Summary
Here, we describe a single cell micro-aspiration method for the separation of infected amoebae. In order to separate viral subpopulations in Vermamoeba vermiformis infected by Faustoviruses and unknown giant viruses, we developed the protocol detailed below and demonstrated its ability to separate two low-abundance novel giant viruses.
Abstract
During the amoeba co-culture process, more than one virus may be isolated in a single well. We previously solved this issue by end point dilution and/or fluorescence activated cell sorting (FACS) applied to the viral population. However, when the viruses in the mixture have similar morphologic properties and one of the viruses multiplies slowly, the presence of two viruses is discovered at the stage of genome assembly and the viruses cannot be separated for further characterization. To solve this problem, we developed a single cell micro-aspiration procedure that allows for separation and cloning of highly similar viruses. In the present work, we present how this alternative strategy allowed us to separate the small viral subpopulations of Clandestinovirus ST1 and Usurpativirus LCD7, giant viruses that grow slowly and do not lead to amoebal lysis compared to the lytic and fast-growing Faustovirus. Purity control was assessed by specific gene amplification and viruses were produced for further characterization.
Introduction
Nucleocytoplasmic large DNA viruses (NCLDV) are extremely diverse, defined by four families that infect eukaryotes1. The first described viruses with genomes above 300 kbp were Phydcodnaviridae, including Paramecium bursaria Chlorella virus 1 PBCV12. The isolation and the first description of Mimivirus, showed that the size of viruses doubled in terms of both the size of the particle (450 nm) and the length of the genome (1.2 Mb)3. Since then, many giant viruses have been described, usually isolated using an amoeba co-culture procedure. Several giant viruses with different morphologies and genetic contents can be isolated from Acanthamoeba sp. cells, including Marseilleviruses, Pandoraviruses, Pithoviruses, Mollivirus, Cedratviruses, Pacmanvirus, Tupanvirus, and recently Medusavirus4,5,6,7,8,9,10,11,12,13,14,15,16,17. In parallel, the isolation of Vermamoeba vermiformis allowed the isolation and description of the giant viruses Faustovirus, Kaumoebavirus, and Orpheovirus18,19,20. Other giant viruses were isolated with their host protists, such as Cafeteria roenbergensis21, Aureococcus anophagefferens22, Chrysochromulina ericina23, and Bodo saltans24. All of these isolations were the result of an increasing number of teams working on isolation and the introduction of high throughput strategy updates25,26,27,28, such as the improvement of the co-culture system with the use of flow cytometry.
In 2016, we used a strategy associating co-culture and flow cytometry to isolate giant viruses27. This strategy was developed to increase the number of samples inoculated, to diversify protists used as cell supports, and to quickly detect the lysis of the cell support. The system was updated by adding a supplemental step to avoid preliminary molecular biology identification and quick detection of an unknown viral population as in the case of Pacmanvirus29. Coupling flow cytometry to cell sorting allowed for separation of a mixture of Mimivirus and Cedratvirus A1130. However, we later encountered the limitations of the separation and detection of these viral subpopulations by flow cytometry. After sequencing, when we assembled the genomes of Faustovirus ST125 and Faustovirus LCD7 (unpublished data), we surprisingly found in each assembly two supplemental genomes of two novel viruses not identified in public genome databases. However, neither flow cytometry nor transmission electronic microscopy (TEM) showed that the amoebaes were infected by two different viruses, Clandestinovirus ST1 and Usurpativirus LCD7. We designed specific PCR systems to amplify Faustovirus, Usurpativirus, and Clandestinovirus markers respectively based on their genomes; our purpose was to have PCR-based systems that enable verification of the purity of the viruses being separated. However, end-point dilution and flow cytometry failed to separate them. The isolation of this single viral population was difficult because neither the morphology nor replicative elements of Clandestinovirus and Usurpativirus populations have been characterized. We detected only one viral population by flow cytometry due to the overlapping of the two populations (tested after the effective separation). We tried to separate them using single particle sorting on 96-well plates, but we did not observe any cytopathic effects, and we detected neither Clandestinovirus nor Usurpativirus by PCR amplification. Finally, it was only the combination of end point dilution followed by single amoeba micro-aspiration that enabled separation of these two low-abundance giant viruses from Faustoviruses. This method of separation is the object of this article.
Subscription Required. Please recommend JoVE to your librarian.
Protocol
1. Amoeba Culture
- Use Vermamoeba vermiformis (strain CDC19) as a cell support.
- Add 30 mL of protease-peptone-yeast extract-glucose medium (PYG) (Table 1) and 3 mL of the amoebae at a concentration of 1 x 106 cells/mL in a 75 cm2 cell culture flask.
- Maintain the culture at 28 °C.
- After 48 h, quantify the amoebae using counting slides.
- To rinse, harvest the cells at a concentration of 1 x 106 cells/mL and pellet the amoebae by centrifugation at 720 x g for 10 min. Remove the supernatant and resuspend the pellet in the appropriate volume of starvation medium to obtain 1 x 106 cells/mL (Table 1).
2. Propagation of Stock Virus in Amoebae
NOTE: Before dilution, it is important to culture the stock sample to obtain enough fresh culture, then proceed to filtration.
- Use 1 x 106 of amoeba culture in starvation medium.
- Inoculate the mixture of viruses issued from the stock solution (Faustovirus/Usurpativirus LCD7 or Faustovirus/Clandestinovirus ST1) after the co-culture process on the cell support at a multiplicity of infection (MOI) of 0.01.
NOTE: The MOI is important to reduce the abundance of the major viral population and the number of infected cells. - Incubate at 30 °C until cytopathic effects (CPE) are induced, such as amoebal rounding or lysis, approximately 10 to 14 h after infection.
- Collect the media and filtrate through a 5 µm filter to remove cellular debris.
3. End-point dilution
- Perform a serial dilution (10-1 to 10-11) of the viral sample in starvation medium (Table 1).
- Inoculate 2 mL of 1 x 106 Vermamoeba vermiformis contained in each Petri dish with 100 µL of the mixture inoculum.
- Place the Petri dishes into a sealable plastic bag at 30 °C.
- Begin observing the Petri dishes with inverted optical microscopy at 6 h postinfection and check cell morphology every 4 to 8 h.
- At the appearance of the cytopathic effect characterized by rounding cells, begin the single cell micro-aspiration process.
4. Single Cell Micro-aspiration
- Prepare the host.
NOTE: This preparation is made for the release of infected single cells to a fresh cell support.- Treat the amoebae in the culture with an antimicrobial agent containing 10 µg/mL of vancomycin, 10 µg/mL of imipenem, 20 µg/mL of ciprofloxacin, 20 µg/mL of doxycycline, and 20 µg/mL of voriconazole. This mixture is used to avoid bacterial and fungal contamination.
NOTE: The procedure takes place on a bench outside the microbiological safety station. Add 2 mL of amoebae concentrated at 1 x 106 cells/mL each into 15 Petri dishes. For amoeba adherence, incubate the culture at 30 °C for 30 min.
- Treat the amoebae in the culture with an antimicrobial agent containing 10 µg/mL of vancomycin, 10 µg/mL of imipenem, 20 µg/mL of ciprofloxacin, 20 µg/mL of doxycycline, and 20 µg/mL of voriconazole. This mixture is used to avoid bacterial and fungal contamination.
- Select the Petri dish used for the micro-aspiration from the limit dilution according to the following criteria: 1) absence of any visible contamination by fungal and bacterial agents, 2) evidence of cytopathic effect of amoebae due to the viruses, and 3) prelysis and rounding phase of the amoebae (to avoid aspiration of viral particles).
- Set up a workstation with the following materials (see Figure 1A,B):
Micromanipulator, which allows microcapillary positioning;
Manual control pressure device, used to aspirate and release the cells into the microcapillary;
Inverted microscope;
Plug and play motor modules;
Camera;
Computer module to visualize manipulation and take pictures. - Choose a microcapillary (see Figure 1C).
NOTE: The size of the cells, the deformation and adhesion of their membranes to the surfaces, and the cellular motility can impact the smooth progress of the micro-aspiration. The microcapillary diameter can be precisely chosen and adapted to specific cell types depending on their sizes and methods of aspiration. A microcapillary of 20 µm inner diameter was used to aspirate a rounding amoeba (diameter ~10 µm). This allows the upkeep of an internal position and an easy release of the cell. - Mount the system.
- Fix the operating angle of the gripping system on the motorized module at 45°.
- Perform a double installation, first on the gripping system, and then on the microcapillary.
- Focus on the cells after running a few drops of oil through the microcapillary.
NOTE: The mineral oil with biological compatibility is supplied by the device. - Complete mounting following manufacturer's recommendations.
- Clone cells (see Figure 2A,B).
NOTE: This procedure is similar to the one described by Fröhlich and König31.- Place the Petri dish containing 2 mL of infected amoebae under the microscope.
- Focus first on the cells, and then on the microcapillary immersed in the culture.
- Pick a rounded single cell and bring the microcapillary closer to the micromanipulator.
- Exert soft aspiration with manual pressure control on the cell, taking it inside the microcapillary. Remove the single cell from the first sample and release in the cellular support, then incubate it at 30 °C.
- Conduct daily observations with an inverted optical microscope to observe the appearance of the cells and to monitor the emergence of the cytopathic effect.
5. PCR Screening
NOTE: Following step 4, a systematic screening by PCR is crucial to confirm the separation. In both Usurpativirus/Faustovirus and Clandestinovirus/Faustovirus, the design and application of the specific primer and probe systems were done using Primer-BLAST online32 (Table 2).
- Extract DNA from a part of the positive culture samples (i.e., where a cytopathic effect is observed), using an automated extraction system according to the manufacturer's protocol.
- Use appropriately designed primers.
NOTE: Here we designed primers to amplify core genes annotated as RpB2 (Faustovirus), LCD7 major capsid protein (Usurpatvirus) and minor capsid protein (Clandestinovirus) - Perform standard PCR using a thermocycler.
- Carry out 20 µL PCR reactions with 50 µM of each primer (Table 2), 1x Master Mix, and RNase free water.
- Activate the Taq DNA polymerase for 5 min at 95 °C, then follow with 45 cycles of 10 s denaturation at 95 °C, annealing of the primers for 30 s at 58 °C, and extension for 30 s at 72 °C.
- Run the PCR products on a 1.5% agarose gel, stain with DNA gel stain (Table of Materials), and visualize with UV.
6. Virus Production and Purification
- Put the rest of the Petri dish culture back in a small flask.
- For the virus production, prepare 15 flasks of 145 cm2, containing 40 mL of Vermamoeba vermiformis in starvation medium and 5 mL of the isolated virus already transferred from the Petri dish to small flasks.
- Treat with the same antibiotic and antifungal mixture used in step 4.1.
- Incubate at 30 °C. Observe every day with inverted optical microscopy.
- After the complete infection, pool all flasks. Use a 0.45 µm filter to eliminate debris.
- Ultracentrifuge all supernatants at 50,000 x g for 45 min.
- After centrifugation, remove the supernatant from each tube by aspiration and resuspend the pellet in 1 mL of phosphate buffered saline (PBS).
- Purify the virus produced using 25% sucrose (27.5 g sucrose in 100 mL of PBS, sterilized by filtration).
- Centrifuge 8 mL of sucrose and 2 mL of the viral suspension at 80,000 x g for 30 min. Resuspend the viral pellet in 1 mL of PBS. Store it at -80 °C.
7. Negative Staining and Transmission Electron Microscopy
NOTE: Bou Khalil et al. previously published this protocol27.
- Deposit 5 μL of the lysis supernatant onto the glow-discharged grid. Leave for approximately 20 min at room temperature.
NOTE: The glow-discharge allows us to obtain a hydrophilic grid by plasma application. - Dry the grid carefully and deposit a small drop of 1% ammonium molybdate on it for 10 s. Leave the grid to dry for 5 min.
- Proceed to electron microscopy observations at 200 keV.
8. Characterization of Clandestinovirus ST1 and Usurpativirus LCD7
- Characterize pure populations of Clandestinovirus ST1 and Usurpativirus LCD7 using genome sequencing, genome assembly, bioinformatics analyses, and study of their replicative cycle as we have done for other viruses10,20,29.
Subscription Required. Please recommend JoVE to your librarian.
Representative Results
Single cell micro-aspiration is a micromanipulation process optimized in this manuscript (Figure 1). This technique enables capture of a rounded, infected amoeba (Figure 2A) and its release in a novel plate containing uninfected amoebae (Figure 2). It is a functional prototype that applies to the co-culture system and has successfully isolated non-lytic giant viruses. This approach was used for the first time in the field of giant viruses and made it possible to isolate two new low-abundance giant viruses. We named the new viruses Clandestinovirus ST1 and Usurpativirus LCD7, that were in low abundance compared to the high abundance Faustoviruses. In order to analyze the viral presence in each plate after the micro-aspiration procedure, we applied PCR on the 15 micro-aspirations. We observed pure Usurpativirus (presence of Usurpativirus LCD7 [+] and absence of Faustovirus [–]) only in clone 7 (Figure 3). The purity of the clone was confirmed by PCR with specific protocols targeting Clandestinovirus ST1 and Usurpativirus LCD7 (Table 2). Electron microscopy revealed the appearance of Clandestinovirus ST1 and Usurpativirus LCD7 (Figure 4), which have a typical icosahedral morphology without fibrils and an icosahedral capsid of about 250 nm, respectively. After the confirmation of the production purity, the clonal virus was produced and purified for whole genome sequencing and further characterization, especially transmission electronic microscopy (TEM) for multiplication cycle studies. We confirmed the overlapping of populations (Faustovirus/novel virus) by flow cytometry (Figure 5).
Figure 1: Materials for micromanipulation. (A) Actual setup of the workstation. (B) Schematic illustration of the workstation’s components. (C) Schematic illustration of the microcapillary. Please click here to view a larger version of this figure.
Figure 2: Micro-aspiration steps. (A) Single cell isolation procedure (zoom x40). (B) Schematic illustration of the different steps of single cell aspiration: 1) Localization of the cell. 2) Aspiration of the cell. 3) Release step. The black arrows show the microcapillary and the white ones show the single cell. Please click here to view a larger version of this figure.
Figure 3: PCR screening and confirmation. Screening PCR of micro-aspirations carried out for Usurpativirus LCD7 and Faustovirus. Presence of Usurpativirus LCD7 DNA (+) and absence of Faustovirus DNA (–) observed for clone 7 after micro-aspiration procedure. Please click here to view a larger version of this figure.
Figure 4: Negative staining micrograph. Negative staining of the viral suspension, showing pure Clandestinovirus ST1 (A) and Usurpativirus LCD7 (B). Please click here to view a larger version of this figure.
Figure 5: Representative gate plots. (A) Superimposition of each single viral population previously stained with fluorescent molecular probes for virus DNA labelling (following previously described protocol26,30). The left part of the picture shows the superposition of five strains of Faustovirus (dark green, light green, orange, red, and blue). On the right, the superposition of Faustovirus ST1 and Clandestinovirus ST1 (light purple and dark purple) is visible. (B) The presence of two viral population of Faustovirus and Usurpativirus in the same gate as Faustovirus (left). A dot plot of pure Usurpativirus shows the same gate defined previously for Faustovirus (right). Please click here to view a larger version of this figure.
| PYG composition | quantities |
| Proteose peptone | 20 g |
| Yeast extract | 20 g |
| MgSO4·7H2O | 0.980 g |
| CaCl2 | 0.059 g |
| Citrate sodium. Dihydrate | 1 g |
| Fe (NH4) 2(SO4) 2 x 6H2O | 0.02 g |
| Glucose | 18 g |
| Distilled water | 1 L |
| Adjust pH at 6.8 with HCl or KOH | |
| Autoclave 15 min at 121 °C | |
| Starvation medium | quantites |
| Yeast extract | 2 g |
| Glucose | 18 g |
| Fe (NH4) 2(SO4) 2 x 6H2O | 0.02 g |
| PAS (detailed below) | 1 L |
| PAS solution A | quantites |
| KH2PO4 | 0.136 g |
| Na2HPO4 | 0.142 g |
| PAS solution B | quantites |
| MgSO4·7H2O | 4.0 mg |
| CaCl2·2H2O | 4.0 mg |
| NaCl | 0.120 g |
| 10 mL each of solution A and B are added into 1 L of distilled water. |
Table 1: Composition of Culture Media.
| Virus target | Target gene | Foward primer (5->3) | Reverse primer (5->3) |
| Faustovirus RpB2 | RpB2 | CWCAATCHGCYGATACHGGTGA | TGATTWGCYAATGGNGCYGC |
| Usurpatvirus LCD7 Major capsid gene | Major capsid gene | GGGCAAGAAGCTCCAAGCTA | GGGTTGAGGAGGAGTCAACG |
| Clandestinovirus ST1 Minor capsid gene | Minor capsid gene | AAAATGAACGCGTTGGAGGC | ACCGGCGAATGTTCCTATGG |
Table 2: Primmer Sequences Used for the PCR.
Subscription Required. Please recommend JoVE to your librarian.
Discussion
The duration of the single cell micro-aspiration handling and its good functioning is operator-dependent. The different steps of the experiment require precision. The use of the micromanipulation components of the workstation must be under constant control by observing the process of micro-aspiration and the release of the cell. The follow-up by microscopic observation is necessary for capture and transfer of a cell. An experienced operator can take 1 to 2 h to isolate 10 cells and retransfer them one by one depending on the abundance of viruses to be isolated. The number of manipulations can vary. We advise beginning with 10 manipulations. By definition, we do not know the intrinsic characteristics of the unknown virus. Thus, the use and development of different strategies for isolation are necessary to optimize the success of separating these viruses.
The micro-aspiration process is performed under unsterile conditions (on a bench outside the microbiological safety station) and thus restricts its usage and prevents its application for the study of human pathogens. Therefore, the use of a mixture of antibiotics and antifungals to limit contaminants is mandatory. Another limitation of the method is that it can only be performed on microorganisms observable by light microscopy on which the micromanipulation components were mounted, thus, conceptually eliminating any work on microorganisms not observable by light microscopy. However, we were able to separate giant viruses of about 200 nm which remain invisible under the light microscope by using an indirect strategy consisting of separating and cloning the infected hosts.
The development of single cell micro-aspiration for amoebal capture is a part of the development of population-sorting methods. Single cell micro-aspiration allowed us to isolate two new giant viruses, Clandestinovirus ST1 and Usurpativirus LCD7, with characteristics distinctive from Faustoviruses. The highly similar morphological properties of both Clandestinovirus ST1 and Usurpativirus LCD7 to Faustovirus LCD7 and their difference of replication shows the limit of FACS, which is usually used in giant viruses sorting. It is represented by the superposition of two viral populations, Clandestinovirus ST1 and Faustovirus ST1 (Figure 5A) and also by the detection for Usupartivirus LCD7 and Faustovirus LCD7. However, with this new method, the entire manipulation is under visual control with careful monitoring of the cell and its integrity even after its release. The use of flow cytometry to directly sort infected amoebae could be an alternative solution to indirectly sort novel viruses. This method is usually followed by the screening of the plate in order to detect cytopathic effects or lysis. The presence of non-lytic viruses in the mix could represent a limit to amoebal sorting. However, this was not explored in the creation of this protocol and for these two novel isolations.
Beyond the application of the micromanipulation in the positioning and holding of cells in general and oocytes for intracytoplasmic sperm injection (ICSI)33, single cell micro-aspiration has proven to be a practical method for the isolation of single prokaryotic cells observable under an optical microscope31. Other applications could be tested, including cell sorting on a morphological basis to have different pure samples from a mixed sample of microorganisms. The observable separation of microorganisms can be envisioned using the strategy described above.
Subscription Required. Please recommend JoVE to your librarian.
Disclosures
All authors have nothing to disclose.
Acknowledgments
The authors would like to thank both Jean-Pierre Baudoin and Olivier Mbarek for their advice and Claire Andréani for her help in English corrections and modifications. This work was supported by a grant from the French State managed by the National Research Agency under the "Investissements d’avenir (Investments for the Future)" program with the reference ANR-10-IAHU-03 (Méditerranée Infection) and by Région Provence Alpes Côte d’Azur and European funding FEDER PRIMI.
Materials
| Name | Company | Catalog Number | Comments |
| Agarose Standard | Euromedex | Unkown | Standard PCR |
| AmpliTaq Gold 360 Master Mix | Applied Biosystems | 4398876 | Standard PCR |
| CellTram 4r Oil | Eppendorf | 5196000030 | Control the cells during the microaspiration process |
| Corning cell culture flasks 150 cm2 | Sigma-aldrich | CLS430825 | Culture |
| Corning cell culture flasks 25 cm2 | Sigma-aldrich | CLS430639 | Culture |
| Corning cell culture flasks 75 cm2 | Sigma-aldrich | CLS430641 | Culture |
| DFC 425C camera | LEICA | Unkown | Observation/Monitoring |
| Eclipse TE2000-S Inverted Microscope | Nikon | Unkown | Observation/Monitoring |
| EZ1 advanced XL | Quiagen | 9001874 | DNA extraction |
| Glasstic Slide 10 with Counting Grids | Kova International | 87144E | Cell count |
| Mastercycler nexus | Eppendorf | 6331000017 | Standard PCR |
| Microcapillary 20 µm | Eppendorf | 5175 107.004 | Microaspiration and release of cells |
| Micromanipulator InjectMan NI2 | Eppendorf | 631-0210 | Microcapillary positioning |
| Nuclease-Free Water | ThermoFischer | AM9920 | Standard PCR |
| Optima XPN Ultracentrifuge | BECKMAN COULTER | A94469 | Virus purification |
| Petri dish 35 mm | Ibidi | 81158 | Culture/observation |
| Sterile syringe filters 5 µm | Sigma-aldrich | SLSV025LS | Filtration |
| SYBR green Type I | Invitrogen | unknown | Fluorescent molecular probes/flow cytometry |
| SYBR Safe | Invitrogen | S33102 | Standard PCR; DNA gel stain |
| Tecnai G20 | FEI | Unkown | Electron microscopy |
| Type 70 Ti Fixed-Angle Titanium Rotor | BECKMAN COULTER | 337922 | Virus purification |
| Ultra-Clear Tube, 25 x 89 mm2 | BECKMAN COULTER | 344058 | Virus purification |
References
- Iyer, L. M., Aravind, L., Koonin, E. V. Common Origin of Four Diverse Families of Large Eukaryotic DNA Viruses. Journal of Virology. 75 (23), 11720-11734 (2001).
- Li, Y., et al. Analysis of 74 kb of DNA located at the right end of the 330-kb chlorella virus PBCV-1 genome. Virology. 237 (2), 360-377 (1997).
- Scola, B. L. A Giant Virus in Amoebae. Science. 299 (5615), 2033 (2003).
- Philippe, N., et al. Pandoraviruses: amoeba viruses with genomes up to 2.5 Mb reaching that of parasitic eukaryotes. Science. 341 (6143), 281-286 (2013).
- Antwerpen, M. H., et al. Whole-genome sequencing of a pandoravirus isolated from keratitis-inducing acanthamoeba. Genome Announcements. 3 (2), 00136-00215 (2015).
- Legendre, M., et al. Thirty-thousand-year-old distant relative of giant icosahedral DNA viruses with a pandoravirus morphology. Proceedings of the National Academy of Sciences of the United States of America. 111 (11), 4274-4279 (2014).
- Legendre, M., et al. In-depth study of Mollivirus sibericum, a new 30,000-y-old giant virus infecting Acanthamoeba. Proceedings of the National Academy of Sciences of the United States of America. 112 (38), 5327-5335 (2015).
- Legendre, M., et al. Diversity and evolution of the emerging Pandoraviridae family. Nature Communications. 9 (1), 2285 (2018).
- Aherfi, S., et al. A Large Open Pangenome and a Small Core Genome for Giant Pandoraviruses. Frontiers in Microbiology. 9, 166 (2018).
- Andreani, J., et al. Cedratvirus, a Double-Cork Structured Giant Virus, is a Distant Relative of Pithoviruses. Viruses. 8 (11), 300 (2016).
- Rodrigues, R. A. L., et al. Morphologic and genomic analyses of new isolates reveal a second lineage of cedratviruses. Journal of Virology. , 00372 (2018).
- Bertelli, C., et al. Cedratvirus lausannensis- digging into Pithoviridaediversity. Environmental Microbiology. , (2017).
- Levasseur, A., et al. Comparison of a modern and fossil Pithovirus reveals its genetic conservation and evolution. Genome Biology and Evolution. , (2016).
- Dornas, F. P., et al. A Brazilian Marseillevirus Is the Founding Member of a Lineage in Family Marseilleviridae. Viruses. 8 (3), 76 (2016).
- Yoshikawa, G., Blanc-Mathieu, R., et al. Medusavirus, a novel large DNA virus discovered from hot spring water. Journal of Virology. , (2019).
- Legendre, M., et al. Pandoravirus Celtis Illustrates the Microevolution Processes at Work in the Giant Pandoraviridae Genomes. Frontiers in Microbiology. 10, 430 (2019).
- Abrahão, J., et al. Tailed giant Tupanvirus possesses the most complete translational apparatus of the known virosphere. Nature Communications. 9 (1), 749 (2018).
- Reteno, D. G., et al. Faustovirus, an asfarvirus-related new lineage of giant viruses infecting amoebae. Journal of Virology. 89 (13), 6585-6594 (2015).
- Bajrai, L., et al. Kaumoebavirus, a New Virus That Clusters with Faustoviruses and Asfarviridae. Viruses. 8 (12), 278 (2016).
- Andreani, J., et al. Orpheovirus IHUMI-LCC2: A New Virus among the Giant Viruses. Frontiers in Microbiology. 8, 779 (2018).
- Fischer, M. G., Allen, M. J., Wilson, W. H., Suttle, C. A. Giant virus with a remarkable complement of genes infects marine zooplankton. Proceedings of the National Academy of Sciences of the United States of America. 107 (45), 19508-19513 (2010).
- Moniruzzaman, M., et al. Genome of brown tide virus (AaV), the little giant of the Megaviridae, elucidates NCLDV genome expansion and host-virus coevolution. Virology. 466-467, 60-70 (2014).
- Gallot-Lavallée, L., Blanc, G., Claverie, J. -M. Comparative genomics of Chrysochromulina Ericina Virus (CeV) and other microalgae-infecting large DNA viruses highlight their intricate evolutionary relationship with the established Mimiviridae family. Journal of Virology. , (2017).
- Deeg, C. M., Chow, C. -E. T., Suttle, C. A. The kinetoplastid-infecting Bodo saltans virus (BsV), a window into the most abundant giant viruses in the sea. eLife. 7, 235 (2018).
- Boughalmi, M., et al. High-throughput isolation of giant viruses of the Mimiviridae and Marseilleviridae families in the Tunisian environment. Environmental Microbiology. 15 (7), 2000-2007 (2013).
- Khalil, J. Y. B., et al. High-Throughput Isolation of Giant Viruses in Liquid Medium Using Automated Flow Cytometry and Fluorescence Staining. Frontiers in Microbiology. 7 (120), 26 (2016).
- Bou Khalil, J. Y., Andreani, J., Raoult, D., La Scola, B. A Rapid Strategy for the Isolation of New Faustoviruses from Environmental Samples Using Vermamoeba vermiformis. Journal of Visualized Experiments : JoVE. (112), e54104 (2016).
- Khalil, J. Y. B., Andreani, J., La Scola, B. Updating strategies for isolating and discovering giant viruses. Current Opinion in Microbiology. 31, 80-87 (2016).
- Andreani, J., et al. Pacmanvirus, a new giant icosahedral virus at the crossroads between Asfarviridae and Faustoviruses. Journal of Virology. , (2017).
- Khalil, J. Y. B., et al. Flow Cytometry Sorting to Separate Viable Giant Viruses from Amoeba Co-culture Supernatants. Frontiers in Cellular and Infection Microbiology. 6, 17722 (2017).
- Fröhlich, J., König, H. New techniques for isolation of single prokaryotic cells. FEMS Microbiology Reviews. 24 (5), 567-572 (2000).
- Ye, J., et al. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics. 13 (1), 134 (2012).
- Kimura, Y., Yanagimachi, R. Intracytoplasmic sperm injection in the mouse. Biology of Reproduction. 52 (4), 709-720 (1995).
