Using Next Generation Sequencing to Identify Mutations Associated with Repair of a CAS9-induced Double Strand Break Near the CD4 Promoter

Summary

Presented here is sgRNA/CAS9 endonuclease and next-generation sequencing protocol that can be used to identify the mutations associated with double strand break repair near the CD4 promoter.

Abstract

Double strand breaks (DSBs) in DNA are the most cytotoxic type of DNA damage. Because a myriad of insults can result in these lesions (e.g., replication stress, ionizing radiation, unrepaired UV damage), DSBs occur in most cells each day. In addition to cell death, unrepaired DSBs reduce genome integrity and the resulting mutations can drive tumorigenesis. These risks and the prevalence of DSBs motivate investigations into the mechanisms by which cells repair these lesions. Next generation sequencing can be paired with the induction of DSBs by ionizing radiation to provide a powerful tool to precisely define the mutations associated with DSB repair defects. However, this approach requires computationally challenging and cost prohibitive whole genome sequencing to detect the repair of the randomly occurring DSBs associated with ionizing radiation. Rare cutting endonucleases, such as I-Sce1, provide the ability to generate a single DSB, but their recognition sites must be inserted into the genome of interest. As a result, the site of repair is inherently artificial. Recent advances allow guide RNA (sgRNA) to direct a Cas9 endonuclease to any genome locus of interest. This could be applied to the study of DSB repair making next generation sequencing more cost effective by allowing it to be focused on the DNA flanking the Cas9-induced DSB. The goal of the manuscript is to demonstrate the feasibility of this approach by presenting a protocol that can define mutations that stem from the repair of a DSB upstream of the CD4 gene. The protocol can be adapted to determine changes in the mutagenic potential of DSB associated with exogenous factors, such as repair inhibitors, viral protein expression, mutations, and environmental exposures with relatively limited computation requirements. Once an organism's genome has been sequenced, this method can be theoretically employed at any genomic locus and in any cell culture model of that organism that can be transfected. Similar adaptations of the approach could allow comparisons of repair fidelity between different loci in the same genetic background.

Introduction

Maintaining genomic stability is critical for all living organisms. Accurate DNA replication and a robust DNA damage response (DDR) are necessary to faithfully propagate the genetic material^1,2. DNA damages occur regularly in most cells^2,3. When these damages are sensed, cell cycle progression is halted, and DNA repair mechanisms are activated. Double strand breaks in DNA or DSBs are the most toxic and mutagenic type of DNA damage^3,4.

While several DDR signaling path....

Protocol

1. Cell plating

1. Grow HFK LXSN and HFK 8E6 cells in 10 cm plates in keratinocyte culture media (10 mL/plate) with human keratinocyte growth supplement (HKGS) and 1% penicillin/streptomycin. Grow cells to about 80% confluence at 37 °C in a jacket incubator with 5% CO₂.
2. Replace culture media with 3 mL of trypsin-EDTA (0.05%, ethylenediamine tetraacetic acid). Incubate at 37 °C for 3 min. Neutralize trypsin with equal volume of fetal bovine serum (FBS) supplemented media and transfer cells to a 15 mL centrifuge tube. Centrifuge at 300 x g for 5 min.
3. Resuspend cells with 10 mL of keratinocyte culture medi....

Results

Three representative results are presented for this protocol. Figure 1 is an immunoblot confirming expression of CAS9 in HFK control (LXSN) and HFK expressing beta-HPV 8E6 (8E6). 48 h after transfection, whole cell lysates were harvested and subsequently probed with an anti-CAS9 antibody (or GAPDH as a loading control). The result shows that HFK LXSN and HFK 8E6 are expressing similar amount of CAS9 indicating that transfection efficiency is similar between t.......

Discussion

In addition to the depth of information provided, there are several advantages to this method. First, DSB repair, in theory, can be assessed at any genomic loci without modifying the genome of the cell of interest. Second, access to NGS analysis of repair is increased by the reduced cost and computational effort afforded by making and analyzing a single DSB targeted to a defined area. Finally, with the genomes of additional organisms routinely becoming available and multiple publications demonstrating successful transfec.......

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
6 Well Tissue Culture Plate	Celltreat	229106	Cell culture plate
BCA Kit	VWR	89167-794	BCA assay kit
Centrifuge 5910 R	Eppendorf	2231000772	Tabletop Centrifuge
CLC Genomic Workbench	Qiagen	832001	deep sequence data analysis software/indel caller/variant caller
Digital Microplate Genie pulse	Scientific industries	SI-400A	Plate shaker
DYKDDDDK Tag Monoclonal Antibody (FG4R)	ThermoFisher Scientific	MA191878	Anti-FLAG antibody
Epilife CF Kit	ThermoFisher Scientific	MEPICF500	Cell cultrue media and supplements
Fetal Bovine Serum (FBS)	VWR	89510-194	Cell culture supplement
Goat anti-Rabbit IgG	ThermoFisher Scientific	A-11012	Secondary antibody
HighPrep PCR Clean-up system	MagBio	AC-60005	Bead-based PCR cleanup kit
KAPA HiFi HotStart ReadyMix PCR Kit	KAPA Biosystems	KK2600	PCR mastermix/PCR assay
MagAttract HMW DNA kit	Qiagen	67563	High Molecular Weight DNA extraction kit
Magnetic Stand-96	Thermo Fisher Scientific	AM10027	96-Well Magnetic Rack
MiniAmp Thermal Cycler	Applied Biosystems	A37834	Thermal Cycler
Miseq	Illumina	SY-410-1003	Sequencer
Miseq v2 300 cycle reagent kit	Illumina	MS-102-2002	300-cycle cartridge/sequencing reagents
Nextera XT DNA Library Prep kit	Illumina	FC-131-1024	Library preparation kit
Nextera XT Kit v2 Set A	Illumina	20027215	Indexes
Nunc 96-well polypropylene DeepWell Stroage plates	Thermo Fisher Scientific	260251	deep well 96-well plates
Penicillin-Streptomycin Solution (100X)	Calsson Labs	PSL02-6X100ML	Antibiotics for cell culture
Phosphate Buffered Saline (PBS)	Bio Basic	PD8117	PBS
px330-CD4	Addgen	136938	SgRNA/CAS9 plasmids targeting 5’- GGCGTATCTGTGTGAGGACT
QIAxcel Advanced System	Qiagen	9001941	capillary electrophersis machine
QIAxcel DNA screening kit	Qiagen	929004	DNA buffer/ capillary electrophersis tubes
Qubit 1x ds HS Assay Kit	ThermoFisher Scientific	Q23851	Fluorometer reagents/1x dsDNA solution
Qubit 4 Fluorometer	ThermoFisher Scientific	Q33238	Fluorometer
Qubit Assay Tubes	Thermo Fisher Scientific	Q32856	Fluorometer assay tubes
RIPA Lysis Buffer	VWR	VWRVN653-100ML	Lysis buffer for protein extraction
Trypsin-EDTA (0.05%), phenol red	ThermoFisher Scientific	25300054	Trypsin
Vortex-Genie 2	Scientific industries	SI-0236	Vortex
Xfect Transfection Reagent	Takara Bio	631318	Transfection reagent
genomic data analysis software	QIAGEN	CLC Workbench v21.0.	Data analysis software