Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Medicine

쥐에 있는 간골 골수 관진 줄기 세포의 격리 그리고 경작

doi: 10.3791/61532 Published: August 25, 2020
* These authors contributed equally

Summary

이 문서에서는 쥐 하악에서 골수 메선 줄기 세포를 분리, 재배, 선별 및 식별하기 위한 전체 골수 준수 및 유동 세포 측정 선별을 결합하는 방법을 제시합니다.

Abstract

여기서 우리는 실험 요구 사항에 대한 수많은 고품질 세포를 빠르게 얻기 위해 시험관에서 하골 골수 중년 줄기 세포 (mBMSC)를 격리하고 배양하는 효율적인 방법을 제시합니다. mBMSC는 우수한 자기 갱신 능력과 다중 계보 분화 잠재력으로 인해 미래에 두개골 면질환 및 두개골 -상악안면 재생의 경우 조직 공학 세포로서 치료 응용 분야에서 널리 사용될 수 있습니다. 따라서 대량으로 mBMSC를 얻는 것이 중요합니다.

이 연구에서는, 골수는 하악에서 플러시되었고 1 차적인 mBMSCs는 전체 골수 부착 재배를 통해 격리되었다. 또한, CD29+CD90+CD45- mBMSC는 형광 세포 분류를 통해 정제되었다. 정제 된 mBMSC의 2 세대는 추가 연구를 위해 사용되었고 골세포, 지방 세포 및 연골 세포로 분화할 수있는 잠재력을 표시했습니다. 이를 활용한 시험관 내 모델을 활용하여 생물학적 특성, 마이크로 환경에 대한 후속 반응 및 mBMSC의 다른 응용 분야의 연구를 용이하게 할 수 있는 많은 수의 증식 mBMSC를 얻을 수 있다.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

골수 관두 줄기 세포(BMSC)는 골수로부터 유래된 비-조혈 줄기 세포로, 강력한 증식 능력과 다중 계측 분화 전위1,2,3,4를나타낸다. 실제로, BMSCs는 뼈 조직 공학 및 재생을 위한 이상적인 후보로 그(것)들이 발견된 이래로 여겨졌습니다. 수년 동안, 경골과 대퇴골과 같은 장골 문장 또는 긴 뼈는 두개안 면재생을 위한 BMSCs의 일반적인 근원이었습니다. 그러나, 하악 BMSC(mBMSC)와 같은 오로페이셜 BMSC는 상이한 배아 기원 및 발달 패턴과 같은 긴 뼈 BMSC로부터 약간의 차이를 표시합니다. 하악은 신경 절제술 세균 층의 신경 문장 세포에서 발생하고 관상 골화를 겪는 반면, 축 및 부속 골격은 중년에서 온 것이며 내뇌부 진동을 겪습니다. 더욱이, 임상 관찰 및 실험동물 연구는 지속적으로 오로페이셜과 일악 문장 BMSC5,6,7,8사이에 기능적 차이가 있음을 나타내고있다. 보고서에 따르면 BMSC는 하악, 상악뼈 및 폐포 뼈와 같은 두개골 면성 뼈에서 유래한 것으로 나타났으며, 축 및 부속뼈9보다우수한 증식, 수명 및 분화 능력을 나타냈다. 따라서 mBMSC는 케루비즘, 턱 종양, 턱 뼈의 골다공증 및 치주 조직 결함10,11,12와같은 두개골 면질환의 미래 치료적용을위한 바람직한 자원으로 간주됩니다. 전임상 실험에서 치료 잠재력을 이해하려면 시험관내에서 mBMSC를 빠르게 격리하고 배양하는 방법을 확립하는 것이 필수적입니다.

이 연구에서는, 목표는 전체 골수 준수 및 흐름 세포 측정 분류에 의해 정제 된 mBMSC를 얻는 것이었습니다. 마이크로 컴퓨터 단층 촬영 (Micro-CT) 및 조직학적 섹션을 통해 명확하게 관찰 된 쥐 하악의 해부학 적 형태는 하악의 궤적 뼈가 절개 수막 공간과 폐포 뼈 사이에 있음을 보여 주었다. 궤적 골수로부터의 골수는 하악골 세포를 얻기 위해 플러시되었지만, 이런 식으로 배양된 세포는 순수한 mBMSC가 아니었으며 뼈, 지방 및 내피 세포로부터의 세포와 같은 다양한 혈통을 가진 여러 유형의 세포로 구성될 가능성이 있었다13,14. 세포 정화의 다음 단계는 특히 중요했다. 유동 세포질은 세포 표면 단백질의 조합을 인식함으로써 세포를 필터링하고 중간엽 줄기 세포의 농축에 널리 채택되어 왔다. 세포 균질성은 유동 세포측정의 주요 장점이지만, 공정은 세포 생존가능성을 결정하지 못하고 제한된 세포 수율을 초래할 수 있다. 이 연구에서는, 전체 골수 준수에서 얻은 P0 mBMSC는 높은 순도와 강한 증식 능력을 가진 mBMSC를 얻기 위하여 유동 세포질에 의해 분류되었습니다.

이 연구는 전체 골수 준수 및 유동 세포 측정 선별의 조합을 사용하여 쥐 하악 BMSC의 격리, 문화 및 분화를 위한 재현 가능하고 신뢰할 수 있는 프로토콜을 소개합니다. 관련 분야의 연구원이 사용할 수 있는 안정적이고 편리한 방법입니다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

이 논문의 모든 동물 실험 절차는 상하이 제9인민병원, 상하이 자오동 대학교 의과대학의 동물관리위원회의 승인을 받았습니다.

1. 준비

  1. 실험에 대 한 두 5 주 된 남성 스프라 그 다울리 쥐를 사용.
  2. 바늘 홀더, 핀셋 및 가위를 포함한 모든 계측기를 고온에서 살균하거나 75% 에탄올에 10분 동안 침지합니다.
    참고: 에탄올 침수가 세포 손상을 피하기에는 너무 길어서는 안 됩니다.
  3. 문화 매체를 미리 준비하며, 구성은 표 1에제공된다. 아래에 설명된 대로 각 매체를 보충하십시오.
    1. α-MEM 배양 배지(10% FBS) 제제: 최소 필수 중간 알파(α-MEM)를 10% 태아소 혈청과 1% 페니실린 및 연쇄절제술을 보충합니다.
    2. 골성 분화 배지 의 준비: 10% 태아 소 혈청, 1% 글루타민, 1% 페니실린-스트렙토마이신, 0.20% 아스코르브산, 1% β-글리페로포산 및 0.01% dexamethasone을 가진 보충 골성 분화 기저질 배지.
    3. 골성 유도 매체의 준비: 혼합 70% α-MEM 배양 배지 (와 10% FBS) 및 30% 골성 분화 매체.
    4. 아디포겐성 분화 매체 A: 10% 태아소 혈청, 1% 글루타민, 1% 페니실린-연쇄절제술, 0.20% 인슐린, 0.10% IBMX, 0.10% 로시글리타존, 0.01% Dexamhasone.
    5. adipogenic 분화 매체 B의 준비: 보충 adipogenic 분화 기저 배지 와 10% 태아 소 혈 청, 1% 글루타민, 1% 페니실린-연쇄 절제술 및 0.20% 인슐린.
    6. 연골분균 분화 배지: 보충 연골분화 기저질 배지 0.01% 덱사메타손, 0.30% 아스코르브산, 1% ITS, 0.10% 피루바테 나트륨, 0.10% 프롤린, 1% TGF-β3.
      참고: 골성 분화 배지는 구성 후 한 달 이내에 사용해야 합니다. 구성된 연골생성 분화 배지의 유효 기간은 12h이다.

2. 쥐 mBMSC의 격리 및 재배

참고: 모든 실험 작업은 세포 생존가능성을 유지하기 위해 가능한 한 얼음에서 수행해야 합니다.

  1. 수확 쥐 하악
    1. CO2 질식에 의해 두 5 주 된 남성 스프라그 Dawley 쥐를 안락사. 실험을 진행하기 전에 동물의 호흡이 멈추는지 확인합니다.
    2. 3 분 동안 75 % 에탄올을 포함하는 비커에서 이 쥐를 헹구세요.
    3. 쥐를 깨끗한 연기 후드 안에 놓고 하악을 수확합니다.
      참고: 사용 전에 30분 동안 자외선으로 연기 후드를 살균하십시오.
    4. 쥐를 척추 위치에 놓습니다. 피부와 부치네터 근육을 양자 간 통구 오리에서 하악의 후방 부위로 절개하여 절개를 낮은 유일한 이동 가능한 뼈입니다.
      참고: 명확한 작동 필드를 얻기 위해 귤 오리스의 각 측면에 2cm 절개를 하는 것이 좋습니다.
    5. 양 엄지 손가락으로 양상악절 절개를 반대 방향으로 밀어 쥐의 입을 열어 하악에 부착된 하악치아를 노출시다.
    6. 코라코이드와 하악의 열등한 경계에 부착된 부칼 근육과 힘줄을 완전히 분리합니다.
      참고: 근육 긴장의 부족 때문에 이 단계에서 하악의 증가 이동성이 관찰됩니다.
    7. 양면의 콘딜레가 명확하게 드러나질 때까지 하악 후방 치아를 누르고 앞뒤로 회전합니다.
      참고: 이 단계는 쥐의 입을 인위적으로 열어 콩딜을 탈구할 수 있는 최대 범위까지 수행된다. 하악은 양측 콘딜레를 통해 두개골에 연결되어 있으므로 condyles의 노출은 두개골과 하악 사이의 단절로 이어집니다.
    8. 하악의 몸을 두개골과 분리합니다.
    9. 젖은 거즈를 사용하여 뼈 표면에 부착 된 연조직을 청소하십시오.
    10. 뼈를 10cm 멸균 유리 접시에 넣고 생존력을 유지하기 위해 얼음 위에 최소 필수 α(α-MEM) 또는 인산염 완충식식식(PBS)으로 채워져 있습니다.
  2. mBMSC의 격리 및 재배
    1. 하악 몸에서 첫 번째 어금니의 매혹적인 가장자리를 따라 전방 뼈를 잘라. 골수 구멍을 노출하는 세 번째 어금니의 탈반 가장자리를 따라 코라코이드와 콘딜을 포함한 하악라무스를 제거합니다.
    2. 10cm 멸균 유리 접시에 10mL의 α-MEM(10% FBS)을 채웁니다.
    3. 1mL 주사기를 사용하여 α-MEM 배양 배지를 흡인하십시오. 주사기 바늘이 골수 구멍에 삽입되어 골수를 접시에 반복적으로 플러시합니다. 뼈가 하얗게 변할 때까지 뼈의 심미적 측면과 말단 측면에서 뼈 구멍을 3회 이상 플러시하십시오.
      참고: 이것은 쥐 하악의 골수 구멍이 긴 뼈에서와 같이 명백하지 않기 때문에 가장 중요한 단계이며 바늘을 삽입하는 적절한 지점은 경험적으로 결정되어야합니다. 위의 모든 실험 샘플은 세포 생존가능성을 유지하기 위해 얼음에 저장되어야하므로 작동 시간이 2h 이상이어야합니다.
    4. 플러시 된 세포를 포함하는 매체를 15 mL 원심분리기 튜브 및 원심분리기로 5 분 동안 4 °C에서 800 x g로 전송합니다. 상부체를 폐기합니다.
    5. α-MEM의 3mL로 세포를 다시 중단합니다(10% FBS). 새로운 10cm 배양 접시에 세포를 플레이트와 5 % CO2 인큐베이터에서 37 °C에서 배양.
    6. 문화의 3 일에 이러한 세포의 형태학적 변화와 성장을 확인합니다. 비부착 세포 및 조직 단편으로 배양 배지를 제거합니다. 10% FBS를 통해 신선한 α-MEM 10mL를 부드럽게 추가합니다.
    7. 문화 7일 간 P0 mBMSC는 70%에서 80%로 합류했습니다.
  3. 플로우 셀 정렬
    참고: P0 mBMSC는 유동 셀 분류를 통해 표기적으로 확인되고 주로 정제되었다.
    1. 배양 매체를 흡인하고 폐기한 다음 PBS로 접시를 씻으십시오. PBS를 폐기합니다.
    2. 요리에 0.02 % EDTA와 0.25 %의 트립신의 1 mL을 추가합니다. 세포를 37°C에서 5분 동안 소화한 다음, α-MEM 2mL(10% FBS)를 추가하여 반응을 중지합니다.
    3. 세포 현탁액을 15mL 원심분리기 튜브와 원심분리기로 5분 동안 800 x g로 옮긴다.
    4. 원심 분리 후 PBS의 120 μL (10 % FBS)에서 세포를 다시 중단합니다.
    5. 15 분 동안 4 °C에서 CD16 / CD32에 대한 항체의 1 μL로 이러한 세포 현탁액을 차단하십시오.
    6. 세포 현탁액의 100 μL을 새로운 미세 원심 분리튜브로 옮기고, CD45에 대한 피코에리스린(PE)-컨쥬게이드 항체, CD90 및 알로피코시아니아닌(APC)-공주 항체에 대한 피코에리스린(PE)-컨쥬게이드 항체를 가진 세포를13,15에서1°C에 4°C로 염색하였다. 본 실험에 사용되는 항체의 농도는 표 2에도시된다. 다른 20 μL의 세포 현탁액을 얼룩지지 않은 음극으로 사용하십시오.
    7. 그런 다음 5 분 동안 800 x g에서 튜브를 원심 분리하고 서스펜션을 폐기하고 PBS의 0.5 mL (10 % FBS)에서 세포를 다시 일시 중단합니다.
    8. 분석 전에 10 분 동안 0.01 mg / mL DAPI의 10 μL을 추가합니다.
    9. 원심분리기 튜브에 배치된 40nm 필터를 사용하여 세포를 필터링합니다.
    10. 형광 활성화 셀 선별기에서 세포를 분석합니다. 패널을 다음과 같이 설정합니다. 첫째, DAPI-세포를 게이팅하여 총 세포 수에서 죽은 세포를 제거한 다음 CD29+CD90+CD45를 대상으로 한 mBMSC로서 선택된 세포에서 제거합니다.
    11. 정렬된 CD29+CD90+CD45- 셀을 3mL의 α-MEM(10% FBS)이 미리 준비된 15mL 원심분리기 튜브로 수집합니다.
    12. 5 분 동안 800 x g에서 튜브를 원심 분리합니다. 컬렉션 버퍼를 제거하고 10%의 FBS가 있는 신선한 α-MEM 1mL을 추가하여 셀을 다시 일시 중지합니다. 그런 다음 6cm 문화 요리에 접시를 접시에 담아 놓습니다.

3. 식민지 형성 능력

참고: 이 단계는 mBMSC의 분할 능력을 확인하기 위해 수행되었습니다. 15

  1. 이 실험에 대해 두 번째 통로 mBMSC(P2)를 선택합니다. 세포 합류가 80%에서 90%에 도달하면, 6웰 플레이트의 직렬 그라데이션에서 세포를 재시드하여 클로날 증식 능력을 평가합니다.
    참고: 그라데이션을 1 x 102에서 1 x 103 세포로 설정하는 것이 좋지만 인간 또는 동물 기원의 상이한 세포주의 최종 희석은 경험적으로 결정되었습니다.
  2. α-MEM에서 세포를 배양 (와 10% FBS) 식민지 형성 단위의 좋은 수가 빛 현미경에서 볼 수 있을 때까지 약 2 주 동안. 3일마다 배양 매체를 새로 고칩니다.
  3. 배양 배지를 흡기하고 폐기하고, PBS로 우물을 한 번에 5분 동안 두 번 씻는다. 다음으로 각 웰에 4 % 파라포름 알데히드 솔루션을 추가하고 적어도 10 분 동안 수정합니다.
  4. 파라포름알데히드를 제거하고 PBS로 우물을 두 번 헹구는 다.
  5. 크리스탈 바이올렛 염색 용액으로 세포를 염색하고 약 10 분 동안 37 °C로 배양하십시오.
    참고: 원하는 음영이 이루어질 때까지 염색 시간이 적절하게 조정되었습니다.
  6. 염색 용액을 제거하고 샘플을 증류수로 씻어 반응을 중지합니다.
  7. 입체 현미경의 밑에 심상 및 적어도 50개의 세포로 구성된 흩어진 세포 식민지를 계산합니다.

4. mBMSC의 다중 리니지 차별화

참고: P2 mBMSC는 달리 설명되지 않는 한 후속 실험에 사용되었습니다.

  1. mBMSC의 골성 유도
    1. 위에서 설명한 대로 mBMSC를 소화합니다. 종자 세포는 1mL α-MEM(10% FBS)으로 보충된 12개의 웰 플레이트에서 2.5 x 105/cm2의 밀도로.
    2. 세포 합류가 60-70%에 도달하면 배지를 30%의 골성 유도 매체로 변경합니다. α-MEM(10%의 FBS)을 가진 세포를 음수 대조군으로 배양하고 2일마다 배지를 변경합니다.
      참고: 골발생 시 칼슘 요절이 많이 나타난 후, 중간 교환 패턴을 2일마다 반부량의 중간 교환으로 변경하여 골세포가 떠다니는 것을 방지하는 것이 좋습니다.
    3. 7일 동안 배양한 후, 알칼리성 인산염염색(16,17)에의해 이들 세포의 석회화를 평가한다.
    4. 배양 배지를 제거하고 10 분 동안 4 % 파라 포름 알데히드로 세포를 고정하십시오. 잘 1mL의 PBS를 사용하여 세포를 헹구고 3 분 동안 두 번.
    5. 그런 다음 알칼리성 인산염 염색 용액으로 세포를 염색하고 10-30 분 동안 37 °C에서 배양합니다.
      참고: 필요한 색상을 얻기 위해 실온에서 하룻밤 동안 배양할 수 있습니다.
    6. 우물을 증류수로 씻어 반응을 멈춥시다. 가벼운 현미경으로 사진을 찍습니다. 적색 색소 과립은 알칼리성 인산염 (ALP) 활성을 나타냅니다.
    7. 나머지 세포를 7일 동안 배양한 후, 알리자린 적색 염색을 수행하여 세포의 광물화 능력을 평가한다.
    8. 세포 고정 후 0.5% 알리자린 적색 염색 용액으로 세포를 10분16,18에염색한다. 3-5 분 후에 증류수로 염색체 반응을 중단하십시오.
      참고: 개발된 색상에 따라 반응 시간을 연장할 수 있습니다.
    9. 마지막으로, 배양판을 빛 현미경 아래에 놓아 골성 염색효과를 관찰한다. 붉은 목절은 이 세포의 칼슘 퇴적물을 나타냅니다.
  2. mBMSC의 유도
    1. 상기와 같이 12웰 플레이트에서 종자 P2 mBMSC.
    2. 웰이 90% 컨서크후, 반포성 분화 배지A를 가진 세포를 배양하여 α-MEM 배양 배지(10% FBS)에서 배양된 세포를 음수 대조군으로 사용한다.
    3. 유도 2일 후, 배지 A를 우물에서 흡인시키고 각 웰에 1mL의 비원성 분화 매체 B를 첨가한다.
    4. 하루 후, 중간 크기 B를 제거하고 우물에 다시 추가 된 중간 A와 함께 다시 주기를 시작합니다. 중간 크기 A 및 B를 사용하여 세포를 번갈아 배양합니다.
    5. 분화 배지 A와 B를 3주기동안 번갈아 적용하고 오일 레드 O 염색16,18에의해 이들 세포의 분리 발생을 검출한다.
      참고: 둥근 및 큰 지질 방울의 제비는 추가 2 3 일 동안 분화 매체 B로 이 세포를 배양하여 관찰될 수 있습니다.
    6. 배지를 제거하고 10 분 동안 4 % 파라 포름 알데히드로 세포를 고정합니다. PBS로 셀을 씻어내라.
    7. 오일 레드 O 염색 용액으로 세포를 염색하고 약 3 분 동안 37 °C에서 배양합니다.
    8. 염색 용액을 제거하고 증류수로 우물을 씻으시다.
    9. 빛 현미경으로 사이포발생을 관찰한다.
  3. mBMSC의 연골 발생 유도
    1. 종자 P2 mBMSC 15 mL 원심분리기 튜브에서 5 x 105/cm2의밀도.
    2. 300 x g에서 5 분 동안 튜브를 원심 분리합니다. 상부체를 폐기합니다.
    3. 연골분화 배지의 0.5 mL로 세포를 다시 중단한다. 세포를 300 x g에서 5 분 동안 원심 분리합니다.
    4. 원심분리기 튜브의 캡을 풀고 5% CO2 인큐베이터에서 37°C에서 배양합니다. 매 2일마다 매체를 갱신합니다.
      참고: 세포는 24시간 후에 펠릿을 시작합니다. 원심분리기 튜브를 48h로 옮기지 않는 것이 좋습니다. 매체를 변경할 때 세포 펠릿을 흡인하지 않도록 주의하십시오.
    5. 유도 21 일 후, 탈수, 파라핀 포함 및 단면다음 4 % 파라 포름 알데히드로 세포 펠릿을 수정합니다.
    6. 탈파화 및 수분 공급 후, 알시안 블루 용액의 슬라이드를 최소 15분18,19,20,21에염색한 다음 증류수로 씻어 반응을 중지합니다. 가벼운 현미경으로 사진을 캡처합니다.
    7. 콜라겐 타입 II의 면역 형광 염색의 경우, 아래 단계를 수행하십시오.
      1. 5 μg/mL 단백질Ase K로 슬라이드를 37°C에서 15분 동안 배양하여 데파라피화 및 수분 화 단계 후 배양합니다.
      2. 슬라이드를 블로킹 버퍼에서 37°C에서 1h로 배양합니다.
      3. 콜라겐 형 II 항체의 1 μL을 슬라이드에 블로킹 버퍼의 200 μL에 적용하고 4 °C에서 하룻밤 동안 배양하십시오.
      4. 다음 날, PBS로 슬라이드를 두 번 세척하고 1 시간 동안 37 °C에서 이차 항체로 배양하십시오.
      5. 슬라이스를 40,6-디아미티노-2-페닐린돌(DAPI)으로 10분 간 배양합니다.
    8. 형광 현미경 검사의 밑에 각 슬라이드의 사진을 찍습니다.

5. 실시간 PCR

  1. 구아니듐 이소티오카네이트 기반의 시판제를 사용하여 mBMSC로부터 총 RNA를 추출한다.
  2. 상용 키트를 사용하여 상호 보완적인 DNA로 RNA의 역 전사를 수행합니다. 역전사의 반응 조건은 다음과 같이: 5분 동안 65°C, 15분 동안 37°C, 15s에 대한 85°C.
  3. 표 3에 나열된 프라이머를 사용하여 골발생 및 사이포발생 특이적 유전자를 검출하기 위해 실시간 PCR을 수행한다. PCR 증폭 절차는 다음과 같이: 5 분 동안 95 °C. 5 초에 대한 95 °C, 40 사이클에 대한 30 초에 대한 60 °C.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

이 프로토콜을 사용하여, 세포의 큰 비율은 초기 배양 후 3 일에 플레이트에 부착. 전형적으로, 추가 3-4일 배양 후, 세포 합류는 70~80%(도1B)에도달하였다. 형광 세포 분류, DAPI-CD29+CD90+CD45- mBMSC는 P0 세포에서 약 81.1 %를 차지하는18,22를정제하였다(도 1C).

P2 mBMSC를 100세포에서 100개의 세포에 1주일 동안 6웰 플레이트씩 파종한 후, 상당한 양의 콜로니 형성 유닛이 관찰되어 mBMSC(도1D)의중요한 식민지 형성 능력을 시사했다.

다중 계측 분화 능력을 평가하기 위해 mBMSC는 각각 12개의 웰 플레이트에서 골조, 콘드로-및 아디포 계보로 유도되었다. mBMSC는 강한 골성 분화 능력을 표시했습니다. ALP의 증가된 활성, 적색 석회화 결절은 알리자린 붉은 염색 하에 산발적으로 분포하고, 골성 특이적 유전자 Runx2, Alp, BspOcn(그림 2)의발현이 증가하여 에스토제닉 유도를 나타냈다. 오일-레드-오 스테인링에 의해 확인된 아디포게네스의 경우, 9일간의 유도 후 수많은 지질이 풍부한 바쿠올이 분명하게 드러났습니다. 마찬가지로, 비포겐성 특이유전자Pparγ1세바의 발현은 유의한 증가를 보였다(도3). 연골분화 분화 슬라이드의 현미경 관찰을 위해, 샘플은 알시안 블루에 대한 긍정적 인 염색을 보였다. 또한, 항형 II 콜라겐 항체를 가진 면역염색은 연골 매트릭스(도4)의축적이 강화된 것으로 나타났다.

문화 매체 구성 요소 최종 농도
1.α-MEM 배양 매체(FBS 10% 기준) 최소 α 필수 매체
태아 소 혈청 10%
페니실린과 연쇄상 구균 1%
2.골성 유도 매체 α-MEM 배양 매체(10%FBS) 70%
골성 분화 분화 매체 30%
3.골성 분화 매체 골성 분화 기저형
태아 소 혈청 10%
글루타민 1%
페니실린-연쇄절제술 1%
아스코르브 산 0.20%
β-글리세로포산염 1%
덱사메타손 0.01%
4.아디포제닉 분화 매체 A 아디포겐성 분화 기저형
태아 소 혈청 10%
글루타민 1%
페니실린-연쇄절제술 1%
인슐린 0.20%
IBMX 0.10%
로시글리타존 0.10%
덱사메타손 0.01%
5.아디포제닉 분화 매체 B: 아디포겐성 분화 기저형
태아 소 혈청 10%
글루타민 1%
페니실린-연쇄절제술 1%
인슐린 0.20%
6.콘드로겐성 분화 매체: 연골분화 분화 기저
덱사메타손 0.01%
아스코르브 산 0.30%
1%
피루바테 나트륨 0.10%
프롤린 0.10%
TGF-β3 1%

표 1: 배양 배지 및 분화 매체의 구성 요소입니다.

항체 농도
CD90.1 (Thy-1.1) 단일 클론 항체 0.5mg/mL
CD45 모노클로날 항체 0.2mg/mL
CD29 항체 0.2mg/mL
콜라겐II 토끼 폴리클로날 항체 5mg/mL
염소 안티 래빗 IgG H&L (알렉사 플루어® 488) 1mg/mL

표 2: 이 연구에서 사용되는 항체 농도.

입문서 시퀀스(5' ~ 3')
GAPDH Foward: CGGCAAGTTCAACAGAGAGAGAGAGAGAGAGAG
역: 아가카타카크
런크스2 포드: GCCTTCAAGGTTGTAGCCCT
역: TGAACCTGGCCACTTGGTTTT
알프 Foward: AAACTCGCTTATGGCCGCCG
역: TGGGTTTGAATTCCTGCGGT
BPS 포워드: GCACGGTTGAGTATGGG가아
역: ATCCTGACCCTCGTAGCCTT
옥시 (주) 포워드:카카카에트GTGACGAGC
역:GGCAACACATCCTAAAAACG
세바 (주) 포워드: 아그트CG그가타카카가아카가아
역: CGGTCATTGTCACTGTCAACTCC
Pparγ1 포드: CCATCGAGACATCCAAGACC
역: GTGCTCTGTGAATCTGCCTGAG

표 3: 실시간 PCR에 사용되는 프라이머.

Figure 1
그림 1: mBMSC의 격리 및 문화. (A)프로토콜의 회로도. mBMSC는 0일째에 고립되고 도금되어 α-MEM 배양 배지로 배양되었습니다. 7일째, P0 mBMSC는 유동 세포 선별을 통해 정제되었고, 선별된 세포는 새로운 배양 접시에 도금되었다. 14일, P1 mBMSC는 12웰 플레이트에 도금을 수집하고 도금했습니다. 15일, P2 mBMSC는 해당 유도 배지하에서 골세포, 아디포겐성 세포 및 연골폭발로 유도되었다. (B)P0 mBMSC의 쥐 하악골 골수 및 현미경 관찰의 회로도 모델. (C)쥐 mBMSC의 흐름 세포측정 분류. 유동 세포 분석은 이러한 세포가 CD29 및 CD90에 대해 양성이었지만 BMSC 특성과 일치하는 CD45에 대해 음수했다는 것을 보여줍니다. 이들 중, 1.4 x 106 세포가 정렬되어 전체 세포의 80 %를 적절히 차지했습니다. (D)크리스탈 바이올렛 스테인드 P2 mBMSC 클론의 대표적인 이미지. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Figure 2
그림 2: mBMSC의 골성 분화 잠재력. (A)골성 유도 7일 후 ALP 활동의 변화가 가시화되었다. 많은 수의 미네랄화된 결절은 골성 분화의 유도 후 14일 후에 알리자린 붉은 염색 하에 염색되었다. (B,C) ALP와 알리자린 레드 스테인닝의 양수는 이미지 J 소프트웨어를 사용하여 평가하였다. (C-G) 골세포 특이적 마커 Runx2, Alp, BspOcn의 mRNA 발현은 골발생 7일 후에 크게 증가하였다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Figure 3
그림 3: 유도 9일 후 mBMSC의 비대화 분화 가능성. (A)많은 양의 지질 방울 형태와 아디포세포가 오일-레드-O에 의해 염색되었다. (B,C) 선포원성 마커 세bpa와 Pparγ1의 mRNA 발현은 9일간의 사이포발생 후 현저하게 증가하였다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Figure 4
그림 4: 연골분분화 효과의 입체보기. (A)mBMSC는 21일 후 연골성 유도가 알시안 블루 염색에 대해 양성 반응을 보였다. (B)항형 II 콜라겐으로 염색된 연골골 골재의 면역형 이미지. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

이 프로토콜은 전체 골수 준수 및 형광 세포 분류를 결합하여 체외에서 쥐 하악에서 BMSC를 분리하는 방법을 설명하며, 이는 강력한 분화 능력으로 증식 mBMSC를 얻을 수있는 간단하고 신뢰할 수있는 방법입니다. 이 방법은 유동 셀 정렬에 의해 mBMSC를 예열적으로 정화할 수 있지만 세포 균질성에 대한 요구 사항이 더 높은 경우 보다 정확한 정제 방법이 필요할 수 있습니다.

현재, 전체 골수 준수, 밀도 그라데이션 원심 분리, 형광 세포 분류 및 자기 활성화 셀 정렬22를포함하여 mBMSC를 분리하는 데 사용되는 네 가지 주요 기술이 있다. 전체 골수 준수 및 밀도 그라데이션 원심 분리는 짧은 시간에 mBMSC를 얻기 위해 사용되는 가장 일반적이고 쉬운 방법이지만, 수확 된 mBMSC의 낮은 순도는 그들의 주요 단점이다. 마지막 두 가지 방법은 면역 학적 기술을 통해 고도로 정제 된 mBMSC를 분리 할 수 있지만, 오랜 시간을 복용하고 세포 생존을 손상, 비싼의 단점이있다. 이 연구에서는 전체 골수 준수 및 형광 세포 선별 방법의 장점이 결합되어 짧은 시간에 증식 성 mBMSC의 충분한 수를 얻었다.

의심 할 여지없이,이 프로토콜에서 가장 중요한 단계 중 하나는 쥐 하악의 해부입니다, 이는 축과 부속 뼈의 것과 매우 구별된다. 그대로 샘플을 얻기 위해 쥐 하악의 해부학을 이해하는 것이 필수적입니다. 인간과 마찬가지로 쥐 하악은 맥실라 아래에 앉아 아래 치아를 제자리에 잡고 양측 콘딜레에 의해 두개골에 연결되어 있습니다. 하악은 두개골에서 움직일 수있는 유일한 뼈이기 때문에 하악에 부착 된 많은 근육이 있어 움직임을 제어합니다. 이러한 연조직을 완전히 제거하고 입을 최대로 열어 두면 두개골과 연결되는 콘딜이 노출될 수 있습니다. 또한 condylar 목은 하악의 신체적 약점이며 골절이 쉽다는 것을 언급 할 가치가 있습니다. 하악을 아래쪽으로 회전할 때 과도한 저항이 발견되면 매스틱 근육이 완전히 제거되지 않을 수 있음을 의미합니다. 이 관찰될 때, 구속적으로 회전하지 말고, 그렇지 않으면 세포 오염으로 이어지는 콘딜라 목을 부러뜨리기 쉽습니다. mBMSC의 분리 및 배양에 있는 그밖 어려움은 골수에 있는 낮은 함량, 섬세한 세포 활동, 낮은 순도, 낮은 세포 주파수 및 조혈 세포의오염을 포함합니다 18,23. 좋은 성장과 상대적으로 높은 차별화 잠재력을 가진 mBMSC를 얻으려면 mBMSC의 활동을 보장하는 것이 매우 중요합니다. 젊은 쥐는 좋은 생존력을 유지하는 것이 선호되기 때문에, 이 것과 후속 실험을 위한 4 주 된 쥐의 사용을 포함하여 몇몇 중요한 단계가 있습니다. 많은 연구는 mBMSC의 활동이 실험 동물의 나이와 관련이 있음을 확인했다. 이전 기증자에서 그 mBMSC는 낮은 확산 활동, 분화 잠재력 및 수명 범위2귀착될 수 있습니다. 세포 수확 시 모든 작업을 얼음에서 완료해야 하며 작동 시간은 가능한 한 짧아야 하며, 바람직하게는 2시간 이내에 있어야 합니다. 또한 트립신 소화 시간을 3분 이상 유지합니다. 마지막으로, 이 프로토콜의 또 다른 과제는 mBMSC를 수확하는 과정입니다. 쥐 하악의 공동은 매우 작기 때문에 뼈 구멍에서 mBMSC를 플러시하는 것이 번거로울 수 있으므로 해부학 적 구조에 익숙해지는 것이 매우 중요합니다. 마이크로 CT 이미지는이 점에서 큰 도움이 될 수 있습니다. 게다가, 그것은 청소년 뼈가 날씬하 고 취성 으로 주목할 가치가 있다, 파손 오염 발생할 수 있습니다.

면역 페노티픽 특성화를 언급, BMSC는 여러 표현형을 표현하지만, 그 중 어느 것도 그들에 특정하지않습니다 24. 일반적으로 BMSC는 CD11b, CD14, CD34 또는 CD45를 표현하지 않지만 Sca-1, CD29, CD90 및 CD105의 높은 발현을 갖는 것으로 인정됩니다. 본 연구는 형광세포분류13, 14,25에 대해 CD29, CD90 및CD45의널리 인정된 마커를 선택했다. 그것은 CD29+CD90+CD45- 세포가 후속 세포 배양 및 연구에 충분했던 총 세포의 적절하게 80 %를 차지한다는 것을 발견했습니다.

수십 년 동안 줄기 세포 치료는 면역 계통 질환, 혈액 학적 전신 질환, 암 또는 외상과 같은 다양한 질병의 치료에 널리 사용됩니다. 의심 할 여지없이, mBMSC는 BMSC를 대체하기 때문에 우수한 특성으로 인해 줄기 세포 치료에서 안전하고 강력한 도구로 사용할 수 있습니다. 따라서, 세포 배양 및 mBMSC의 확장은 처리를 위한 세포의 충분한 수를 얻기 위하여 특히 중요하게 됩니다.

요약하자면, 이 연구는 단기간에 높은 균질성과 다분화 능력을 가진 풍부한 mBMSC를 수확하기 위한 유망하고 신뢰할 수 있는 프로토콜을 보여주었습니다.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

모든 저자는 이해 상충이 없다고 말합니다.

Acknowledgments

상하이 9대 인민병원의 두개안면 이상에 대한 디지털화된 스토마토로지 연구센터의 도움을 주셔서 감사합니다. 이 원고의 작품은 중국 국립 자연과학재단(NSFC)[81570950,81870740,81800949]의 보조금으로 지원되고, 상하이 서밋 & 고원 분야, 상하이 정밀 의학 연구소, 상하이 9인조 병원, 상하이 자오동 의과대학 [JC201809], 상하이 자오동 대학 의과대학 고원혁신팀 인센티브 프로젝트. L.J.는 우수 청소년 의료 인재, 상하이 "의학 재능의 떠오르는 별" 청소년 개발 프로그램 및 상하이 자오퉁 대학의 "첸 싱" 프로젝트의 학자입니다.

Materials

Name Company Catalog Number Comments
0.25% Trypsin-EDTA(1X) Gibco 25200072
10cm culture dish Corning
acutenaculum
Adipogenic differentiation medium Cyagen biosciences inc. MUBMX-90031
Alcian Blue Beyotime Biotechnology
Alizarin red Sigma-Aldrich A5533
Alkaline Phosphatase Color Development Kit Beyotime Biotechnology C3206
alpha-Minimum essential medium GE Healthcare HyClone Cell Culture SH30265.01B
Anti -CollagenII Rabbit pAb Abcam ab34712
Antibodies against CD16/CD32
Antifade Mounting Medium with DAPI Beyotime Biotechnology P0131
APC anti-mouse/rat CD29 Antibody biolegend inc 102215
Biosafety cabinet Esco AC2-4S8-CN
CD45 Monoclonal Antibody (OX1), PE, eBioscience Invitrogen 12-0461-82
CD90.1 (Thy-1.1) Monoclonal Antibody (HIS51), FITC, eBioscience Invitrogen 11-0900-85
Centrifuge cence L500
Chondrogenesis differentiation medium cyagen biosciences inc.
Confocal laser scanning microscope Zeiss LSM880
Countess II FL Automated Cell Counter Invitrogen AMQAF1000
Crystal Violet Staining Solution Beyotime Biotechnology C0121
Fetal Bovine Serum GE Healthcare HyClone Cell Culture SH30084.03
Goat Anti-Rabbit IgG H&L (Alexa Fluor 488) abcam ab150077
Incubator Esco CCL-170B-8
Inverted microscope olympus CKX53
Magzol reagent(Trizol reagent) Magen
micropipettor Eppendorf
Oil Red O
Osteogenic differentiation medium cyagen biosciences inc. MUBMX-90021
Penicillin-Streptomycin Gibco 15070063
Phosphate-buffered saline(1X) Gibco 20012027
PrimeScript RT Master Kit TakaRa Bio Inc RR036A
Proteinase K Sigma-Aldrich P6556
QuickBlock Blocking Buffer Beyotime Biotechnology P0260
scissor
SYBR1 Premix TakaRa Bio Inc
Toluidine Blue Beyotime Biotechnology
Trypan Blue Solution, 0.4% Gibco 15250061

DOWNLOAD MATERIALS LIST

References

  1. Jin, C., et al. Stem cell education for medical students at Tongji University: Primary cell culture and directional differentiation of rat bone marrow mesenchymal stem cells. Biochemistry and Molecular Biology Education. 46, (2), 151-154 (2018).
  2. Chu, D. T., et al. An Update on the Progress of Isolation, Culture, Storage, and Clinical Application of Human Bone Marrow Mesenchymal Stem/Stromal Cells. International Journal of Molecular Sciences. 21, (3), 708 (2020).
  3. Jin, Z., Chen, J., Shu, B., Xiao, Y., Tang, D. Bone mesenchymal stem cell therapy for ovariectomized osteoporotic rats: a systematic review and meta-analysis. BMC Musculoskeleton Disorder. 20, (1), 556 (2019).
  4. Jiang, Y., et al. Pluripotency of mesenchymal stem cells derived from adult marrow. Nature. 418, (6893), 41-49 (2002).
  5. Musina, R. A., Bekchanova, E. S., Belyavskii, A. V., Sukhikh, G. T. Differentiation potential of mesenchymal stem cells of different origin. Bulletin of Experimental Biology and Medicine. 141, (1), 147-151 (2006).
  6. Lloyd, B., et al. Similarities and differences between porcine mandibular and limb bone marrow mesenchymal stem cells. Archives in Oral Biology. 77, 1-11 (2017).
  7. Zhang, W., et al. Comparison of the use of adipose tissue-derived and bone marrow-derived stem cells for rapid bone regeneration. Journal of Dental Research. 92, (12), 1136-1141 (2013).
  8. Stefanik, D., et al. Disparate osteogenic response of mandible and iliac crest bone marrow stromal cells to pamidronate. Oral Disorders. 14, (5), 465-471 (2008).
  9. Aghaloo, T. L., et al. Osteogenic potential of mandibular vs. long-bone marrow stromal cells. Journal of Dental Research. 89, (11), 1293-1298 (2010).
  10. Kaigler, D., et al. Stem cell therapy for craniofacial bone regeneration: a randomized, controlled feasibility trial. Cell Transplantation. 22, (5), 767-777 (2013).
  11. Li, C., Wang, F., Zhang, R., Qiao, P., Liu, H. Comparison of proliferation and osteogenic differentiation potential of rat mandibular and femoral bone marrow mesenchymal stem cells in vitro. Stem Cells Development. 2020, 1941629 (2020).
  12. Matsubara, T., et al. Alveolar bone marrow as a cell source for regenerative medicine: differences between alveolar and iliac bone marrow stromal cells. Journal of Bone and Mineral Research. 20, (3), 399-409 (2005).
  13. Chan, C. K. F., et al. Identification of the Human Skeletal Stem Cell. Cell. 175, (1), 43-56 (2018).
  14. Bianco, P., Riminucci, M., Gronthos, S., Robey, P. G. Bone marrow stromal stem cells: nature, biology, and potential applications. Stem Cells. 19, (3), 180-192 (2001).
  15. Franken, N. A., Rodermond, H. M., Stap, J., Haveman, J., van Bree, C. Clonogenic assay of cells in vitro. Nature Protocol. 1, (5), 2315-2319 (2006).
  16. Xu, H., et al. Icariin prevents oestrogen deficiency-induced alveolar bone loss through promoting osteogenesis via STAT3. Cell Proliferation. 53, (2), 12743 (2020).
  17. Zhang, P., Wu, Y., Jiang, Z., Jiang, L., Fang, B. Osteogenic response of mesenchymal stem cells to continuous mechanical strain is dependent on ERK1/2-Runx2 signaling. Internation Journal of Molecular Medicine. 29, (6), 1083-1089 (2012).
  18. Zhu, H., et al. A protocol for isolation and culture of mesenchymal stem cells from mouse compact bone. Nature Protocol. 5, (3), 550-560 (2010).
  19. Lach, M. S., et al. Chondrogenic Differentiation of Pluripotent Stem Cells under Controllable Serum-Free Conditions. International Journal of Molecular Sciences. 20, (11), 2711 (2019).
  20. Huang, X., Zhong, L., Hendriks, J., Post, J. N., Karperien, M. The Effects of the WNT-Signaling Modulators BIO and PKF118-310 on the Chondrogenic Differentiation of Human Mesenchymal Stem Cells. International Journal of Molecular Sciences. 19, (2), 561 (2018).
  21. Gale, A. L., Linardi, R. L., McClung, G., Mammone, R. M., Ortved, K. F. Comparison of the Chondrogenic Differentiation Potential of Equine Synovial Membrane-Derived and Bone Marrow-Derived Mesenchymal Stem Cells. Frontiers in Veterinary Sciences. 6, 178 (2019).
  22. Li, X., Zhang, Y., Qi, G. Evaluation of isolation methods and culture conditions for rat bone marrow mesenchymal stem cells. Cytotechnology. 65, (3), 323-334 (2013).
  23. Kagami, H., Agata, H., Tojo, A. Bone marrow stromal cells (bone marrow-derived multipotent mesenchymal stromal cells) for bone tissue engineering: basic science to clinical translation. International Journal of Biochemistry and Cell Biology. 43, (3), 286-289 (2011).
  24. Chamberlain, G., Fox, J., Ashton, B., Middleton, J. Concise review: mesenchymal stem cells: their phenotype, differentiation capacity, immunological features, and potential for homing. Stem Cells. 25, (11), 2739-2749 (2007).
  25. Abdallah, B. M., Alzahrani, A. M., Abdel-Moneim, A. M., Ditzel, N., Kassem, M. A simple and reliable protocol for long-term culture of murine bone marrow stromal(mesenchymal) stem cells that retained their in vitro and in vivo stemness in long-term culture. Biology Proceedings Online. 21, 3 (2019).
쥐에 있는 간골 골수 관진 줄기 세포의 격리 그리고 경작
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Hong, Y., Xu, H., Yang, Y., Zhou, S., Jin, A., Huang, X., Dai, Q., Jiang, L. Isolation and Cultivation of Mandibular Bone Marrow Mesenchymal Stem Cells in Rats. J. Vis. Exp. (162), e61532, doi:10.3791/61532 (2020).More

Hong, Y., Xu, H., Yang, Y., Zhou, S., Jin, A., Huang, X., Dai, Q., Jiang, L. Isolation and Cultivation of Mandibular Bone Marrow Mesenchymal Stem Cells in Rats. J. Vis. Exp. (162), e61532, doi:10.3791/61532 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter