10 ml de support.
      2. Conserver les cellules rechargées dans un plat frais de 10 cm dans un incubateur de 37 oC pendant 30 min et assembler les cellules flottantes. Puis rincer les cellules une fois avec un PBS froid.
      3. Incubate 3 x 106 splenocytes appauvris par les lymphocytes T (CD4-CD8-) à partir de rates de H-2 de classe I, HLA-A2.1-transgénique (HHD) souris avec 5 m 183 peptide (FLLTRILTI) dans 200 'L de médias à 4 'C pour 30 min.
      4. Produire un mélange de cellules iPSC-CD8et T avec des splenocytes pulsés avec du peptide s183 (cellules T : splenocytes 1:4; utiliser 0,75 x 106 lymphocytes T). Incuber le mélange de cellules à 37 oC dans un incubateur de CO2 pendant 40 h. Au cours des 7 dernières heures, ajouter 4 l de brefeldin A dilué dans la culture (concentration finale de 1000x, qui sera diluée dans 1x culture media) pour bloquer les processus de transport lors de l'activation cellulaire.
      5. Tainer les cellules et effectuer une analyse cytométrique du débit de l'IFN intracellulaire- Comme décrit précédemment (Figure 2).

2. Induction de la réplication du VHB par la livraison hydrodynamique du plasmide du VHB

REMARQUE : la construction de pAAV/HBV1.2 a été produite comme décrit précédemment9. L'ADN complet du VHB 1.2 est incorporé dans le pAAV vectoriel.

  1. Livraisons hydrodynamiques de plasmide hBV dans la veine de la queue
    1. Chauffer les souris HHD à l'aide d'une lampe thermique pendant 5 min dans la cage afin de dilater la veine de la queue.
    2. Détenir l'animal au moyen d'une formatrice et nettoyer la queue de souris avec un vaporisateur d'éthanol à 70 %.
    3. Livraison de plasmide dans le foie.
    4. Mesurer le poids corporel de la souris à l'aide d'une balance à mesurer.
    5. Diluer 10 g de plasmide de HBV dans l'équivalent de 8 % de la masse corporelle PBS (p. ex., 1,6 mL pour une souris de 20 g). Chargez le plasmide dilué dans une seringue de 3 ml avec une aiguille hypodermique de 26 G et 1à2po (0,45 x 12 mm).
    6. Localiser l'une des deux veines latérales de la queue au milieu du tiers de la queue et positionner l'aiguille dans l'une ou l'autre veine latérale. Administrer l'injection contenant le plasmide de HBV par la veine de queue dans 3 - 5 s.
  2. Quantification de la virémie à partir du sérum sanguin de souris infectées
    REMARQUE : La réplication du VHB se produit du jour 3 à 35 dans le sérum de souris. La réplication de l'ADN atteint son maximum le jour 7 et diminue progressivement. L'ADN du VHB n'est pas éliminé du sérum avant le 35e jour.
    1. Collecte de sérum sanguin sur des souris infectées
      1. Recueillir environ 0,1 ml de sang dans un tube microcentrifuge de chaque souris sur 3, 5, 7, et 10 jours après l'infection par saignement rétro-orbital dans un tube microcentrifuge de 1,5 mL, puis incuber à température ambiante (RT) pendant 20 min.
      2. Centrifuger l'échantillon à 6 000 x g pendant 15 min à 4 oC et recueillir le supernatant de sérum après centrifugation.
    2. Purifez l'ADN du sérum sanguin à l'aide d'une trousse d'extraction d'ADN disponible dans le commerce suivant les recommandations du fabricant. En bref, lyser les cellules dans une colonne à base de silice, effectuer les lavages, et extraire l'ADN en ajoutant 100% d'éthanol à la colonne d'élution et de centrifuging à 6000 x g pendant 1 min. Elute l'ADN dans 50 'L d'eau sans RNase.
    3. Utilisez 100 ng d'ADN HBV de l'élution pour l'analyse PCR en temps réel. Utilisez les amorces et sondes suivantes : avant 5' TAGGAGGCTGTAGGCATAATTTGG 3'; inverse 5' GCACAGCTTGGAGGCTTGT 3'; sonde 5' TCACCTCGCCTAATC 3'.
      1. Utilisez le génome du VHB contenant le plasmide (pAAV/HBV1.2) pour la courbe standard et effectuez un PCR en temps réel dans un volume total de 10 L (figure 3).
    4. Configurez la réaction PCR dans un volume total de 10 L, comme le montre le tableau 1.
    5. Configurez le programme PCR dans le thermocycler comme indiqué dans le tableau 2. Le taux de transition de température programmé est de 20 oC/s pour la dénaturation/annealing et de 5 oC/s pour l'extension. Mesurer la fluorescence à la fin de la phase d'annexion pour chaque cycle pour la surveillance en temps réel de PCR.

3. Réduction de la réplication du VHB par ACT des cellules virales iPSC-CD8 et T spécifiques à l'Ag

  1. Transfert de cellules adoptives (ACT)
    1. Différencier les s183/iPSC (1.3.7) sur les cellules stromales OP9-DL1-DL4 en présence de mFlt-3L et de mIL-7 pendant 8 jours comme décrit dans la section 1.3.
    2. Le jour 22, recueillir les cellules iPSC-CD8et T de la plaque de 10 cm avec la trypsine, puis laver et resuspendre chaque plaque de 10 cm dans 10 ml de puisagsix frais. Ajouter les cellules à une plaque fraîche de 10 cm et retourner à l'incubateur pendant 30 min comme cela a été fait dans la section 1.3. Après 30 min, recueillir les cellules flottantes.
    3. Utilisez une passoire en nylon de 70 m pour passer les cellules afin d'éliminer les amas cellulaires et de compter le nombre de cellules. Adaptez les cellules à une concentration de 1,5 x 107 cellules/mL dans une solution PBS froide et utilisez une passoire en nylon de 70 m pour passer les cellules afin d'éliminer à nouveau les amas cellulaires si nécessaire. Maintenir les cellules sur la glace jusqu'à l'ACT.
    4. Injecter une suspension cellulaire de 200 ll (3 x 106 cellules) dans des souris HHD de 4 à 6 semaines par la veine de la queue.
  2. Induction de la réplication du VHB
    1. Le jour 14 après le transfert de cellules, effectuer la livraison hydrodynamique du plasmide de HBV par la veine de queue comme décrit dans la section 2.1.
  3. Détection de protéines virales provenant du foie infecté
    1. Sacrifier les souris les jours 3, 5, 7, 14 et 21 après l'infection. Pour l'euthanasie, dans chaque cage, utiliser 1 à 2 L de dioxyde de carbone (CO2) dans la première phase. Lorsque l'animal développe la perte de conscience, gagnez le débit de CO2 autour de 4 à 5 L/min. Effectuer l'euthanasie de la souris en utilisant l'inhalation de CO2.
    2. Séparer le foie en coupant la peau de surface du péritoine en utilisant des ciseaux et des forceps et en faisant glisser légèrement le foie vers l'arrière pour découvrir la peau interne qui tapisse la cavité péritonéale. Recueillir et couper les échantillons de foie (longueur x largeur x hauteur de 0,5 cm x 0,5 cm x 0,3 cm) des souris infectées pour s'adapter facilement dans la cassette d'intégration et bloquer dans la formaline tampon neutre de 10 % pendant 4 à 24 h.
    3. Décalcifier l'échantillon du foie en utilisant 2,5 M d'acide formique; rincer au xylène pendant 3 min, rincer 2x à 100 % d'éthanol, rincer 2x à 95 % d'éthanol, rincer 2x dans de l'eau désionisée (DI) pendant 2 min, puis décalciser les échantillons de foie dans 1 mM d'acide éthylènediaminetacetic (EDTA) en conséquence. Poignée à une température inférieure à l'ébullition (90 oC) pendant 20 min.
    4. Refroidir les tissus du foie fixe pendant 30 min. Rincer les tissus avec 1x PBS pendant 4 min et incorporer les tissus dans la paraffine. Déshydrater les tissus dans une série de concentrations croissantes d'éthanol pour remplacer l'eau, puis plonger dans l'immersion en xylène. Intégrez les tissus infiltrés dans des blocs de cire. Faire une section verticale et horizontale uniformément pour la coloration. Préparer des sections de 4 m avec un microtome coulissant.
    5. Passer les sections à travers la déparaffinisation et la réhydratation à l'aide de xylène et d'éthanol, puis effectuer la coloration immunofluorescente des sections.
    6. Tainer les sections avec 200 oL d'anticorps spécifiques à la surface HBV Ag (1:100 dilution dans la solution de blocage). Incuber les sections avec l'anticorps pendant 2 h à RT dans une chambre humidifiée de 75 % à 100 %, et laver 5x en 1x PBS pendant 5 min.
    7. Utilisez un réactif anti-fade contenant 4',6-diamidino-2-phenylindole (DAPI) pour la coloration nucléaire pour contrer les diapositives. Ajouter le bordereau de couverture avec environ 300 l de la solution de coloration Diluée DAPI (300 nM en 1x PBS) et valider l'ensemble du coverslip couvert. Maintenez les glissières dans l'obscurité à 4 oC jusqu'à l'inspection sous un microscope fluorescent.
  4. Infiltration de cellules inflammatoires chez les souris infectées
    1. Sacrifier les souris telles que décrites à l'étape 3.3.1. Recueillir le foie et faire des sections comme décrit à l'étape 3.3.4.
    2. Tainer la section avec de l'hématoxylin et de l'éosine (H et E) pour évaluer l'infiltration de cellules inflammatoires dans le foie.
    3. Conserver les diapositives dans l'obscurité à 4 oC jusqu'à une analyse plus poussée au microscope fluorescent.
    4. Visualiser les diapositives sous un microscope à fluorescence pour détecter l'infiltration de cellules inflammatoires dans le foie (Figure 4).
  5. Détection d'ADN du VHB du foie infecté
    1. Isolement de l'ADN viral.
    2. Euthanasier les souris et prélever les échantillons de foie selon la section 3.3.
    3. Lyse les tissus hépatiques dans Nonindet P-40 (NP-40) tampon de lyse (50 mM Tris-HCL, 1 mM EDTA, 1% NP-40) contenant un cocktail inhibiteur de la protéase.
    4. Brièvement centrifugeuse à 16 000 x g pour enlever les noyaux et les débris cellulaires.
    5. Incuber le lysate cytoplasmique à la nucléase micrococcique (nucléane S7; 150 unités/mL) et CaCl2 (5 mM) à 37 oC pendant 90 min pour dégrader l'acide nucléique à l'extérieur des nucléocapdiens (NC).
    6. Inactiver la nucléase S7 par l'ajout de 10 mM EDTA.
    7. Précipiter les nucléocapdes avec du polyéthylène glycol (PEG), perturber de 0,5 % le sulfate de dodécyl de sodium (SDS) et digérer avec 0,6 mg/mL de protéinase K (PK) à 37 oC pendant 1 h.
    8. Récupérez les acides nucléiques viraux par extraction de chloroforme de phénol et précipitation d'éthanol.
    9. Résoudre l'ADN viral extrait sur un gel agarose de 1,2% et détecter par l'analyse standard de tache du Sud à l'aide d'une sonde d'ADN HBV32 P-étiquetée.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Comme indiqué ici, les cellules virales du VHB Ag-spécifiques iPSC-CD8t sont générées par un système de culture in vitro. Après l'ACT de ces cellules virales Ag-spécifiques iPSC-CD8- T supprimer considérablement la réplication du VHB dans un modèle de murine (Fichier supplémentaire 1). Souris iPSC sont transducés avec la construction rétrovirale MIDR codant un gène hybride homme-souris HBV TCR (HBs183-191-spécifique, s183), puis les iPSC transducés par gène sont co-cultivés avec op9-DL1/DL4 cellules exprimant des ligands Notch (dL1 et DL4) molécules en présence de rFlt3L et de rIL-7. Le jour 28 de la co-culture in vitro, les cellules iPSC-dérivées expriment sensiblement CD3 et Ag-spécifique TCR (marqueurs de cellules T). L'analyse cytométrique du débit de lapopulation cD3etCD8 montre que la transduction du HBV TCR augmente considérablement la génération de cellules CD8 et T spécifiques au virus s183(figure 1).

Le jour 28 de la co-culture in vitro, les cellules IPSC-CD8 (CD8) cD8 et T de CD4cD8sont isolées et stimulées par des splenocytes appauvris en T pulsés avec du peptide s183, et la production de cytokine est évaluée. Les iPSC-CTL produisent de grandes quantités d'IL-2 et d'IFN-MD telles qu'elles sont détectées par coloration intracellulaire ou ELISA (figure 2). L'infection par le VHB est induite chez les souris transgéniques HLA-A2.1 (HHD) par injection hydrodynamique de 10 g de plasmide d'ADN pAAV/HBV1.2 à travers les veines de la queue des souris. La réplication du VHB est détectée à partir du jour 3-21 dans le sérum des souris HHD. La réplication de l'ADN atteint son maximum le jour 6 et diminue progressivement à l'aide d'une analyse PCR en temps réel (figure 3).

Deux semaines après l'ACT, les souris sont défiées avec une injection hydrodynamique de plasmide d'ADN de pAAV/HBV1.2. Le tatet viral est mesuré par PCR en temps réel à partir de sérum à divers moments après l'injection. Les résultats démontrent que la réplication virale est considérablement réduite à tous les moments chez les souris recevant des lymphocytes T vbv virus Ag spécifiques par rapport aux souris recevant des cellules témoins (Figure 4A). L'expression des protéines de surface du VHB est également examinée dans le foie dans le cadre ci-dessus du traitement. Les souris sont euthanasiées à divers jours après l'injection de VHB et les échantillons de foie sont isolés pour l'examen histologique. Les échantillons sont tachés pour la protéine de surface du VHB et examinés au microscope à fluorescence. La protéine de surface du VHB est observée comme une diminution substantielle chez les souris recevant des pré-iPS-CTL virales HBV Ag,c., par rapport aux souris recevant des cellules témoins (Figure 4B). Cette expérience démontre clairement que les cellules virales ag-spécifiques iPSC-CD8T ont la capacité de réduire la réplication du VHB dans le modèle de murine.

Figure 1
Figure 1 : Génération de cellules virales du VHB Ag-spécifiques iPSC-CD8.
Les iPSC de souris sont transducés avec les constructions rétrovirales suivantes : HBs183-91 TCR (MiDR-s183 TCR) ou OVA257-264 TCR (MiDR-OVA TCR), et les iPSC transductés sont co-cultivés avec des cellules stromales OP9-DL1/DL4 pour la différenciation de la lignée T. (A) Représentation schématique de la construction rétrovirale MiDR-s183 TCR exprimant s183-spécifique TCR. Signal d'emballage; 2A - picornavirus auto-clivant 2A séquence; LTR - longues répétitions terminales. (B) Morphologie de la différenciation des lymphocytes T les jours 0, 7, 14 et 22. (C) Analyse cytométrique de flux pour les cellules dérivées de l'iPSC le jour 28. Lescellules CD3etCD8 (à gauche) sont fermées comme indiqué et analysées pour l'expression du CD8 et du TCRV-28 (à droite). Les données présentées sont représentatives de trois expériences individuelles. Les valeurs représentent la moyenne de SD (lt; 0,01; t-tests appariés). Veuillez cliquer ici pour voir une version plus grande de ce chiffre.

Figure 2
Figure 2 : Analyse fonctionnelle des cellules virales Ag-spécifiques du VHB iPSC-CD8.
Le jour 28 de la co-culture in vitro, les cellules SP CD8etS183 TCR pentameret iPSC-T sont triées. Les cellules iPSC-T et les lymphocytes T CD8 et T transduisent avec le TCR MiDR-s183 sont stimulés par des splenocytes T (APC) à partir de souris HHD et pulsés avec du peptide s183 (FLLTRILTI). (A) Coloration intracellulaire de l'IFN-MD après 7 h (fermée sur cD8et cellules) (T/ACs 1:4). (B) ELISA de l'IFN-après 40 h. Les données présentées sont représentatives de trois expériences individuelles. Les valeurs représentent la moyenne de SD (n.s., p 'gt; 0.05; t-tests appariés). Veuillez cliquer ici pour voir une version plus grande de ce chiffre.

Figure 3
Figure 3 : Induction de la réplication du VHB chez les souris HHD par injection hydrodynamique.
Les souris HHD sont administrées par le plasmide HBV par injection hydrodynamique de veine de queue. 10 g du plasmide est injecté avec 8% de la masse corporelle totale PBS. Sur les points de temps indiqués après l'injection, le sérum est isolé du sang et l'ADN est extrait pour PCR en temps réel. Les données présentées sont représentatives de trois expériences individuelles. Les valeurs représentent la moyenne de SD. Les données sont représentatives de cinq souris par groupe de trois expériencesindépendantes. Veuillez cliquer ici pour voir une version plus grande de ce chiffre.

Figure 4
Figure 4 : Réduction de la réplication du VHB par ACT des cellules virales iPSC-CD8et T spécifiques à l'Ag.
Les souris HHD sont i.v. adoptivement transférées avec l'iPSC-CD8 viral d'Ag-spécifique- progéniteurs de cellules T (le jour 22 de la culture in vitro) et administrées avec le plasmide de HBV à la semaine 2 après le transfert de cellule. (A) Copies sérum HBV. Aux moments indiqués après l'injection, le sérum est isolé du sang, et l'ADN est extrait pour l'analyse en temps réel de PCR. Les données présentées sont représentatives de trois expériences individuelles. Les valeurs représentent la moyenne - SD. (B) Histologie de tissu de foie. Les souris sont euthanasiées au jour 8 après l'infection à VHB. Les échantillons de foie sont isolés et tachés pour l'examen histologique. Le panneau supérieur montre l'expression de protéine HBsAg chez les souris infectées (coloration IHC) et le panneau inférieur montre l'infiltration inflammatoire de cellules (HE-staining). Les données sont représentatives de cinq souris par groupe de trois expériences indépendantes. Veuillez cliquer ici pour voir une version plus grande de ce chiffre.

Modèle d'ADN 2 ml
Mélange d'hybridation maître d'ADN ((polymérase d'ADN de Taq, tampon de réaction de PCR, mgCl2 de 10 mM, et mélange de dNTP) 1 ml
25 mM MgCl2 0,8 ml
0.3 M la sonde 3 ml
5 Md de chaque amorce 3,2 ml
total 10 ml

Tableau 1 : Volume de réaction PCR

température temps
Dénaturation 95 oC 5 s
Recuit 53 oC 10 s
prolongation 72 oC 20 s
5 oC

Tableau 2 : Programme PCR

Dossier supplémentaire 1: Veuillez cliquer ici pour télécharger ce fichier.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Ce protocole présente une méthode pour générer les iPSC-CTL virales spécifiques à ag pour une utilisation comme ACT pour supprimer la réplication du VHB dans un modèle de murine. Dans l'infection chronique de HBV, le génome viral forme un mini chromosome stable, l'ADN circulaire covalently fermé (cccDNA) qui peut persister tout au long de la durée de vie de l'hépatocyte. Cibler le dégagement du mini chromosome viral peut entraîner un traitement de l'infection chronique par le VHB. Le traitement antiviral actuel cible la transcriptase inverse de virus mais établit rarement le contrôle immunologique sur la réplication de HBV conduite par cccDNA. Les CD8 spécifiques au VHBpeuvent être la médiation de la mise à mort des hépatocytes infectés et accélérer le déminage de l'ADN-ccc. Néanmoins, les CTL spécifiques au VHB sont supprimés, dysfonctionnels, ou succombent à l'épuisement chez les patients atteints d'infection chronique au VHB. ACT avec le HBV spécifiques CTLs est un traitement favorable pour l'infection chronique au VHB28,29. Les lymphocytes T naïfs ou à mémoire centrale dérivés des lymphocytes T (c.-à-d. les cellules immunitaires hautement réactives) sont des effecteurs idéaux pour les thérapies à base d'ACT en raison de leur grande prolifération, de leur tendance plus faible à la mort par rapport aux cellules différenciées en phase terminale et d'excellentes capacité de répondre aux cytokines homéostatiques. Cependant, un tel ACT a été souvent impossible en raison des difficultés à obtenir un nombre suffisant de CTL des patients. Il a été précédemment montré que la reprogrammation des CTL ag-spécifiques ou Tregs des iPSCs peuvent être utilisés pour les thérapies cellulaires20,23,27,30. Ce rapport démontre une méthode pour produire l'iPSC-CTLs viral D'Ag-spécifique et pour employer ces cellules pour l'immunothérapie BASÉE sur l'ACT dans un modèle de murine de la réplication de HBV.

Bien qu'il existe des modèles transgéniques de la réplication du VHB, ces modèles sont difficiles parce que la tolérance centrale induite par les produits géniques transgéniques fait en dire aux souris qu'elles sont immunisées contre le VHB Ags. En outre, les souris transgéniques ne sont pas appropriées pour surveiller le dégagement viral que le génome intégré du VHB persiste dans chaque cellule de souris31,32. En outre, en dépit du fait que des vaccins efficaces ont été mis au point pour prévenir l'infection, le traitement ou l'immunothérapie après l'infection au VHB n'a pas été mis au point. En outre, les approches expérimentales de la pathogénie du VHB ont été entravées parce que la gamme hôte de l'infection par le VHB est limitée aux hommes et aux chimpanzés, et le système de culture in vitro pour la propagation du VHB n'est pas suffisant. Les lymphocytesT CD8 sont des cellules effectrices prometteuses contre divers types d'infection virale; cependant, la réponse de cellule T contre HBV n'est pas abondante. La spécificité, le fonctionnement et le manque de nombres suffisants pour monter une réponse immunitaire peuvent être la cause. Ce rapport révèle la méthode d'injection hydrodynamique qui induit efficacement la réplication du VHB chez la souris. La méthode permet la livraison d'une grande quantité de plasmide HBV directement dans le foie. Le modèle présente une virémie continue pendant plus de 8 semaines avec la détection de l'ARNm, des protéines et de l'ADN du VHB à différents jours après l'injection. Cette méthode pour la réplication de HBV chez les souris est utile pour l'immunothérapie de HBV.

En résumé, la réplication de HBV a été avec succès induite chez les souris par la procédure hydrodynamique d'injection, et les iPSC-CTL s'ag-spécifiques virales ont été employées comme immunothérapie pour la réplication de HBV. Cependant, il y a deux limites de la méthode : (1) plus de trois semaines de différenciation in vitro de cellules T peut réduire les applications translationnelles des cellules T générées pour L'ACT ; et (2) l'injection hydrodynamique de HBV peut induire efficacement la réplication de HBV dans le foie ; cependant, il ne forme pas l'ADN-ccc, qui est la principale raison de l'infection persistante de HBV. Néanmoins, la méthode fournit une approche alternative pour la réplication et le traitement du VHB. Un régime combiné utilisant des médicaments anti-VHB et l'ACT des iPSC-CTL virales spécifiques à ag est susceptible de réduire les réservoirs de VIH, ce qui entraîne un traitement pour l'infection chronique par le VIH.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs n'ont rien à révéler.

Acknowledgments

Les auteurs remercient le Dr Adam J Gehring, de l'Institut de recherche de l'Hôpital général de Toronto, d'avoir fourni de l'ADNC pour les HBs183-91 (s183) (FLLTRILTI) - gènes hybrides hybrides à la murine humaine à restriction A2, et le Dr Pei-Jer Chen de la National Taiwan University pour avoir fourni des gènes tCR hybrides à murine humain restreints par A2, et le Dr Pei-Jer Chen de la National Taiwan University pour avoir fourni des gènes tCR hybrides à murine humain restreints a2, et le Dr Pei-Jer Chen de la National Taiwan University pour avoir fourni pAAV/HBV 1.2 construction. Ce travail est soutenu par le National Institute of Health Grant R01AI121180, R01CA221867 et R21AI109239 à J. S.

Materials

Name Company Catalog Number Comments
HHD mice Institut Pasteur, Paris, France H-2 class I knockout, HLA-A2.1-transgenic (HHD) mice
iPS-MEF-Ng-20D-17 RIKEN Cell Bank APS0001
SNL76/7 ATCC SCRC-1049
OP9 ATCC CRL-2749
pAAV/HBV1.2 plasmid Dr. Dr. Pei-Jer Chen (National Taiwan University Hospital, Taiwan) HBV DNA construct
HBs183-91(s183) (FLLTRILTI)-specific TCR genes Dr. Adam J Gehring (Toronto General Hospital Research Institute, Toronto, Canada) FLLTRILTI-specific A2-restricted human-murine hybrid TCR genes (Vα34 and Vβ28)
OVA257–264-specific TCR genes Dr. Dario A. Vignali (University of Pittsburgh, PA) SIINFEKL-specific H-2Kb-restricted TCR genes
Anti-CD3 (17A2) antibody Biolegend 100236
Anti-CD44 (IM7) antibody BD Pharmingen 103012
Anti-CD4 (GK1.5) antibody Biolegend 100408
Anti-CD8 (53-6.7) antibody Biolegend 100732
Anti-IFN-γ (XMG1.2) antibody Biolegend 505810
Anti-TNF-a (MP6-XT22) antibody Biolegend 506306
α-MEM Invitrogen A10490-01
Anti-HBs antibody Thermo Fisher MA5-13059
ACK Lysis buffer Lonza 10-548E
Brefeldin A Sigma B7651
DMEM Invitrogen ABCD1234
FBS Hyclone SH3007.01
FACSAria Fusion cell sorter BD 656700
Gelatin MilliporeSigma G9391
GeneJammer Agilent 204130
HLA-A201-HBs183-91-PE pentamer Proimmune F027-4A - 27
HRP Anti-Mouse Secondary Antibody Invitrogen A27025
mFlt-3L Peprotech 250-31L
mIL-7 Peprotech 217-17
Nuclease S7 Roche 10107921001
Paraformaldehyde MilliporeSigma P6148-500G Caution: Allergenic, Carcenogenic, Toxic
Permeabilization buffer Biolegend 421002
Polybrene MilliporeSigma 107689
ProLong™ Gold Antifade Mountant with DAPI Invitrogen P36931
QIAamp MinElute Virus Spin Kit Qiagen 57704

DOWNLOAD MATERIALS LIST

References

  1. Scaglione, S. J., Lok, A. S. Effectiveness of hepatitis B treatment in clinical practice. Gastroenterology. 142, (6), 1360-1368 (2012).
  2. Osiowy, C. From infancy and beyond... ensuring a lifetime of hepatitis B virus (HBV) vaccine-induced immunity. Human Vaccines & Immunotherapeutics. 14, (8), 2093-2097 (2018).
  3. Gish, R. G., et al. Loss of HBsAg antigen during treatment with entecavir or lamivudine in nucleoside-naive HBeAg-positive patients with chronic hepatitis B. Journal of Viral Hepatitis. 17, (1), 16-22 (2010).
  4. Kurktschiev, P. D., et al. Dysfunctional CD8+ T cells in hepatitis B and C are characterized by a lack of antigen-specific T-bet induction. Journal of Experimental Medicine. 211, (10), 2047-2059 (2014).
  5. Fisicaro, P., et al. Antiviral intrahepatic T-cell responses can be restored by blocking programmed death-1 pathway in chronic hepatitis B. Gastroenterology. 138, (2), 682-693 (2010).
  6. Schurich, A., et al. The third signal cytokine IL-12 rescues the anti-viral function of exhausted HBV-specific CD8 T cells. PLoS Pathogens. 9, (3), 1003208 (2013).
  7. Gehring, A. J., et al. Engineering virus-specific T cells that target HBV infected hepatocytes and hepatocellular carcinoma cell lines. Journal of Hepatology. 55, (1), 103-110 (2011).
  8. Xia, Y., et al. Interferon-gamma and Tumor Necrosis Factor-alpha Produced by T Cells Reduce the HBV Persistence Form, cccDNA, Without Cytolysis. Gastroenterology. 150, (1), 194-205 (2016).
  9. Huang, L. R., Wu, H. L., Chen, P. J., Chen, D. S. An immunocompetent mouse model for the tolerance of human chronic hepatitis B virus infection. Proceedings of the National Academy of Sciences U.S.A. 103, (47), 17862-17867 (2006).
  10. Wong, P., Pamer, E. G. CD8 T cell responses to infectious pathogens. Annual Review of Immunology. 21, 29-70 (2003).
  11. Murray, J. M., Wieland, S. F., Purcell, R. H., Chisari, F. V. Dynamics of hepatitis B virus clearance in chimpanzees. Proceedings of the National Academy of Sciences USA. 102, (49), 17780-17785 (2005).
  12. Hinrichs, C. S., et al. Adoptively transferred effector cells derived from naive rather than central memory CD8+ T cells mediate superior antitumor immunity. Proceedings of the National Academy of Sciences U.S.A. 106, (41), 17469-17474 (2009).
  13. Hinrichs, C. S., et al. Human effector CD8+ T cells derived from naive rather than memory subsets possess superior traits for adoptive immunotherapy. Blood. 117, (3), 808-814 (2011).
  14. Kerkar, S. P., et al. Genetic engineering of murine CD8+ and CD4+ T cells for preclinical adoptive immunotherapy studies. Journal of Immunotherapy. 34, (4), 343-352 (2011).
  15. Kuball, J., et al. Facilitating matched pairing and expression of TCR chains introduced into human T cells. Blood. 109, (6), 2331-2338 (2007).
  16. van Loenen, M. M., et al. Mixed T cell receptor dimers harbor potentially harmful neoreactivity. Proceedings of the National Academy of Sciences USA. 107, (24), 10972-10977 (2010).
  17. Cameron, B. J., et al. Identification of a Titin-derived HLA-A1-presented peptide as a cross-reactive target for engineered MAGE A3-directed T cells. Science Translational Medicine. 5, (197), (2013).
  18. Fedorov, V. D., Themeli, M., Sadelain, M. PD-1- and CTLA-4-based inhibitory chimeric antigen receptors (iCARs) divert off-target immunotherapy responses. Science Translational Medicine. 5, (215), (2013).
  19. Maus, M. V., et al. T cells expressing chimeric antigen receptors can cause anaphylaxis in humans. Cancer Immunolology Research. 1, (1), 26-31 (2013).
  20. Haque, R., et al. Programming of regulatory T cells from pluripotent stem cells and prevention of autoimmunity. Journal of Immunology. 189, (3), 1228-1236 (2012).
  21. Vizcardo, R., et al. Regeneration of human tumor antigen-specific T cells from iPSCs derived from mature CD8(+) T cells. Cell Stem Cell. 12, (1), 31-36 (2013).
  22. Nishimura, T., et al. Generation of rejuvenated antigen-specific T cells by reprogramming to pluripotency and redifferentiation. Cell Stem Cell. 12, (1), 114-126 (2013).
  23. Lei, F., et al. In vivo programming of tumor antigen-specific T lymphocytes from pluripotent stem cells to promote cancer immunosurveillance. Cancer Research. 71, (14), 4742-4747 (2011).
  24. Kim, J. B., et al. Oct4-induced pluripotency in adult neural stem cells. Cell. 136, (3), 411-419 (2009).
  25. Lei, F., Haque, R., Xiong, X., Song, J. Directed differentiation of induced pluripotent stem cells towards T lymphocytes. Journal of Visualized Experiments. (63), e3986 (2012).
  26. Lei, F., Haque, M., Sandhu, P., Ravi, S., Ni, Y., Zheng, S., Fang, D., Jia, H., Yang, J. M., Song, J. Development and characterization of naive single-type tumor antigen-specific CD8+ T lymphocytes from murine pluripotent stem cells. OncoImmunology. 6, (2017).
  27. Haque, M., et al. Melanoma Immunotherapy in Mice Using Genetically Engineered Pluripotent Stem Cells. Cell Transplantation. 25, (5), 811-827 (2016).
  28. Tan, A. T., et al. Use of Expression Profiles of HBV DNA Integrated Into Genomes of Hepatocellular Carcinoma Cells to Select T Cells for Immunotherapy. Gastroenterology. (2019).
  29. Wu, L. L., et al. Ly6C(+) Monocytes and Kupffer Cells Orchestrate Liver Immune Responses Against Hepatitis B Virus in Mice. Hepatology. (2019).
  30. Haque, M., et al. Stem cell-derived tissue-associated regulatory T cells suppress the activity of pathogenic cells in autoimmune diabetes. Journal of Clinical Investigation Insights. (2019).
  31. Chisari, F. V., et al. Structural and pathological effects of synthesis of hepatitis B virus large envelope polypeptide in transgenic mice. Proceedings of the National Academy of Sciences USA. 84, (19), 6909-6913 (1987).
  32. Wirth, S., Guidotti, L. G., Ando, K., Schlicht, H. J., Chisari, F. V. Breaking tolerance leads to autoantibody production but not autoimmune liver disease in hepatitis B virus envelope transgenic mice. Journal of Immunology. 154, (5), 2504-2515 (1995).
Les lymphocytes T T spécifiques à la cellule souche s'amedisent à supprimer la réplication du VHB chez les souris
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Xiong, X., Lei, F., Haque, M., Song, J. Stem Cell-Derived Viral Ag-Specific T Lymphocytes Suppress HBV Replication in Mice. J. Vis. Exp. (151), e60043, doi:10.3791/60043 (2019).More

Xiong, X., Lei, F., Haque, M., Song, J. Stem Cell-Derived Viral Ag-Specific T Lymphocytes Suppress HBV Replication in Mice. J. Vis. Exp. (151), e60043, doi:10.3791/60043 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter