Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Medicine

Sıçanlarda Mandibuler Kemik İliği Mezenkimal Kök Hücrelerinin İzolasyonu ve Yetiştirilmesi

doi: 10.3791/61532 Published: August 25, 2020
* These authors contributed equally

Summary

Bu makalede, sıçan mandibulalarından kemik iliği mezenkimal kök hücrelerini izole etmek, yetiştirmek, sıralamak ve tanımlamak için tüm kemik iliği yapışması ve akış sitometrisi sıralamasını birleştiren bir yöntem sunulmaktadır.

Abstract

Burada, deneysel gereksinimler için çok sayıda yüksek kaliteli hücreyi hızla elde etmek için mandibuler kemik iliği mezenkimal kök hücrelerini (mBMSC' ler) in vitro izole etmek ve kültleştirmek için etkili bir yöntem sunuyoruz. mBMSC'ler, mükemmel kendini yenileme yeteneği ve çok soylu farklılaşma potansiyeli nedeniyle gelecekte kraniyofasiyal hastalıklar ve kraniyo-maksillofasiyal rejenerasyon durumunda doku mühendisliği hücreleri olarak terapötik uygulamalarda yaygın olarak kullanılabilir. Bu nedenle, mBMSC'leri çok sayıda elde etmek önemlidir.

Bu çalışmada kemik iliği mandibuladan yıkanmış ve primer mBMSC'ler tüm kemik iliği yapışmış ekimi ile izole edilmiştir. Ayrıca, CD29+CD90+CD45 mBMSC'ler floresan hücre sıralama yoluyla saflaştırılmıştır. İkinci nesil saflaştırılmış mBC'ler daha fazla çalışma için kullanıldı ve osteoblastlara, adipositlere ve kondrositlere farklılaşma potansiyeli gösterdi. Bu in vitro modeli kullanarak, biyolojik özelliklerin incelenmesini, mikroçevrime sonraki reaksiyonları ve mBMSC'lerin diğer uygulamalarını kolaylaştırabilecek yüksek sayıda proliferatif mBMSC elde edilebilir.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Kemik iliği mezenkimal kök hücreler (BMSC' ler), kemik iliğinden elde edilen ve güçlü çoğalma yeteneği ve çok soylu farklılaşma potansiyeli gösteren hematopoetik olmayan kök hücrelerdir1,2,3,4. Nitekim BMSC'ler keşfedildiklerinden beri kemik doku mühendisliği ve yenilenmesi için ideal bir aday olarak kabul edilmiştir. Yıllardır, iliak tepe veya kaval kemiği ve uyluk kemiği gibi uzun kemikler kraniyofasiyal rejenerasyon için BMSC'lerin en yaygın kaynağı olmuştur. Bununla birlikte, mandibuler BMSC'ler (mBMSC'ler) gibi orofasiyal BMSC'ler, farklı embriyonik köken ve gelişim patörü gibi uzun kemik BMSC'lerinden bazı farklılıklar gösterir. Mandibulalar nöroektoderm mikrop tabakasının nöral kret hücrelerinden kaynaklanır ve intramembranöz kemikleşmeye uğrar, eksenel ve apandisitrik iskeletler ise mezodermdendir ve endochondral kemikleşmeye uğrar. Ayrıca, klinik gözlemler ve deneysel hayvan çalışmaları sürekli olarak orofacial ve iliak kret BMSC'ler 5,6,7,8arasında fonksiyonel farklılıklar olduğunubelirtmiştir. Raporlar, mandibula, maksiller kemik ve alveolar kemik gibi kraniyofasiyal kemikten elde edilen BMSC'lerin eksenel ve apandisiler kemiklerden üstün çoğalma, yaşam süresi ve farklılaşma yeteneği sergilediğini göstermiştir9. Bu nedenle mBMSC'ler, cherubism, çene tümörü, çene kemiği osteoporoz ve periodontal doku defekti10 , 11,12gibi kraniyofasiyal hastalıkların gelecekteki terapötik uygulamaları için tercih edilen kaynaklar olarak kabul edilir. Preklinik deneylerde tedavi potansiyelini anlamak için, mBMSC'lerin in vitro olarak hızla izole edilmesi ve kült haline getirmek için bir yöntem oluşturmak esastır.

Bu çalışmada tüm kemik iliği yapışması ve akış sitometrisi tasnifi ile saflaştırılmış mBMSC'lerin elde etmesi amaçlanmıştı. Mikro bilgisayarlı tomografi (Mikro-BT) ve histolojik bölümler ile açıkça gözlenen fare mandibulasının anatomik morfolojisi, mandibulanın trabeküler kemiğinin kesici medüller boşluk ile alveolar kemik arasında olduğunu göstermiştir. Trabeküler kemik kemiğinden kemik iliği mandibular ilik hücreleri elde etmek için yıkandı, ancak bu şekilde kültürlenen hücreler saf mBC'ler değildi ve kemik, yağ ve endotel hücrelerinden hücreler gibi belirsiz potenslere ve çeşitli soylara sahip birden fazla hücre türünden oluşması muhtemeldi13,14. Hücre saflaştırmanın bir sonraki adımı özellikle önemliydi. Akış sitometrisi, hücre yüzeyi proteinlerinin bir kombinasyonunu tanıyarak hücreleri filtreler ve mezenkimal kök hücrelerin zenginleştirilmesinde yaygın olarak benimsenmiştir. Hücre homojenliği akış sitometrisinin ana avantajıdır, ancak işlem hücre canlılığını belirlemez ve sınırlı hücre verimi ile sonuçlanabilir. Bu çalışmada, tüm kemik iliği yapışmasından elde edilen P0 mBMSC'ler, yüksek saflık ve güçlü çoğalma kapasitesine sahip mBMSC'ler elde etmek için akış sitometrisine göre sıralanmıştır.

Bu çalışma, tüm kemik iliği yapışması ve akış sitometrisi sıralama kombinasyonu kullanılarak sıçan mandibular BMSC'lerin izolasyonu, kültürü ve farklılaşması için tekrarlanabilir ve güvenilir bir protokol sürmektedir. İlgili alanlardaki araştırmacıların kullanması için güvenilir ve kullanışlı bir yöntemdir.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Bu makaledeki tüm hayvan deneysel prosedürleri Şanghay Jiao Tong Üniversitesi Tıp Fakültesi Şanghay Dokuzuncu Halk Hastanesi Hayvan Bakım Komitesi tarafından onaylanmıştır.

1. Hazırlık

  1. Deney için 5 haftalık iki erkek Sprague Dawley faresi kullanın.
  2. İğne tutucular, cımbızlar ve makaslar da dahil olmak üzere tüm aletleri yüksek sıcaklıkta sterilize edin veya 10 dakika boyunca% 75 etanol içine daldırın.
    NOT: Etanol daldırma hücre hasarlarını önlemek için çok uzun olmamalıdır.
  3. Kompozisyonu Tablo 1'desağlanan kültür medyasını önceden hazırlayın. Aşağıda açıklandığı gibi her ortamı tamamlayın.
    1. α-MEM kültür ortamının hazırlanması (%10 FBS ile): %10 fetal sığır serumu ve %1 penisilin ve streptomisin ile minimum esansiyel orta alfayı (α-MEM) tamamlar.
    2. Osteojenik farklılaşma ortamının hazırlanması: %10 fetal sığır serumu, %1 glutamin, %1 penisilin-streptomisin, %0,20 askorbik asit, %1 β-glisefosfat ve %0,01 deksametazon ile takviye osteojenik farklılaşma bazal ortamı.
    3. Osteojenik indüksiyon ortamının hazırlanması: %70 α-MEM kültür ortamını (%10 FBS ile) ve %30 osteojenik farklılaşma ortamını karıştırın.
    4. Adipojenik farklılaşma ortamının hazırlanması A: %10 fetal sığır serumu, %1 glutamin, %1 penisilin-streptomisin, %0,20 insülin, %0,10 IBMX, %0,10 Rosiglitazone ve %0,01 Dexamethasone ile takviye adipojenik farklılaşma bazal ortamı.
    5. Adipojenik farklılaşma ortamı B'nin hazırlanması: %10 fetal sığır serumu, %1 glutamin, %1 penisilin-streptomisi ve %0,20 insülin ile takviye adipojenik farklılaşma bazal ortamı.
    6. Kondrojenik farklılaşma ortamının hazırlanması: %0.01 Deksametazon, %0.30 Askorbik asit, %1 ITS, %0.10 Sodyum piruvat, %0.10 Prolin ve %1 TGF-β3 ile ek kondrojenik farklılaşma bazal ortamı.
      NOT: Osteojenik farklılaşma ortamı yapılandırmadan sonraki bir ay içinde kullanılmalıdır. Yapılandırılmış kondrojenik farklılaşma ortamının etkili süresi 12 saattir.

2. Sıçan mBMSC'lerin izolasyonu ve yetiştirilmesi

NOT: Hücre canlılığını korumak için tüm deneysel işlemler mümkün olduğunca buz üzerinde yapılmalıdır.

  1. Sıçan mandibulalarının toplanması
    1. CO2 boğulması ile 5 haftalık iki erkek Sprague Dawley sıçanını ötenazi edin. Deneye devam etmeden önce hayvanın solunumun kesildiğinden emin olun.
    2. Bu sıçanları 3 dakika boyunca% 75 etanol içeren bir beherde durulayın.
    3. Fareyi mandibulaları hasat etmek için temiz bir duman kaputunun içine yerleştirin.
      NOT: Duman davlumbazını kullanmadan önce 30 dakika boyunca ultraviyole ışık radyasyonu ile sterilize edin.
    4. Sıçanı bir supine pozisyonuna getirin. Derileri ve buccinator kaslarını bilateral angulus oris'ten alt kesici dişe sahip tek hareketli kemik olan mandibulanın arka bölgesine kadar inkübize edin.
      NOT: Net bir çalışma alanı elde etmek için angulus oris'in her iki tarafında 2 cm'lik bir kesi yapılması önerilir.
    5. Mandibulaya tutturulmuş mandibular dişleri ortaya çıkarmak için maksiller ve mandibuler kesici dişleri her iki başparmakla ters yöne doğru iterek sıçanın ağzını açın.
    6. Bukuzal kasları ve koracoidlere bağlı tendonları ve mandibulanın alt sınırını tamamen çıkarın.
      NOT: Bu adım sırasında kas gerginliği olmaması nedeniyle mandibula hareketliliğinde artış gözlenir.
    7. Mandibular arka dişlere basın ve her iki taraftaki kondyles açıkça açığa çıkana kadar geriye ve aşağı doğru döndürün.
      NOT: Bu adım, sıçanın ağzını, kondyle'u yerinden çıkarmak için mümkün olan en yüksek ölçüde yapay olarak açmak için gerçekleştirilir. Mandibula, çift kondyles yoluyla kafatasına bağlanır, bu nedenle kondilenlerin maruz kalması kafatası ile mandibula arasındaki kopukluğa yol açar.
    8. Mandibula vücudunu kafatasından ayırın.
    9. Kemik yüzeyindeki yapışan yumuşak dokuyu ıslak bir gazlı bez kullanarak temizleyin.
    10. Canlılığı korumak için kemiği buzun üzerine önceden sarılmış minimum esansiyel orta α (α-MEM) veya fosfat tampon salin (PBS) ile dolu 10 cm steril bir cam kabın içine yerleştirin.
  2. mBMSC'lerin izolasyonu ve yetiştirilmesi
    1. Mandibular gövdeden ilk azı dişinin mesial kenarı boyunca ön kemiği kesin. İlik boşluğunu ortaya çıkarmak için üçüncü azı dişinin distal kenarı boyunca coracoid ve kondyle dahil olmak üzere mandibular ramus'u çıkarın.
    2. 10 cm steril cam kabı 10 mL α-MEM (%10 FBS ile) ile doldurun.
    3. α-MEM kültür ortamını aspire etmek için 1 mL şırınna kullanın. Kemik iliği boşluğuna sokulmuş şırınga iğnesi ile kemik iliğini tekrar tekrar çanağa yıkayın. Kemik boşluğunu, kemik beyazlayıncaya kadar sırasıyla kemiğin hem mesial hem de distal yanlarından en az 3 kez yıkayın.
      NOT: Bu en kritik adımdır, çünkü bir sıçan mandibulasının kemik iliği boşluğu uzun kemikteki kadar belirgin değildir ve iğneyi yerleştirmek için uygun noktanın ampirik olarak belirlenmesi gerekir. Yukarıdaki tüm deneysel örnekler hücre canlılığını korumak için buz üzerinde depolanmalıdır ve bu nedenle çalışma süresi 2 saatten uzun olmamalıdır.
    4. Yıkanmış hücreleri içeren ortamı 15 mL santrifüj tüpüne ve 4 °C'de 800 x g'da santrifüje 5 dakika aktarın. Üstnatant atın.
    5. Hücreleri 3 mL α-MEM (%10 FBS ile) ile yeniden biriktirin. Hücreleri yeni bir 10 cm kültür çanakta plakalayın ve% 5 CO2 inkübatörde 37 ° C'de kuluçkaya yatırın.
    6. Kültürün 3. gününde bu hücrelerin morfolojik değişimlerini ve büyümesini kontrol edin. Doğal olmayan hücreler ve doku parçaları ile kültür ortamını çıkarın. Hafifçe 10 mL taze α-MEM ekleyin (%10 FBS ile).
    7. 7 günlük kültürden sonra, P0 mBMSC'ler% 70 ila% 80 birışıklığa ulaştı.
  3. Akış hücresi sıralama
    NOT: P0 mBMSC'ler fenotipik olarak tanımlandı ve öncelikle akış hücresi sıralama yoluyla saflaştırıldı.
    1. Kültür ortamını aspire edin ve atın ve ardından yemeği PBS ile yıkayın. PBS'yi atın.
    2. Yemeğe % 0.02 EDTA ile% 0.25 trypsin 1 mL ekleyin. Hücreleri 37 °C'de 5 dakika sindirin, ardından reaksiyonun durdurulması için 2 mL α-MEM (%10 FBS ile) ekleyin.
    3. Hücre süspansiyonu 15 mL santrifüj tüpüne ve 5 dakika boyunca 800 x g'da santrifüje aktarın.
    4. Santrifüjlemeden sonra hücreleri 120 μL PBS'de (%10 FBS ile) yeniden biriktirin.
    5. Bu hücre süspansiyonlarını 15 dakika boyunca 4 °C'de CD16/CD32'ye karşı 1 μL antikorla engelleyin.
    6. Hücre süspansiyonunun 100 μL'lik kısmını yeni bir mikrosantrifüj tüpüne aktarın, CD45'e karşı Phycoerythrin (PE)-konjuge antikor, CD90'a karşı floresan-izotiyosiyanat (FITC) ve 4 °C'de 1 saat boyunca CD29'a karşı Allophycocyanin (APC)-antikoru ile hücreleri lekeleyin13,15. Bu deneyde kullanılan antikorların konsantrasyonu Tablo 2'de gösterilmiştir. Diğer 20 μL hücre süspansiyonu lekesiz negatif kontrol olarak kullanın.
    7. Daha sonra tüpleri 5 dakika boyunca 800 x g'da santrifüj edin, süspansiyonu atın ve hücreleri 0,5 mL PBS'de (%10 FBS ile) yeniden biriktirin.
    8. Analizden önce 10 dakika boyunca 10 μL 0,01 mg/mL DAPI ekleyin.
    9. Hücreleri filtrelemek için santrifüj tüplerine yerleştirilen 40 nm filtreleri kullanın.
    10. Floresan ile aktive edilmiş hücre sıralayıcısı üzerindeki hücreleri analiz edin. Panelleri aşağıdaki gibi ayarlayın. İlk olarak, seçilen hücrelerde HEDEFLENEN mBMSC'ler olarak DAPI- hücreler, ardından cd29+CD90+CD45kapısı - gating yaparak ölü hücreleri toplam hücre sayısına çıkarın.
    11. Sıralanmış CD29+CD90+CD45- hücreleri önceden hazırlanmış 3 mL α-MEM (% 10 FBS ile) ile 15 mL santrifüj tüpünde toplayın.
    12. Tüpleri 5 dakika boyunca 800 x g'da santrifüj edin. Toplama arabelleği çıkarın ve hücreleri yeniden çıkarmak için 1 mL taze α-MEM (%10 FBS ile) ekleyin. Daha sonra 6 cm'lik bir kültür tabağında tabaklayın.

3. Koloni oluşum yeteneği

NOT: Bu adım, mBMSC'lerin bölünme yeteneğini denetlemek için gerçekleştirildi. 15

  1. Bu deneme için ikinci pasaj mBMSC'leri (P2) seçin. Hücre birleşmesi % 80 ila% 90'a ulaştığında, klonal çoğalma yeteneklerini değerlendirmek için hücreleri 6 kuyu plakasında bir seri gradyanda yeniden ekitledi.
    NOT: Degradenin kuyu başına 1 x 10 2 ila1 x 103 hücre arasında ayarlandırılması önerilir, ancak insan veya hayvan kökenli farklı hücre hatlarının son seyreltmeleri ampirik olarak belirlenmiştir.
  2. Α-MEM'deki hücreleri (%10 FBS ile) yaklaşık iki hafta boyunca, hafif mikroskop altında koloni oluşturan birimlerin çok sayıda görülebildiğine kadar kültüre edin. Kültür ortamını her 3 günde bir yenileyin.
  3. Kültür ortamını aspire edin ve atın, kuyuları PBS ile bir seferde 5 dakika boyunca iki kez yıkayın. Daha sonra her kuyuya% 4 paraformaldehit çözeltisi ekleyin ve en az 10 dakika sabitleyin.
  4. Paraformaldehiti çıkarın ve kuyuları PBS ile iki kez durulayın.
  5. Hücreleri kristal mor boyama çözeltisi ile lekelayın ve yaklaşık 10 dakika boyunca 37 °C'de kuluçkaya yatırın.
    NOT: Boyama süresi, istenen gölge elde edilene kadar uygun şekilde ayarlanır.
  6. Boyama çözeltisini çıkarın ve reaksiyonun durması için numuneleri damıtılmış suyla yıkayın.
  7. Stereomikroskop altında görüntü ve en az 50 hücreden oluşan dağınık hücre kolonilerini saymak.

4. mBMSC'lerin çok satırlı farklılaşması

NOT: P2 mBMSC'ler, aksi belirtilmedikçe sonraki denemeler için kullanılmıştır.

  1. mBMSC'lerin osteojenik indüksiyonu
    1. Yukarıda açıklandığı gibi mBMSC'leri özetle. 1 mL α-MEM(%10 FBS ile) ile desteklenmiş 12 kuyu plakasında 2,5 x 105/cm 2 yoğunlukta tohum hücreleri.
    2. Hücre birleşmesi % 60-70'e ulaştığında, ortamı% 30 osteojenik indüksiyon ortamına değiştirin. Hücreleri α-MEM (%10 FBS ile) negatif kontrol olarak kültüre edin ve ortamı her 2 günde bir değiştirin.
      NOT: Osteogenez sırasında çok sayıda kalsiyum nodül ortaya çıktıktan sonra, osteoblastların yüzmesini önlemek için orta değişim deseninin her 2 günde bir yarım hacimli orta değişime değiştirilmesi önerilir.
    3. Yedi gün boyunca kültlemeden sonra, bu hücrelerin kireçlenmesini alkali fosfataz lekeleme ile değerlendirin16,17.
    4. Kültür ortamını çıkarın ve hücreleri 10 dakika boyunca% 4 paraformaldehit ile sabitleyin. Hücreleri kuyu başına 1 mL PBS kullanarak iki kez 3 dakika durulayın.
    5. Daha sonra hücreleri alkali fosfataz boyama çözeltisi ile lekelenin ve 37 °C'de 10-30 dakika kuluçkaya yatırın.
      NOT: Gerekli rengi elde etmek için oda sıcaklığında gece boyunca kuluçka yapılabilir.
    6. Reaksiyonun durdurulması için kuyuları damıtılmış suyla yıkayın. Işık mikroskobu altında fotoğraf çek. Kırmızı pigmentli granüller alkali fosfataz (ALP) aktivitesini temsil eder.
    7. Kalan hücreleri 7 gün daha kült ettikten sonra, hücrelerin mineralizasyon kapasitesini değerlendirmek için alizarin kırmızı lekeleme gerçekleştirin.
    8. Hücreleri 10 dk 16,18için hücre fiksasyonundan sonra% 0.5 alizarin kırmızı boyama çözeltisi ile lekelenin. Kromojenik reaksiyonun damıtılmış su ile 3-5 dakika sonra durdurulması.
      NOT: Reaksiyon süresi geliştirilen renge bağlı olarak uzatılabilir.
    9. Son olarak, osteojenik lekelemenin etkisini gözlemlemek için kültür plakasını ışık mikroskobu altına yerleştirin; kırmızı nodüller bu hücrelerin kalsiyum birikintilerini gösterir.
  2. mBMSC'lerin adipojenik indüksiyonu
    1. Tohum P2 mBMSC'ler yukarıda açıklandığı gibi 12 kuyu plakasında.
    2. Kuyu % 90 birleştikten sonra, adipojenik farklılaşma ortamı A ile hücreleri kültüre edin. α-MEM kültür ortamında (%10 FBS ile) kültürlenmiş hücreleri negatif kontrol olarak kullanın.
    3. 2 günlük indüksiyondan sonra, orta A'yı kuyudan epire edin ve her kuyuya 1 mL adipojenik farklılaşma orta B ekleyin.
    4. Bir gün sonra, orta B'yi çıkarın ve kuyuya geri eklenen orta A ile döngüye tekrar başlayın. A ve B ortamını kullanarak hücreleri dönüşümlü olarak kültüre edin.
    5. A ve B farklılaşma ortamını üç döngü boyunca dönüşümlü olarak uygulayın ve bu hücrelerin adipogenezini yağ kırmızısı O boyama16,18ile tespit edin.
      NOT: Bu hücrelerin 2 ila 3 gün daha B farklılaşması ile kültlenerek çok sayıda yuvarlak ve büyük lipit damlacıkları gözlenebilir.
    6. Ortamı çıkarın ve hücreleri 10 dakika boyunca% 4 paraformaldehit ile sabitleyin. Hücreleri PBS ile yıkayın.
    7. Hücreleri yağ kırmızısı O boyama çözeltisi ile lekeleyin ve yaklaşık 3 dakika boyunca 37 °C'de kuluçkaya yatırın.
    8. Boyama çözeltisini çıkarın ve kuyuları damıtılmış suyla yıkayın.
    9. Işık mikroskobu altında adipogenez gözlemleyin.
  3. mBMSC'lerin kondrogenez indüksiyonu
    1. 5 x105 /cm 2 yoğunlukta 15 mL santrifüj tüpünde P2 mBMSC'ler.
    2. Tüpleri 5 dakika boyunca 300 x g'da santrifüj edin. Üstnatant atın.
    3. Hücreleri 0,5 mL kondrojenik farklılaşma ortamı ile yeniden biriktirin. Hücreleri 5 dakika boyunca 300 x g'da santrifüj edin.
    4. Santrifüj tüpünün kapağını gevşetin ve % 5 CO2 inkübatörde 37 °C'de kuluçkaya bırakın. Ortamı her 2 günde bir yenileyin.
      NOT: Hücreler 24 saat sonra peletmeye başlar. Santrifüj tüpünün 48 saat hareket ettirmemeniz önerilir. Ortamı değiştirirken hücre peletini aspire etmemeye dikkat edin.
    5. 21 günlük indüksiyondan sonra, hücre peletlerini% 4 paraformaldehit ile sabitle, ardından dehidrasyon, parafin gömme ve bölümleme.
    6. Deparaffinizasyon ve hidrasyondan sonra, slaytları Alcian mavi çözeltisinde en az 15 dk18,19,20,21boyunca lekeleyin, ardından reaksiyonu durdurmak için damıtılmış suyla yıkayın. Fotoğrafları ışık mikroskobu altında çek.
    7. Kollajen tip II'nin immünofluoresan lekeleme için aşağıdaki adımları uygulayın.
      1. Deparaffinizasyon ve hidrasyon adımından sonra slaytları 37 °C'de 15 dakika boyunca 5 μg/mL proteinaz K ile kuluçkaya yatırın.
      2. Slaytları 37 °C'de 1 saat boyunca engelleme arabelleğine inkübte edin.
      3. Slaytlara 200 μL blokaj tamponunda 1 μL kollajen tip II antikor uygulayın ve 4 °C'de bir gecede kuluçkaya yatırın.
      4. Ertesi gün, slaytları PBS ile iki kez yıkayın ve 1 saat boyunca 37 °C'de ikincil antikorlarla kuluçkaya yatırın.
      5. Dilimleri 10 dakika boyunca 40,6-diamidino-2-fenylindole (DAPI) ile kuluçkaya yatırın.
    8. Floresan mikroskopisi altında her slaytın fotoğrafını çek.

5. Gerçek zamanlı PCR

  1. Guanidium izotiyosiyanat bazlı ticari olarak mevcut reaktif kullanarak mBMSC'lerden toplam RNA çıkarın.
  2. Piyasada bulunan bir kit kullanarak RNA'nın tamamlayıcı DNA'ya ters transkripsiyonunu gerçekleştirin. Ters transkripsiyonun reaksiyon koşulları şu şekildeydi: 5 dakika için 65 °C, 15 dk için 37 °C, 15 sn için 85 °C.
  3. Tablo 3'te listelenen astarları kullanarak osteogenez ve adipogenez spesifik genleri tespit etmek için gerçek zamanlı PCR gerçekleştirin. PCR amplifikasyon prosedürü aşağıdaki gibidir: 5 dakika için 95 °C, 5 s için 95 °C, 40 döngü için 30 sn için 60 °C.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Bu protokolü kullanarak, hücrelerin büyük bir kısmı ilk kültürden sonraki üçüncü günde plakaya yapıştı. Tipik olarak, ek bir 3-4 günlük kültürden sonra, hücre birleşmesi% 70 ila 80'e ulaştı (Şekil 1B). Floresan hücre sıralama ile DAPI-CD29 + CD90+CD45 mBMSC'ler P0 hücrelerinde yaklaşık%81,1'ioluşturan 18,22saflaştırılmıştır ( Şekil1C).

P2 mBMSC'lerin bir hafta boyunca 6 kuyu plakasının her kuyusunda 100 hücrede tohumlandıktan sonra, mBMSC'lerin önemli koloni oluşturma yeteneğini öneren önemli miktarda koloni oluşturma ünitesi gözlenmiştir (Şekil 1D).

Çok hatlı farklılaşma yeteneğini değerlendirmek için, mBMSC'ler sırasıyla 12 kuyu plakasında osteo, kondro ve adipo-soylara indüklendi. MBC'ler güçlü osteojenik farklılaşma yeteneği gösterdi. ALP aktivitesinin artması, alizarin kırmızı lekeleme altında düzensiz olarak dağıtılan kırmızı kalsiptik nodüller ve osteojenik spesifik genlerin artan ekspresyonu Runx2, Alp, Bsp ve Ocn (Şekil 2) oestojenik indüksiyonu gösterdi. Yağ-kırmızı-O lekeleme ile tanımlanan adipogenez için, 9 günlük indüksiyondan sonra çok sayıda lipid bakımından zengin vakuol belirgindi. Aynı şekilde, adipojenik spesifik genlerin Pparφ1 ve Cebpa ekspresyoyu önemli bir artış göstermiştir (Şekil 3). Kondrojenik farklılaşma slaytlarının mikroskobik gözlemi için, örnekler Alcian mavisi için pozitif lekelenme gösterdi. Ek olarak, anti-tip II kollajen antikoru ile immünostaining kıkırdak matrisinin gelişmiş birikimini göstermiştir(Şekil 4).

Kültür Ortamı parça Son Konsantrasyon
1.α-MEM kültür ortamı (%10 FBS ile) α minimum temel ortam
Fetal sığır serumu 10%
Penisilin ve streptomisinin 1%
2. Osteojenik indüksiyon ortamı α-MEM kültür ortamı (%10 FBS ile) 70%
Osteojenik farklılaşma farklılaşma ortamı 30%
3. Osteojenik farklılaşma ortamı Osteojenik farklılaşma bazal ortamı
Fetal sığır serumu 10%
Glutamine 1%
Penisilin-Streptomisiin 1%
Askorbik asit 0.20%
β-Glisofosfat 1%
Deksametazon 0.01%
4. Adipojenik farklılaşma ortamı A Adipojenik farklılaşma bazal ortamı
Fetal sığır serumu 10%
Glutamine 1%
Penisilin-Streptomisiin 1%
Insülin 0.20%
IBMX 0.10%
Rosiglitazone 0.10%
Deksametazon 0.01%
5.Adipojenik farklılaşma ortamı B: Adipojenik farklılaşma bazal ortamı
Fetal sığır serumu 10%
Glutamine 1%
Penisilin-Streptomisiin 1%
Insülin 0.20%
6. kondrojenik farklılaşma ortamı: Kondrogenez farklılaşma baziyel ortam
Deksametazon 0.01%
Askorbik asit 0.30%
onun 1%
Sodyum piruvat 0.10%
Prolin 0.10%
TGF-β3 1%

Tablo 1: Kültür ortamı ve farklılaşma ortamının bileşenleri.

antikor konsantrasyon
CD90.1 (Thy-1.1) Monoklonal Antikor 0.5mg/mL
CD45 Monoklonal Antikor 0.2mg/mL
CD29 Antikor 0.2mg/mL
KollajenII tavşan poliklonal antikor 5mg/mL
Keçi Anti-Tavşan IgG H&L (Alexa Fluor® 488) 1mg/mL

Tablo 2: Bu çalışmada kullanılan antikor konsantrasyonu.

Astar Sıra(5' ila 3')
GAPDH Foward: CGGCAAGTTCAACGGCAGTCAAGG
Geri vites: ACGACATACTCAGCACCAGCATCACC
Runx2 Foward: GCCTTCAAGGTTGTAGCCCT
Ters: TGAACCTGGCCACTTGGTTT
ALP Foward: AAACTCGCTTATGGTCCCCG
Geri vites: TGGGTTTGAATTCCTGCGGT
Bps Foward: GCACGGTTGAGTATGGGGAA
Geri vites: ATCCTGACCCCCGTAGCCTT
Ocn İleri:CAACCCCAATTGTGACGAGC
Ters:GGCAACACATGCCCTAAACG
Cebpa Foward: AGTCGGTGGATAAGAACAGCAACG
Ters: CGGTCATTGTCACTGGTCAACTCC
Pparφ1 Foward: CCATCGAGGACATCCAAGACAACC
Ters: GTGCTCTGTGACAATCTGCCTGAG

Tablo 3: Gerçek zamanlı PCR'de kullanılan astarlar.

Figure 1
Şekil 1: mBMSC'lerin izolasyonu ve kültürü. (A) Protokolün şematik diyagramı. mBMSC'ler 0. günde izole edildi ve α-MEM kültür ortamı ile kuluçkaya kaldırıldı. 7. günde, P0 mBMSC'ler akış sitometrisi sıralama yoluyla saflaştırılmış ve sıralanmış hücreler yeni bir kültür çanağı üzerine kaplanmıştır. 14. günde P1 mBMSC'ler toplandı ve 12 kuyu plakasında kaplama yapıldı. 15. günde P2 mBMSC'ler osteoblastlara, adipojenik hücrelere ve kondroblastlara karşılık gelen indüksiyon ortamı altında indüklendi. (B) Sıçan mandibular kemik iliğinin şematik modeli ve P0 mBMSC'lerin mikroskobik gözlemi. (C) Sıçan mBMSC'lerin akış sitometrisi sıralaması. Akış sitometrisi analizi, bu hücrelerin CD29 ve CD90 için pozitif, ancak BMSC özellikleriyle uyumlu cd45 için negatif olduğunu göstermektedir. Bunlardan 1.4 x 106 hücre sıralandı ve bu da toplam hücrelerin uygun şekilde% 80'ini oluşturdu. (D) Kristal mor lekeli P2 mBMSC klonlarının temsili görüntüsü. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Figure 2
Şekil 2: mBMSC'lerin osteojenik farklılaşma potansiyeli. (A) 7 günlük osteojenik indüksiyondan sonra ALP aktivitesinin değişimi görselleştirildi. Osteojenik farklılaşmanın indüksiyonu sonrasında 14 gün sonra çok sayıda mineralize nodül alizarin kırmızısı lekelenme altında lekelendi. (B,C) ALP ve alizarin kırmızı lekelemenin pozitif alanı Image J yazılımı kullanılarak değerlendirildi. (C-G) Osteoblast spesifik belirteçlerin mRNA ekspresyumu Runx2, Alp, Bsp ve Ocn 7 günlük osteogenezden sonra önemli ölçüde artmıştır. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Figure 3
Şekil 3: Dokuz günlük indüksiyondan sonra mBMSC'lerin adipojenik farklılaşma potansiyeli. (A) Çok miktarda lipit damlacık formu ve adiposit yağ-kırmızı-O ile boyandı. (B,C) Adipojenik belirteçlerin mRNA ekspresyânı Cebpa ve Pparφ1, 9 günlük adipogenezden sonra önemli ölçüde artmıştır. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Figure 4
Şekil 4: Kondrojenik farklılaşma etkisinin stereoskop görünümü. (A) 21 gün kondrojenik indüksiyondan sonra mBMSC'ler alcian mavisi lekeleme için pozitif gösterdi. (B) Anti-tip II kollajen ile boyanmış kondrojenik agreganın immünoresans görüntüsü. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Bu protokol, güçlü farklılaşma yeteneğine sahip proliferatif mBMSC'ler elde etmenin basit ve güvenilir bir yolu olan tüm kemik iliği yapışması ve floresan hücre sıralamasını birleştirerek BMSC'leri fare mandibulalarından in vitro olarak izole etmek için bir yöntem açıklanmaktadır. Bu yöntem, akış hücresi sıralama ile mBMSC'leri önceden saflaştırabilir, ancak hücre homojenliği için daha yüksek gereksinimler varsa, daha kesin saflaştırma yöntemleri gerekebilir.

Şu anda, tüm kemik iliği yapışması, yoğunluk gradyan santrifüjleme, floresan hücre sıralama ve manyetik aktif hücre sıralama22dahil olmak üzere mBMSC'leri izole etmek için kullanılan dört ana teknik vardır. Tüm kemik iliği yapışması ve yoğunluk gradyan santrifüjleme, mBMSC'leri kısa sürede elde etmek için kullanılan en yaygın ve kolay yöntemlerdir, ancak hasat edilen mBMSC'lerin düşük saflığı başlıca dezavantajlarıdır. Son iki yöntem, yüksek oranda saflaştırılmış mBMSC'leri immünolojik tekniklerle izole edebilir, ancak pahalı olma, uzun zaman alma ve hücre canlılığının bozulması eksikliklerine sahiptir. Bu çalışmada tüm kemik iliği yapışmasının avantajları ve floresan hücre sıralama yöntemi birleştirilerek kısa sürede yeterli sayıda proliferatif mBMSC elde edilmiştir.

Şüphesiz, bu protokoldeki en kritik adımlardan biri, eksenel ve apandiküler kemiklerden oldukça farklı olan fare mandibulasının diseksiyonudur. Sağlam bir örnek elde etmek için fare mandibulasının anatomisini anlamak önemlidir. İnsana benzer şekilde, sıçan mandibulası maksillanın altında oturur, alt dişleri yerinde tutar ve kafatasına bilateral kondyles ile bağlanır. Mandibula kafatasında hareket edebilen tek kemik olduğundan, hareketini kontrol eden mandibula bağlı birçok kas vardır. Sadece bu yumuşak dokuları tamamen çıkararak ve ağzı maksimum şekilde açarak kafatasına bağlanan kondilenler açığa çıkabilir. Kondiler boynun mandibulada fiziksel bir zayıflık olduğunu ve kırılmasının kolay olduğunu da belirtmek gerekir. Mandibulayı aşağı doğru döndürürken aşırı direnç bulunursa, mastikatör kasların tamamen çıkarılmayabileceği anlamına gelir. Bu gözlendiğinde, kısıtlı bir şekilde döndürmeyin, aksi takdirde kondiler boynu kırmak kolaydır, böylece hücre kirlenmesine yol açan. MBMSC'lerin ayrılması ve kültüründeki diğer zorluklar arasında kemik iliğinde düşük içerik, hassas hücre aktivitesi, düşük saflık, düşük hücre sıklığı ve hematopoetik hücrelerin kirlenmesi18,23bulunur. İyi büyüme ve nispeten yüksek farklılaşma potansiyeline sahip mBMSC'ler elde etmek, mBMSC'lerin aktivitesini sağlamak çok önemlidir. Genç sıçanlar iyi canlılığı korumak için tercih edildiğinden, bu ve sonraki deneyler için dört haftalık sıçanların kullanımı da dahil olmak üzere birkaç önemli adım vardır. Birçok çalışma, mBMSC'lerin aktivitesinin deneysel hayvanların yaşıyla ilgili olduğunu doğrulamıştır. Eski donörlerden gelen mBMSC'ler daha düşük çoğalma aktivitesi, farklılaşma potansiyeli ve yaşam süresi2ile sonuçlanabilir. Hücre hasadı sırasındaki tüm işlemlerin buz üzerinde tamamlanması ve çalışma süresinin mümkün olduğunca kısa, tercihen 2 saat içinde tamamlanması gerekir. Ek olarak, tripsin sindirim süresini 3 dakikadan fazla tutmayın. Son olarak, bu protokoldeki bir başka zorluk da mBMSC'lerin hasat sürecidir. MBMSC'leri kemik boşluğundan yıkamak zahmetli olabilir, çünkü fare mandibulasının boşluğu çok küçüktür, bu nedenle anatomik yapıya aşina olmak çok önemlidir. Mikro BT görüntüleri bu konuda çok yardımcı olabilir. Ayrıca, çocuk kemikleri ince ve kırılgan olduğu için kırılmanın kontaminasyona neden olabileceğini belirtmek gerekir.

İmmünofenik karakterizasyona atıfta bulunan BMSC'ler birkaç fenotip ifade eder, ancak hiçbiri onlara özgü değildir24. BMSC'lerin CD11b, CD14, CD34 veya CD45'i ifade etmedikleri, ancak Sca-1, CD29, CD90 ve CD105'in yüksek bir ifadesine sahip oldukları genellikle kabul edilir. Bu çalışma floresan hücre sıralama13 , 14,25 için CD29, CD90 veCD45'inyaygın olarak kabul edilen işaretlerini seçti. CD29+CD90+CD45 hücrenin toplam hücrelerin uygun şekilde% 80'ini oluşturduğunu ve bunun sonraki hücre kültürü ve araştırmaları için yeterli olduğunu buldu.

Onlarca yıldır kök hücre tedavisi, bağışıklık sistemi hastalıkları, hematolojik sistemik hastalıklar, kanserler veya travma gibi çeşitli hastalıkların tedavisinde yaygın olarak kullanılmaktadır. Kuşkusuz, mBMSC'ler, BMSC'lerin yerine, üstün özellikleri nedeniyle kök hücre tedavisinde daha güvenli ve güçlü bir araç olarak kullanılabilir. Bu nedenle, hücre kültürü ve mBMSC'lerin genişlemesi, tedavi için yeterli sayıda hücre elde etmek için özellikle önemli hale gelir.

Özetle, bu çalışma, kısa bir süre içinde yüksek homojenlik ve çoklu farklılaşma yeteneğine sahip bol miktarda mBMSC toplamak için umut verici ve güvenilir bir protokol göstermiştir.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Tüm yazarlar çıkar çatışmaları olmadığını belirtir.

Acknowledgments

Şanghay Dokuzuncu Halk Hastanesi Kraniyofasiyal Anomaliler Için Dijitalleştirilmiş Stomatoloji ve Araştırma Merkezi Laboratuvarı'nın yardımı için teşekkür ederiz. Bu makalenin çalışmaları Çin Ulusal Doğa Bilimleri Vakfı'nın (NSFC) hibeleriyle desteklenmektedir [81570950,81870740,81800949], Şanghay Zirvesi & Plato Disiplinleri, Şanghay Hassas Tıp Enstitüsü'nden SHIPM-mu fonu, Şanghay Dokuzuncu Halk Hastanesi, Şanghay Jiao Tong Üniversitesi Tıp Fakültesi [JC201809], Şanghay Jiao Tong Üniversitesi Tıp Fakültesi için Üst Düzey İnovasyon Ekibinin Teşvik Projesi. Ve L.J. Üstün Gençlik Tıbbi Yetenekleri, Şanghay "Tıbbi Yeteneğin Yükselen Yıldızları" Gençlik Geliştirme Programı ve Şanghay Jiaotong Üniversitesi'nden "Chen Xing" projesinin bir bilginidir.

Materials

Name Company Catalog Number Comments
0.25% Trypsin-EDTA(1X) Gibco 25200072
10cm culture dish Corning
acutenaculum
Adipogenic differentiation medium Cyagen biosciences inc. MUBMX-90031
Alcian Blue Beyotime Biotechnology
Alizarin red Sigma-Aldrich A5533
Alkaline Phosphatase Color Development Kit Beyotime Biotechnology C3206
alpha-Minimum essential medium GE Healthcare HyClone Cell Culture SH30265.01B
Anti -CollagenII Rabbit pAb Abcam ab34712
Antibodies against CD16/CD32
Antifade Mounting Medium with DAPI Beyotime Biotechnology P0131
APC anti-mouse/rat CD29 Antibody biolegend inc 102215
Biosafety cabinet Esco AC2-4S8-CN
CD45 Monoclonal Antibody (OX1), PE, eBioscience Invitrogen 12-0461-82
CD90.1 (Thy-1.1) Monoclonal Antibody (HIS51), FITC, eBioscience Invitrogen 11-0900-85
Centrifuge cence L500
Chondrogenesis differentiation medium cyagen biosciences inc.
Confocal laser scanning microscope Zeiss LSM880
Countess II FL Automated Cell Counter Invitrogen AMQAF1000
Crystal Violet Staining Solution Beyotime Biotechnology C0121
Fetal Bovine Serum GE Healthcare HyClone Cell Culture SH30084.03
Goat Anti-Rabbit IgG H&L (Alexa Fluor 488) abcam ab150077
Incubator Esco CCL-170B-8
Inverted microscope olympus CKX53
Magzol reagent(Trizol reagent) Magen
micropipettor Eppendorf
Oil Red O
Osteogenic differentiation medium cyagen biosciences inc. MUBMX-90021
Penicillin-Streptomycin Gibco 15070063
Phosphate-buffered saline(1X) Gibco 20012027
PrimeScript RT Master Kit TakaRa Bio Inc RR036A
Proteinase K Sigma-Aldrich P6556
QuickBlock Blocking Buffer Beyotime Biotechnology P0260
scissor
SYBR1 Premix TakaRa Bio Inc
Toluidine Blue Beyotime Biotechnology
Trypan Blue Solution, 0.4% Gibco 15250061

DOWNLOAD MATERIALS LIST

References

  1. Jin, C., et al. Stem cell education for medical students at Tongji University: Primary cell culture and directional differentiation of rat bone marrow mesenchymal stem cells. Biochemistry and Molecular Biology Education. 46, (2), 151-154 (2018).
  2. Chu, D. T., et al. An Update on the Progress of Isolation, Culture, Storage, and Clinical Application of Human Bone Marrow Mesenchymal Stem/Stromal Cells. International Journal of Molecular Sciences. 21, (3), 708 (2020).
  3. Jin, Z., Chen, J., Shu, B., Xiao, Y., Tang, D. Bone mesenchymal stem cell therapy for ovariectomized osteoporotic rats: a systematic review and meta-analysis. BMC Musculoskeleton Disorder. 20, (1), 556 (2019).
  4. Jiang, Y., et al. Pluripotency of mesenchymal stem cells derived from adult marrow. Nature. 418, (6893), 41-49 (2002).
  5. Musina, R. A., Bekchanova, E. S., Belyavskii, A. V., Sukhikh, G. T. Differentiation potential of mesenchymal stem cells of different origin. Bulletin of Experimental Biology and Medicine. 141, (1), 147-151 (2006).
  6. Lloyd, B., et al. Similarities and differences between porcine mandibular and limb bone marrow mesenchymal stem cells. Archives in Oral Biology. 77, 1-11 (2017).
  7. Zhang, W., et al. Comparison of the use of adipose tissue-derived and bone marrow-derived stem cells for rapid bone regeneration. Journal of Dental Research. 92, (12), 1136-1141 (2013).
  8. Stefanik, D., et al. Disparate osteogenic response of mandible and iliac crest bone marrow stromal cells to pamidronate. Oral Disorders. 14, (5), 465-471 (2008).
  9. Aghaloo, T. L., et al. Osteogenic potential of mandibular vs. long-bone marrow stromal cells. Journal of Dental Research. 89, (11), 1293-1298 (2010).
  10. Kaigler, D., et al. Stem cell therapy for craniofacial bone regeneration: a randomized, controlled feasibility trial. Cell Transplantation. 22, (5), 767-777 (2013).
  11. Li, C., Wang, F., Zhang, R., Qiao, P., Liu, H. Comparison of proliferation and osteogenic differentiation potential of rat mandibular and femoral bone marrow mesenchymal stem cells in vitro. Stem Cells Development. 2020, 1941629 (2020).
  12. Matsubara, T., et al. Alveolar bone marrow as a cell source for regenerative medicine: differences between alveolar and iliac bone marrow stromal cells. Journal of Bone and Mineral Research. 20, (3), 399-409 (2005).
  13. Chan, C. K. F., et al. Identification of the Human Skeletal Stem Cell. Cell. 175, (1), 43-56 (2018).
  14. Bianco, P., Riminucci, M., Gronthos, S., Robey, P. G. Bone marrow stromal stem cells: nature, biology, and potential applications. Stem Cells. 19, (3), 180-192 (2001).
  15. Franken, N. A., Rodermond, H. M., Stap, J., Haveman, J., van Bree, C. Clonogenic assay of cells in vitro. Nature Protocol. 1, (5), 2315-2319 (2006).
  16. Xu, H., et al. Icariin prevents oestrogen deficiency-induced alveolar bone loss through promoting osteogenesis via STAT3. Cell Proliferation. 53, (2), 12743 (2020).
  17. Zhang, P., Wu, Y., Jiang, Z., Jiang, L., Fang, B. Osteogenic response of mesenchymal stem cells to continuous mechanical strain is dependent on ERK1/2-Runx2 signaling. Internation Journal of Molecular Medicine. 29, (6), 1083-1089 (2012).
  18. Zhu, H., et al. A protocol for isolation and culture of mesenchymal stem cells from mouse compact bone. Nature Protocol. 5, (3), 550-560 (2010).
  19. Lach, M. S., et al. Chondrogenic Differentiation of Pluripotent Stem Cells under Controllable Serum-Free Conditions. International Journal of Molecular Sciences. 20, (11), 2711 (2019).
  20. Huang, X., Zhong, L., Hendriks, J., Post, J. N., Karperien, M. The Effects of the WNT-Signaling Modulators BIO and PKF118-310 on the Chondrogenic Differentiation of Human Mesenchymal Stem Cells. International Journal of Molecular Sciences. 19, (2), 561 (2018).
  21. Gale, A. L., Linardi, R. L., McClung, G., Mammone, R. M., Ortved, K. F. Comparison of the Chondrogenic Differentiation Potential of Equine Synovial Membrane-Derived and Bone Marrow-Derived Mesenchymal Stem Cells. Frontiers in Veterinary Sciences. 6, 178 (2019).
  22. Li, X., Zhang, Y., Qi, G. Evaluation of isolation methods and culture conditions for rat bone marrow mesenchymal stem cells. Cytotechnology. 65, (3), 323-334 (2013).
  23. Kagami, H., Agata, H., Tojo, A. Bone marrow stromal cells (bone marrow-derived multipotent mesenchymal stromal cells) for bone tissue engineering: basic science to clinical translation. International Journal of Biochemistry and Cell Biology. 43, (3), 286-289 (2011).
  24. Chamberlain, G., Fox, J., Ashton, B., Middleton, J. Concise review: mesenchymal stem cells: their phenotype, differentiation capacity, immunological features, and potential for homing. Stem Cells. 25, (11), 2739-2749 (2007).
  25. Abdallah, B. M., Alzahrani, A. M., Abdel-Moneim, A. M., Ditzel, N., Kassem, M. A simple and reliable protocol for long-term culture of murine bone marrow stromal(mesenchymal) stem cells that retained their in vitro and in vivo stemness in long-term culture. Biology Proceedings Online. 21, 3 (2019).
Sıçanlarda Mandibuler Kemik İliği Mezenkimal Kök Hücrelerinin İzolasyonu ve Yetiştirilmesi
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Hong, Y., Xu, H., Yang, Y., Zhou, S., Jin, A., Huang, X., Dai, Q., Jiang, L. Isolation and Cultivation of Mandibular Bone Marrow Mesenchymal Stem Cells in Rats. J. Vis. Exp. (162), e61532, doi:10.3791/61532 (2020).More

Hong, Y., Xu, H., Yang, Y., Zhou, S., Jin, A., Huang, X., Dai, Q., Jiang, L. Isolation and Cultivation of Mandibular Bone Marrow Mesenchymal Stem Cells in Rats. J. Vis. Exp. (162), e61532, doi:10.3791/61532 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter