Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Medicine

Isolamento e Cultivo de Células-Tronco Mesenquimais de Medula Óssea Mandibular em Ratos

doi: 10.3791/61532 Published: August 25, 2020
* These authors contributed equally

Summary

Este artigo apresenta um método que combina a adesão total da medula óssea e a classificação da citometria de fluxo para isolar, cultivar, classificar e identificar células-tronco mesenquimais de medula óssea a partir de mandíbulas de ratos.

Abstract

Aqui apresentamos um método eficiente para isolar e culminar células-tronco mesenquimais de medula óssea mandibular (mBMSCs) in vitro para obter rapidamente numerosas células de alta qualidade para requisitos experimentais. os mBMSCs poderiam ser amplamente utilizados em aplicações terapêuticas como células de engenharia tecidual no caso de doenças craniofaciais e regeneração cranio-maxilofacial no futuro devido à excelente capacidade de autoconexão e potencial de diferenciação de multi-linhagem. Por isso, é importante obter mBMSCs em grande número.

Neste estudo, a medula óssea foi liberada da mandíbula e os MBMSCs primários foram isolados através de todo o cultivo adepto da medula óssea. Além disso, CD29+CD90+CD45 mBMSCs foram purificados através da classificação celular fluorescente. A segunda geração de mBMSCs purificados foi utilizada para estudos mais aprofundados e apresentou potencial na diferenciação de osteoblastos, adipócitos e condrócitos. Utilizando esse modelo in vitro, pode-se obter um alto número de mBMSCs proliferativos, o que pode facilitar o estudo das características biológicas, a reação subsequente ao microambiente e outras aplicações de mBMSCs.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

As células-tronco mesenquimais de medula óssea (BMSCs) são células-tronco não hematopoiéticas derivadas da medula óssea que manifestam forte capacidade de proliferação e potencial de diferenciação de multi-linhagem1,2,3,4. De fato, os BMSCs têm sido considerados como um candidato ideal para engenharia e regeneração de tecidos ósseos desde que foram descobertos. Durante anos, a crista ilíaca ou ossos longos, como a tíbia e o fêmur, têm sido a fonte mais comum de BMSCs para regeneração craniofacial. No entanto, os BMSCs orofacial, como os BMSCs mandibulares (mBMSCs), apresentam algumas diferenças em relação aos BMSCs longos, como diferentes padrões de origem embrionária e de desenvolvimento. As mandíbulas surgem de células de crista neural da camada germe neuroectoderm e sofrem ossificação intramembana, enquanto esqueletos axial e appendicular são do mesoderme e sofrem ossificação endocondral. Além disso, observações clínicas e estudos experimentais em animais têm consistentemente indicado que há diferenças funcionais entre os BMSCs orofacial e ilíaca5,6,7,8. Relatos mostraram que os BMSCs derivados de ossos craniofaciais como mandíbula, osso maxilar e osso alveolar apresentaram proliferação superior, tempo de vida e capacidade de diferenciação do que os dos ossos axiais e appendiculares9. os mBMSCs, portanto, são considerados os recursos preferidos para futuras aplicações terapêuticas de doenças craniofaciais como querubismo, tumor de mandíbula, osteoporose do osso da mandíbula e defeito do tecido periodontal10,11,12. Para entender o potencial de tratamento em experimentos pré-clínicos, é essencial estabelecer um método para isolar e culminar rapidamente os MBMSCs in vitro.

Neste estudo, o objetivo foi obter mBMSCs purificados por adesão integral da medula óssea e triagem de citometria de fluxo. A morfologia anatômica da mandíbula de rato, claramente observada através de tomografia microcomputífica (Micro-CT) e seções histológicas, mostrou que o osso trabecular da mandíbula estava entre o espaço medular incisivo e o osso alveolar. A medula óssea do osso trabecular foi lavada para obter células de medula mandibular, mas as células cultivadas dessa forma não eram mBMSCs puras e provavelmente consistiam em múltiplos tipos de células com potências incertas e diversas linhagens como células de células ósseas, gordas e endoteliais13,14. O próximo passo da purificação celular foi particularmente importante. A citometria de fluxo filtra as células reconhecendo uma combinação de proteínas da superfície celular e tem sido amplamente adotada no enriquecimento de células-tronco mesenquimais. A homogeneidade celular é a principal vantagem da citometria de fluxo, mas o processo não determina a viabilidade celular e pode resultar em um rendimento celular limitado. Neste estudo, os P0 mBMSCs obtidos a partir da adesão total da medula óssea foram classificados por citometria de fluxo para obtenção de mBMSCs com alta pureza e forte capacidade de proliferação.

Este estudo introduz um protocolo reprodutível e confiável para isolamento, cultura e diferenciação de BMSCs mandibulares de ratos usando uma combinação de adesão total da medula óssea e classificação de citometria de fluxo. É um método confiável e conveniente para pesquisadores em áreas relacionadas a usar.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Todos os procedimentos experimentais animais neste artigo foram aprovados pelo Comitê de Cuidados Com Animais do Hospital do Nono Povo de Xangai, Shanghai Jiao Tong University School of Medicine.

1. Preparação

  1. Use dois ratos de 5 semanas de idade, Sprague Dawley, para o experimento.
  2. Esterilize todos os instrumentos, incluindo porta-agulhas, pinças e tesouras em alta temperatura ou imerso em 75% de etanol por 10 minutos.
    NOTA: A imersão do etanol não deve demorar muito para evitar danos celulares.
  3. Prepare previamente os meios de comunicação culturais, da qual a composição está prevista na Tabela 1. Suplemente cada meio descrito abaixo.
    1. Preparação de α-MEM médio cultural (com 10% FBS): Suplementação mínimo de alfa médio essencial mínimo (α-MEM) com soro bovino fetal de 10% e 1% penicilina e estreptomicina.
    2. Preparação do meio de diferenciação osteogênica: Suplemento de diferenciação osteogênica meio basal com soro bovino fetal de 10%, 1% glutamina, 1% penicilina-estreptomicina, 0,20% ácido ascórbico, 1% β-glicosfatosfato e 0,01% de dexametasona.
    3. Preparação do meio de indução osteogênica: Misture 70% α-MEM meio de cultura (com 10% FBS) e 30% de meio de diferenciação osteogênica.
    4. Preparação do meio de diferenciação adipogênica A: Suplemento de diferenciação adipogênica meio basal com soro bovino fetal de 10%, 1% glutamina, 1% penicilina-estreptomicina, 0,20% insulina, 0,10% IBMX, 0,10% Rosiglitazone e 0,01% Dexametasona.
    5. Preparação do meio de diferenciação adipogênica B: suplemento de diferenciação adipogênica meio basal com soro bovino fetal de 10%, 1% glutamina, 1% penicilina-estreptomicina e 0,20% insulina.
    6. Preparação do meio de diferenciação condrogênica: Suplemento de diferenciação condrogênica meio basal com 0,01% Dexametasona, 0,30% Ácido ascórbico, 1% ITS, 0,10% piruvato de sódio, 0,10% Proline e 1% TGF-β3.
      NOTA: O meio de diferenciação osteogênica deve ser utilizado dentro de um mês após a configuração. O período efetivo do meio de diferenciação condrogênica configurado é de 12 h.

2. Isolamento e cultivo de mBMSCs de ratos

NOTA: Todas as operações experimentais devem ser realizadas no gelo o máximo possível para manter a viabilidade celular.

  1. Colhendo mandíbulas de rato
    1. Eutanize dois ratos de 5 semanas de idade, Sprague Dawley, por asfixia de CO2. Certifique-se de que a respiração do animal está parada antes de prosseguir com o experimento.
    2. Enxágüe esses ratos em um béquer contendo 75% de etanol por 3 min.
    3. Coloque o rato dentro de um capô de fumaça limpa para colher mandíbulas.
      NOTA: Esterilize a capa de fumaça por radiação de luz ultravioleta por 30 minutos antes de usar.
    4. Coloque o rato em uma posição supina. Incisar as peles e os músculos do buccinador desde anguluss bilaterais oris até a região posterior da mandíbula, que é o único osso móvel com incisivo inferior.
      NOTA: Recomenda-se fazer uma incisão de 2 cm em cada lado do angulus oris para obter um campo de operação claro.
    5. Abra a boca do rato empurrando os incisivos maxilares e mandibulares na direção oposta com ambos os polegares para expor os dentes mandibulares, que estão ligados à mandíbula.
    6. Desconecte completamente os músculos buccal e os tendões ligados aos coracoides e à borda inferior da mandíbula.
      NOTA: Observa-se um aumento da mobilidade da mandíbula durante esta etapa devido à falta de tensão muscular.
    7. Pressione os dentes posteriores mandibulares e gire para trás e para baixo até que os condyles de ambos os lados estejam claramente expostos.
      NOTA: Este passo é realizado para abrir artificialmente a boca do rato na medida do possível para deslocar o condíle. A mandíbula está conectada ao crânio através de condyles bilaterais, então a exposição dos condyles leva à desconexão entre o crânio e a mandíbula.
    8. Separe o corpo da mandíbula do crânio.
    9. Limpe o tecido mole aderente na superfície óssea usando uma gaze molhada.
    10. Coloque o osso em um prato de vidro estéril de 10 cm cheio de α mínimo essencial pré-cozido (α-MEM) ou salina tampão fosfato (PBS) no gelo para preservar a viabilidade.
  2. Isolamento e cultivo dos mBMSCs
    1. Corte o osso anterior ao longo da borda mesial do primeiro molar do corpo mandibular. Remova o ramus mandibular, incluindo coracoide e condíle ao longo da borda distal do terceiro molar para expor a cavidade da medula.
    2. Encha um prato de vidro estéril de 10 cm com 10 mL de α-MEM (com 10% de FBS).
    3. Use seringa de 1 mL para aspirar α-MEM. Com a agulha de seringa inserida na cavidade da medula óssea, lave repetidamente a medula óssea no prato. Lave a cavidade óssea pelo menos 3 vezes dos lados mesial e distal do osso, respectivamente, até que o osso ficou branco.
      NOTA: Este é o passo mais crítico, pois a cavidade da medula óssea de uma mandíbula de rato não é tão óbvia quanto no osso longo e o ponto adequado para inserir a agulha precisa ser determinado empiricamente. Todas as amostras experimentais acima devem ser armazenadas no gelo para manter a viabilidade celular e, portanto, o tempo de operação não deve ser superior a 2 h.
    4. Transfira a mídia contendo as células lavadas em um tubo de centrífuga de 15 mL e centrífuga a 800 x g em 4 °C por 5 min. Descarte o supernaspeso.
    5. Resuspense as células com 3 mL de α-MEM (com 10% de FBS). Coloque as células em um novo prato de cultura de 10 cm e incubar a 37 °C em uma incubadora de 5% de CO2.
    6. Verifique as mudanças morfológicas e o crescimento dessas células no 3º dia de cultura. Remova o meio de cultura com células não aadeentes e fragmentos de tecido. Adicione suavemente 10 mL de α-MEM fresco (com 10% de FBS).
    7. Após 7 dias de cultura, os P0 mBMSCs atingiram 70% a 80% de confluência.
  3. Classificação de células de fluxo
    NOTA: Os P0 mBMSCs foram identificados fenotipicamente e purificados principalmente através da triagem de células de fluxo.
    1. Aspire e descarte o meio de cultura e depois lave o prato com PBS. Descarte o PBS.
    2. Adicione 1 mL de 0,25% de trippsina com 0,02% de EDTA no prato. Digerir as células a 37 °C por 5 min, depois adicione 2 mL de α-MEM (com 10% de FBS) para parar a reação.
    3. Transfira a suspensão das células para um tubo de centrífuga de 15 mL e centrífuga a 800 x g por 5 min.
    4. Resuspensar as células em 120 μL de PBS (com 10% de FBS) após centrifugação.
    5. Bloqueie estas suspensões celulares com 1 μL de anticorpo contra CD16/CD32 a 4 °C por 15 min.
    6. Transfira 100 μL da suspensão celular para um novo tubo de microcentrífuga, colorir as células com anticorpo conjugado Phycoerythrin (PE) contra CD45, anticorpo conjugado fluoresceína (FITC)contra CD90 e Allophycocyanin (APC)-anticorpo contra CD29 a 4 °C por 1 h no escuro13,15. A concentração de anticorpos utilizados neste experimento é mostrada na Tabela 2. Use os outros 20 μL de suspensão celular como controle negativo não manchado.
    7. Em seguida, centrifugar os tubos a 800 x g por 5 min, descartar a suspensão e resuspensar as células em 0,5 mL de PBS (com 10% de FBS).
    8. Adicione 10 μL de 0,01 mg/mL DAPI por 10 minutos antes da análise.
    9. Use filtros de 40 nm colocados em tubos de centrífuga para filtrar as células.
    10. Analise as células do Sorter celular ativado pela Fluorescência. Coloque os painéis da seguinte forma. Em primeiro lugar, remova as células mortas da contagem total de células, gating DAPI- células, depois portão CD29+CD90+CD45- nas células selecionadas como mBMSCs direcionados.
    11. Colete as células cd29+CD90+CD45classificadas em um tubo de centrífuga de 15 mL com 3 mL de α-MEM (com 10% FBS) pré-preparados.
    12. Centrifugar os tubos a 800 x g por 5 min. Remova o buffer de coleta e adicione 1 mL de α-MEM fresco (com 10% de FBS) para resuspensar as células. Em seguida, emplaque-los em um prato de cultura de 6 cm.

3. Capacidade de formação de colônias

NOTA: Esta etapa foi realizada para verificar a capacidade de divisão dos mBMSCs. 15

  1. Selecione mBMSCs de segunda passagem (P2) para este experimento. Quando a confluência celular atingiu 80% a 90%, reseed as células em um gradiente serial em uma placa de 6 poços para avaliar sua capacidade de proliferação clonal.
    NOTA: Recomenda-se definir o gradiente de 1 x 102 a 1 x 103 células por poço, mas as diluições finais de diferentes linhas celulares de origem humana ou animal foram empiricamente determinadas.
  2. Cultura as células em α-MEM (com 10% de FBS) por aproximadamente duas semanas até que um bom número de unidades formadoras de colônias pudesse ser visto sob microscópio leve. Refrescar o meio de cultura a cada 3 dias.
  3. Aspire e descarte o meio de cultura, lave os poços com PBS duas vezes por 5 minutos de cada vez. Em seguida, adicione 4% de solução de paraformaldeído a cada poço e fixe por pelo menos 10 min.
  4. Retire o paraformaldeído e enxágue os poços duas vezes com PBS.
  5. Manche as células com solução de coloração violeta cristalina e incuba-as em 37 °C por cerca de 10 minutos.
    NOTA: O tempo de coloração ajustado adequadamente até que a sombra desejada seja alcançada.
  6. Remova a solução de coloração e lave as amostras com água destilada para impedir a reação.
  7. Imagem sob um estereómico e contar colônias de células dispersas que consistiam de pelo menos 50 células.

4. Diferenciação de multilineagem de mBMSCs

NOTA: Os P2 mBMSCs foram usados para experimentos subsequentes, a menos que descritos de outra forma.

  1. Indução osteogênica de mBMSCs
    1. Digerir os mBMSCs conforme descrito acima. Células de sementes a uma densidade de 2,5 x 105/cm2 em uma placa de 12 poços suplementadas com 1 mL α-MEM (com 10% FBS).
    2. Quando a confluência celular atingiu 60-70%, mude o meio para 30% de mídia de indução osteogênica. Cultuem as células com α-MEM (com 10% de FBS) como controle negativo e alterem o meio a cada 2 dias.
      NOTA: Depois que um grande bom número de nódulos de cálcio aparecerem durante a osteogênese, recomenda-se alterar o padrão de troca média para uma troca média de meio volume a cada 2 dias, para evitar que os osteoblastos flutuassem.
    3. Após a colheita por sete dias, avalie a calcificação dessas células por manchas alcalinas de fosfatase16,17.
    4. Remova o meio de cultura e fixe as células com 4% de paraformaldeído por 10 minutos. Enxágüe as células usando 1 mL de PBS por poço por 3 minutos duas vezes.
    5. Em seguida, colorir as células com solução alcalina de coloração de fosfatase e incubar a 37 °C por 10-30 min.
      NOTA: A incubação pode ser realizada durante a noite à temperatura ambiente para obter a cor necessária.
    6. Lave os poços com água destilada para parar a reação. Tire fotos sob microscópio leve. Grânulos pigmentados vermelhos representam atividade alcalina de fosfattase (ALP).
    7. Após a cultura das células restantes por mais 7 dias, realize a coloração vermelha alizarina para avaliar a capacidade de mineralização das células.
    8. Colorisse as células com solução de coloração vermelha de 0,5% após fixação celular por 10 min16,18. Pare a reação cromogênica com água destilada após 3-5 min.
      NOTA: O tempo de reação pode ser estendido dependendo da cor desenvolvida.
    9. Por fim, coloque a placa de cultura sob o microscópio de luz para observar o efeito da coloração osteogênica; nódulos vermelhos indicam depósitos de cálcio dessas células.
  2. Indução adipogênica de mBMSCs
    1. Seed P2 mBMSCs em uma placa de 12 poços como descrito acima.
    2. Após o bem se tornar 90% confluente, cultura as células com diferenciação adipogênica média A. Use células cultivadas em α-MEM meio de cultura (com 10% FBS) como controle negativo.
    3. Após 2 dias de indução, aspire o médio A do poço e adicione 1 mL de diferencial adipogênica médio B em cada poço.
    4. Depois de um dia, remova o médio B e inicie o ciclo novamente com o meio A adicionado de volta ao poço. Cultura as células alternadamente usando médio A e B.
    5. Aplique os meios de diferenciação A e B alternadamente por três ciclos e detecte a adipogênese dessas células por mancha O vermelha de óleo16,18.
      NOTA: Muitas gotículas redondas e grandes lipídicas podem ser observadas culminando com essas células com meio de diferenciação B por mais 2 a 3 dias.
    6. Retire o meio e fixe as células com 4% de paraformaldeído por 10 minutos. Lave as células com PBS.
    7. Colora as células com óleo vermelho Solução de coloração O e incubar a 37 °C por aproximadamente 3 min.
    8. Remova a solução de coloração e lave os poços com água destilada.
    9. Observe adipogênese sob microscópio leve.
  3. Indução de condronese de mBMSCs
    1. Semente P2 mBMSCs em tubo centrífuga de 15 mL a uma densidade de 5 x 105/cm2.
    2. Centrifugar os tubos a 300 x g por 5 min. Descarte o supernaspeso.
    3. Resuspense as células com 0,5 mL de meio de diferenciação condrogênica. Centrifugar as células a 300 x g por 5 min.
    4. Solte a tampa do tubo de centrífuga e incuba-o a 37 °C em uma incubadora de 5% de CO2. Renove o meio a cada 2 dias.
      NOTA: As células começam a ser pelotas após 24h. Recomenda-se não mover o tubo centrífuga por 48 h. Tenha cuidado para não aspirar a pelota celular ao trocar o meio.
    5. Após 21 dias de indução, fixar as pelotas celulares com 4% de paraformaldeído, seguida de desidratação, incorporação de parafina e secção.
    6. Após a desparafinação e hidratação, manche os slides em solução azul alciana por pelo menos 15 min18,19,20,21, depois lave com água destilada para parar a reação. Capture as fotografias sob microscópio leve.
    7. Para coloração imunofluorescente do colágeno tipo II, realize as etapas abaixo.
      1. Incubar os slides com 5 μg/mL proteinase K por 15 min a 37 °C após a desparafinação e a hidratação.
      2. Incubar os slides no tampão de bloqueio por 1h a 37 °C.
      3. Aplique 1 μL de anticorpo tipo 2 de colágeno em 200 μL de tampão de bloqueio para os slides e incubar durante a noite a 4 °C.
      4. No dia seguinte, lave os slides com PBS duas vezes e incubar com anticorpos secundários a 37 °C por 1h.
      5. Incubar as fatias com 40,6-diamidino-2-fenilômado (DAPI) por 10 minutos.
    8. Tire fotos de cada slide sob microscopia de fluorescência.

5. PCR em tempo real

  1. Extrair RNA total de mBMSCs usando um reagente comercialmente disponível com isothionato à base de guanidium.
  2. Realize a transcrição reversa do RNA em DNA complementar usando um kit comercialmente disponível. As condições de reação da transcrição reversa foram as seguintes: 65 °C para 5 min, 37 °C para 15 min, 85 °C para 15 s.
  3. Execute o PCR em tempo real para detectar genes específicos de osteogênese e adipogênese usando primers listados na Tabela 3. O procedimento de amplificação do PCR foi o seguinte: 95 °C para 5 min. 95 °C para 5 s, 60 °C para 30 s para 40 ciclos.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Usando este protocolo, uma grande proporção de células aderiu à placa no terceiro dia após a cultura inicial. Normalmente, após 3-4 dias adicionais de cultura, a confluência celular atingiu 70 a 80%(Figura 1B). Com classificação celular fluorescente, DAPI-CD29+CD90+CD45 mBMSCs foram purificados18,22, que representaram cerca de 81,1% nas células P0(Figura 1C).

Após a semeadura de P2 mBMSCs em 100 células em cada poço de 6 poços por uma semana, observou-se uma quantidade significativa de unidades formadoras de colônias, o que sugeriu a significativa capacidade de formação de colônias de mBMSCs(Figura 1D).

Para avaliar a capacidade de diferenciação de multi-linhagem, os mBMSCs foram induzidos em linhagens osteo, condro e adipo, respectivamente, em 12 placas de poços. Os mBMSCs apresentaram forte capacidade de diferenciação osteogênica. Aumento da atividade de ALP, nódulos calcíficos vermelhos distribuídos esporadicamente sob coloração vermelha de alizarina, e aumento da expressão dos genes específicos osteogênicos Runx2, Alp, Bsp e Ocn (Figura 2) indicaram indução estogênica. Para a adipogênese, identificada pela mancha de Óleo-Vermelho-O, numerosos vacuoles ricos em lipídios ficaram evidentes após 9 dias de indução. Da mesma forma, a expressão dos genes adipogênicos específicos Pparγ1 e Cebpa apresentou um aumento significativo (Figura 3). Para observação microscópica de lâminas de diferenciação condrogênica, as amostras mostraram coloração positiva para azul alciano. Além disso, imunostaining com anticorpo de colágeno anti-tipo II mostrou maior acúmulo de matriz de cartilagem(Figura 4).

Meio de Cultura componente Concentração Final
1,α-MEM meio de cultura (com 10% FBS) α mínimo de meio essencial
Soro bovino fetal 10%
Penicilina e estreptomicina 1%
2.Meio de indução osteogênica α-MEM cultura média (com 10%FBS) 70%
Meio de diferenciação osteogênica 30%
3.Meio de diferenciação osteogênica Meio basal de diferenciação osteogênica
Soro bovino fetal 10%
glutamina 1%
Penicilina-Estreptomicina 1%
ácido ascórbico 0.20%
β-Glicerofosfato 1%
dexametasona 0.01%
4.Diferencial adipogênico médio A Diferenciação adipogênica meio basal
Soro bovino fetal 10%
glutamina 1%
Penicilina-Estreptomicina 1%
insulina 0.20%
IBMX 0.10%
Rosiglitazone 0.10%
dexametasona 0.01%
5.Diferencial adipogênico médio B: Diferenciação adipogênica meio basal
Soro bovino fetal 10%
glutamina 1%
Penicilina-Estreptomicina 1%
insulina 0.20%
6.Meio de diferenciação condrogênica: Diferencial de condrogênese meio basial
dexametasona 0.01%
ácido ascórbico 0.30%
seu 1%
Piruvato de sódio 0.10%
prolina 0.10%
TGF-β3 1%

Tabela 1: Componentes do meio de cultura e meio de diferenciação.

anticorpo concentração
CD90.1 (Thy-1.1) Anticorpo monoclonal 0,5mg/mL
Anticorpo Monoclonal CD45 0,2mg/mL
Anticorpo CD29 0,2mg/mL
Anticorpo policlonal de coelho colágeno 5mg/mL
Cabra Anti-Coelho IgG H&L (Alexa Fluor® 488) 1mg/mL

Tabela 2: Concentração de anticorpos utilizada neste estudo.

cartilha Sequência (5' a 3')
GAPDH Foward: CGGCAAGTTCAACGGCACAGTCAAGG
Reverso: ACGACATACTCAGCACCAGCATCACC
Runx2 Foward: GCCTTCAAGGTTGTAGCCCT
Reverso: TGAACCTGGCCACTTGGTTT
Alp Foward: AAACTCGCTTATGGTCCCCG
Reverso: TGGGTTTGAATTCCTGCGGT
Bps Foward: GCACGGTTGAGTATGGGGAA
Reverso: ATCCTGACCCTCGTAGCCTT
Ocn Avante:CAACCCCAATTGTGACGAGC
Reverso:GGCAACACATCCTAAACG
Cebpa Foward: AGTCGGTGGATAAGAACAGCAACG
Reverso: CGGTCATTGTCACTGGTCAACTCC
Pparγ1 Foward: CCATCGAGGACATCCAAGACACC
Reverso: GTGCTCTGACAATCTGCCTGAG

Tabela 3: Primers usados em PCR em tempo real.

Figure 1
Figura 1: Isolamento e cultura de mBMSCs. Diagramaesquemático do protocolo. os mBMSCs foram isolados e banhados no dia 0 e incubados com α-MEM de cultura. No dia 7, os P0 mBMSCs foram purificados através da triagem de citometria de fluxo e as células classificadas foram banhadas em um novo prato de cultura. No dia 14, foram coletados P1 mBMSCs e emplacamentos em placa de 12 poços. No dia 15, os P2 mBMSCs foram induzidos em osteoblastos, células adipogênicas e chondroblasts sob meio de indução correspondente. (B) Modelo esquemático de medula óssea mandibular de rato e observação microscópica de P0 mBMSCs. (C) Classificação de citometria de fluxo de mBMSCs de rato. A análise de citometria de fluxo mostra que essas células foram positivas para CD29 e CD90, mas negativas para CD45, que é congruente com características de BMSC. Destes, foram classificadas 1,4 x10 6 células, o que representou apenas 80% do total de células. (D) Imagem representativa de clones P2 mBMSC manchados de cristal violeta. Clique aqui para ver uma versão maior desta figura.

Figure 2
Figura 2: Potencial de diferenciação osteogênica dos mBMSCs. (A) Após 7 dias de indução osteogênica, a mudança da atividade da ALP foi visualizada. Um grande número de nódulos mineralizados foram manchados sob manchas vermelhas alizarinas aos 14 dias após a indução da diferenciação osteogênica. (B,C) A área positiva da ALP e da coloração vermelha alizarina foram avaliadas por meio do software Image J. (C-G) A expressão mRNA dos marcadores específicos do osteoblasto Runx2, Alp, Bsp e Ocn aumentou significativamente após 7 dias de osteogênese. Clique aqui para ver uma versão maior desta figura.

Figure 3
Figura 3: Potencial de diferenciação adipogênica dos mBMSCs após nove dias de indução. (A) Uma grande quantidade de gotículas lipídicas formam-se e adipócitos foram manchados por óleo-vermelho-O. (B,C) A expressão mRNA dos marcadores adipogênicos Cebpa e Pparγ1 aumentou notavelmente após 9 dias de adipogênese. Clique aqui para ver uma versão maior desta figura.

Figure 4
Figura 4: Visão estereoscópio do efeito de diferenciação condrogênica. (A) mBMSCs após 21 dias indução condrogênica mostrou positivo para coloração azul alciano. (B) Imagem de imunofluorescência de agregado condrogênico manchado com colágeno anti-tipo II. Clique aqui para ver uma versão maior desta figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Este protocolo descreve um método para isolar BMSCs de mandíbulas de ratos in vitro, combinando a adesão total da medula óssea e a classificação celular fluorescente, que é uma maneira simples e confiável de obter mBMSCs proliferativos com forte capacidade de diferenciação. Este método poderia purificar preliminarmente os mBMSCs por classificação de células de fluxo, mas se houver requisitos mais elevados para homogeneidade celular, métodos de purificação mais precisos podem ser necessários.

Atualmente, existem quatro técnicas principais utilizadas para isolar mBMSCs, incluindo adesão integral da medula óssea, centrifugação de gradiente de densidade, classificação celular fluorescente e classificação celular ativada magnética22. A adesão integral da medula óssea e a centrifugação gradiente de densidade são os métodos mais comuns e fáceis utilizados para obter mBMSCs em pouco tempo, no entanto, a baixa pureza dos mBMSCs colhidos é sua principal desvantagem. Os dois últimos métodos podem isolar mBMSCs altamente purificados através de técnicas imunológicas, mas têm as deficiências de ser caro, demorando muito tempo e prejudicando a viabilidade celular. Neste estudo, as vantagens da adesão total da medula óssea e do método de classificação celular fluorescente foram combinadas para obter um número suficiente de mBMSCs proliferativos em pouco tempo.

Sem dúvida, um dos passos mais críticos deste protocolo é a dissecação da mandíbula de rato, que é bastante distinta das de ossos axiais e appendiculares. É essencial entender a anatomia da mandíbula de rato para obter uma amostra intacta. Semelhante à mandíbula humana, a mandíbula de rato fica sob a maxila, mantém os dentes inferiores no lugar e é conectada ao crânio por condyles bilaterais. Como a mandíbula é o único osso que pode se mover no crânio, há muitos músculos ligados à mandíbula, que controlam seu movimento. Somente removendo esses tecidos moles completamente e girando a boca aberta ao máximo podem expor os condyles que se conectam com o crânio. Vale ressaltar também que o pescoço condylar é uma fraqueza física na mandíbula e é fácil de fraturar. Se for encontrada resistência excessiva ao girar a mandíbula para baixo, significa que os músculos mastigatórios podem não ter sido completamente removidos. Quando isso for observado, não gire-o com restrição, caso contrário é fácil quebrar o pescoço condílar, levando assim à contaminação celular. Outras dificuldades na separação e cultura dos mBMSCs incluem baixo teor em medula óssea, atividade celular delicada, baixa pureza, baixa frequência celular e contaminação de células hematopoiéticas18,23. Obter mBMSCs com bom crescimento e potencial de diferenciação relativamente elevado, garantir a atividade dos mBMSCs é de fundamental importância. Existem vários passos-chave, incluindo o uso de ratos de quatro semanas para isso e experimentos subsequentes, já que os ratos jovens são preferidos para manter uma boa viabilidade. Muitos estudos confirmaram que a atividade dos MBMSCs está relacionada à idade dos animais experimentais. Esses mBMSCs de doadores mais velhos podem resultar em menor atividade de proliferação, potencial de diferenciação e vida útil2. Todas as operações durante a colheita celular precisam ser concluídas no gelo e o tempo de operação deve ser o mais curto possível, de preferência dentro de 2 horas. Além disso, mantenha o tempo de digestão da trippsina não mais do que 3 minutos. Por fim, outro desafio neste protocolo é o processo de colheita de mBMSCs. Pode ser problemático tirar mBMSCs da cavidade óssea porque a cavidade da mandíbula de rato é muito pequena, por isso é muito importante estar familiarizado com a estrutura anatômica. Imagens microcsições podem ser de grande ajuda a este respeito. Além disso, vale ressaltar que, como os ossos juvenis são esbeltos e quebradiços, a quebra pode resultar em contaminação.

Referindo-se à caracterização imunofenópica, os BMSCs expressam vários fenótipos, mas nenhum dos quais é específico para eles24. É geralmente aceito que os BMSCs não expressam CD11b, CD14, CD34 ou CD45, mas têm uma alta expressão de Sca-1, CD29, CD90 e CD105. Este estudo escolheu os marcadores amplamente aceitos de CD29, CD90 e CD45 para classificação celular fluorescente13,14,25. Descobriu-se que cd29+CD90+CD45 célula representava adequadamente 80% do total de células, o que foi suficiente para a cultura e pesquisa celular subsequentes.

Por décadas, a terapia com células-tronco é amplamente utilizada no tratamento de várias doenças, como doenças do sistema imunológico, doenças sistêmicas hematológicas, cânceres ou traumas. Sem dúvida, os mBMSCs, como substituto dos BMSCs, podem ser usados como uma ferramenta mais segura e poderosa na terapia com células-tronco devido às suas características superiores. A cultura celular e a expansão dos mBMSCs, portanto, tornam-se particularmente importantes para obter número suficiente de células para o tratamento.

Em resumo, este estudo demonstrou um protocolo promissor e confiável para colher mBMSCs abundantes com alta homogeneidade e capacidade multi-diferenciação em um curto período de tempo.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Todos os autores afirmam que não têm conflitos de interesse.

Acknowledgments

Agradecemos pela ajuda do Laboratório de Estomatologia Digitalizada e Centro de Pesquisa para Anomalias Craniofaciais do Hospital do Nono Povo de Xangai. O trabalho deste manuscrito é apoiado por subsídios da Fundação Nacional de Ciência Natural da China (NSFC) [81570950,81870740,81800949], Shanghai Summit & Plateau Disciplines, o fundo SHIPM-mu do Shanghai Institute of Precision Medicine, Shanghai No People's Hospital, Shanghai Jiao Tong University School of Medicine [JC201809], o Projeto de Incentivo da Equipe de Inovação de Alto Nível para a Shanghai Jiao Tong University School of Medicine. E L.J. é um estudioso dos Talentos Médicos Da Juventude, Shanghai "Rising Stars of Medical Talent" Youth Development Program e o projeto "Chen Xing" da Universidade de Xangai Jiaotong.

Materials

Name Company Catalog Number Comments
0.25% Trypsin-EDTA(1X) Gibco 25200072
10cm culture dish Corning
acutenaculum
Adipogenic differentiation medium Cyagen biosciences inc. MUBMX-90031
Alcian Blue Beyotime Biotechnology
Alizarin red Sigma-Aldrich A5533
Alkaline Phosphatase Color Development Kit Beyotime Biotechnology C3206
alpha-Minimum essential medium GE Healthcare HyClone Cell Culture SH30265.01B
Anti -CollagenII Rabbit pAb Abcam ab34712
Antibodies against CD16/CD32
Antifade Mounting Medium with DAPI Beyotime Biotechnology P0131
APC anti-mouse/rat CD29 Antibody biolegend inc 102215
Biosafety cabinet Esco AC2-4S8-CN
CD45 Monoclonal Antibody (OX1), PE, eBioscience Invitrogen 12-0461-82
CD90.1 (Thy-1.1) Monoclonal Antibody (HIS51), FITC, eBioscience Invitrogen 11-0900-85
Centrifuge cence L500
Chondrogenesis differentiation medium cyagen biosciences inc.
Confocal laser scanning microscope Zeiss LSM880
Countess II FL Automated Cell Counter Invitrogen AMQAF1000
Crystal Violet Staining Solution Beyotime Biotechnology C0121
Fetal Bovine Serum GE Healthcare HyClone Cell Culture SH30084.03
Goat Anti-Rabbit IgG H&L (Alexa Fluor 488) abcam ab150077
Incubator Esco CCL-170B-8
Inverted microscope olympus CKX53
Magzol reagent(Trizol reagent) Magen
micropipettor Eppendorf
Oil Red O
Osteogenic differentiation medium cyagen biosciences inc. MUBMX-90021
Penicillin-Streptomycin Gibco 15070063
Phosphate-buffered saline(1X) Gibco 20012027
PrimeScript RT Master Kit TakaRa Bio Inc RR036A
Proteinase K Sigma-Aldrich P6556
QuickBlock Blocking Buffer Beyotime Biotechnology P0260
scissor
SYBR1 Premix TakaRa Bio Inc
Toluidine Blue Beyotime Biotechnology
Trypan Blue Solution, 0.4% Gibco 15250061

DOWNLOAD MATERIALS LIST

References

  1. Jin, C., et al. Stem cell education for medical students at Tongji University: Primary cell culture and directional differentiation of rat bone marrow mesenchymal stem cells. Biochemistry and Molecular Biology Education. 46, (2), 151-154 (2018).
  2. Chu, D. T., et al. An Update on the Progress of Isolation, Culture, Storage, and Clinical Application of Human Bone Marrow Mesenchymal Stem/Stromal Cells. International Journal of Molecular Sciences. 21, (3), 708 (2020).
  3. Jin, Z., Chen, J., Shu, B., Xiao, Y., Tang, D. Bone mesenchymal stem cell therapy for ovariectomized osteoporotic rats: a systematic review and meta-analysis. BMC Musculoskeleton Disorder. 20, (1), 556 (2019).
  4. Jiang, Y., et al. Pluripotency of mesenchymal stem cells derived from adult marrow. Nature. 418, (6893), 41-49 (2002).
  5. Musina, R. A., Bekchanova, E. S., Belyavskii, A. V., Sukhikh, G. T. Differentiation potential of mesenchymal stem cells of different origin. Bulletin of Experimental Biology and Medicine. 141, (1), 147-151 (2006).
  6. Lloyd, B., et al. Similarities and differences between porcine mandibular and limb bone marrow mesenchymal stem cells. Archives in Oral Biology. 77, 1-11 (2017).
  7. Zhang, W., et al. Comparison of the use of adipose tissue-derived and bone marrow-derived stem cells for rapid bone regeneration. Journal of Dental Research. 92, (12), 1136-1141 (2013).
  8. Stefanik, D., et al. Disparate osteogenic response of mandible and iliac crest bone marrow stromal cells to pamidronate. Oral Disorders. 14, (5), 465-471 (2008).
  9. Aghaloo, T. L., et al. Osteogenic potential of mandibular vs. long-bone marrow stromal cells. Journal of Dental Research. 89, (11), 1293-1298 (2010).
  10. Kaigler, D., et al. Stem cell therapy for craniofacial bone regeneration: a randomized, controlled feasibility trial. Cell Transplantation. 22, (5), 767-777 (2013).
  11. Li, C., Wang, F., Zhang, R., Qiao, P., Liu, H. Comparison of proliferation and osteogenic differentiation potential of rat mandibular and femoral bone marrow mesenchymal stem cells in vitro. Stem Cells Development. 2020, 1941629 (2020).
  12. Matsubara, T., et al. Alveolar bone marrow as a cell source for regenerative medicine: differences between alveolar and iliac bone marrow stromal cells. Journal of Bone and Mineral Research. 20, (3), 399-409 (2005).
  13. Chan, C. K. F., et al. Identification of the Human Skeletal Stem Cell. Cell. 175, (1), 43-56 (2018).
  14. Bianco, P., Riminucci, M., Gronthos, S., Robey, P. G. Bone marrow stromal stem cells: nature, biology, and potential applications. Stem Cells. 19, (3), 180-192 (2001).
  15. Franken, N. A., Rodermond, H. M., Stap, J., Haveman, J., van Bree, C. Clonogenic assay of cells in vitro. Nature Protocol. 1, (5), 2315-2319 (2006).
  16. Xu, H., et al. Icariin prevents oestrogen deficiency-induced alveolar bone loss through promoting osteogenesis via STAT3. Cell Proliferation. 53, (2), 12743 (2020).
  17. Zhang, P., Wu, Y., Jiang, Z., Jiang, L., Fang, B. Osteogenic response of mesenchymal stem cells to continuous mechanical strain is dependent on ERK1/2-Runx2 signaling. Internation Journal of Molecular Medicine. 29, (6), 1083-1089 (2012).
  18. Zhu, H., et al. A protocol for isolation and culture of mesenchymal stem cells from mouse compact bone. Nature Protocol. 5, (3), 550-560 (2010).
  19. Lach, M. S., et al. Chondrogenic Differentiation of Pluripotent Stem Cells under Controllable Serum-Free Conditions. International Journal of Molecular Sciences. 20, (11), 2711 (2019).
  20. Huang, X., Zhong, L., Hendriks, J., Post, J. N., Karperien, M. The Effects of the WNT-Signaling Modulators BIO and PKF118-310 on the Chondrogenic Differentiation of Human Mesenchymal Stem Cells. International Journal of Molecular Sciences. 19, (2), 561 (2018).
  21. Gale, A. L., Linardi, R. L., McClung, G., Mammone, R. M., Ortved, K. F. Comparison of the Chondrogenic Differentiation Potential of Equine Synovial Membrane-Derived and Bone Marrow-Derived Mesenchymal Stem Cells. Frontiers in Veterinary Sciences. 6, 178 (2019).
  22. Li, X., Zhang, Y., Qi, G. Evaluation of isolation methods and culture conditions for rat bone marrow mesenchymal stem cells. Cytotechnology. 65, (3), 323-334 (2013).
  23. Kagami, H., Agata, H., Tojo, A. Bone marrow stromal cells (bone marrow-derived multipotent mesenchymal stromal cells) for bone tissue engineering: basic science to clinical translation. International Journal of Biochemistry and Cell Biology. 43, (3), 286-289 (2011).
  24. Chamberlain, G., Fox, J., Ashton, B., Middleton, J. Concise review: mesenchymal stem cells: their phenotype, differentiation capacity, immunological features, and potential for homing. Stem Cells. 25, (11), 2739-2749 (2007).
  25. Abdallah, B. M., Alzahrani, A. M., Abdel-Moneim, A. M., Ditzel, N., Kassem, M. A simple and reliable protocol for long-term culture of murine bone marrow stromal(mesenchymal) stem cells that retained their in vitro and in vivo stemness in long-term culture. Biology Proceedings Online. 21, 3 (2019).
Isolamento e Cultivo de Células-Tronco Mesenquimais de Medula Óssea Mandibular em Ratos
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Hong, Y., Xu, H., Yang, Y., Zhou, S., Jin, A., Huang, X., Dai, Q., Jiang, L. Isolation and Cultivation of Mandibular Bone Marrow Mesenchymal Stem Cells in Rats. J. Vis. Exp. (162), e61532, doi:10.3791/61532 (2020).More

Hong, Y., Xu, H., Yang, Y., Zhou, S., Jin, A., Huang, X., Dai, Q., Jiang, L. Isolation and Cultivation of Mandibular Bone Marrow Mesenchymal Stem Cells in Rats. J. Vis. Exp. (162), e61532, doi:10.3791/61532 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter