Lentiviral Mediated Delivery of shRNAs to hESCs and NPCs Using Low-cost Cationic Polymer Polyethylenimine (PEI)

Summary

Using the low-cost cationic polymer polyethylenimine (PEI), we produced lentiviral particles for stable expression of shRNAs in H9 human embryonic stem cells (hESCs) and transiently transduced H9-derived neural progenitor cells (NPCs) at high efficiency.

Abstract

The current protocol describes the use of lentiviral particles for the delivery of short hairpin RNAs (shRNAs) to both human embryonic stem cells (hESCs) as well as neural progenitor cells (NPCs) derived from hESCs at high efficiency. Lentiviral particles were generated by co-transfecting HEK293T cells using entry vectors (carrying shRNAs) along with packaging plasmids (pAX and pMD2.G) using the low-cost cationic polymer polyethylenimine (PEI). Viral particles were concentrated using ultracentrifugation, which resulted in average titers above 5 x 10⁷. Both hESCs and NPCs could be infected at high efficiencies using these lentiviral particles, as shown by puromycin selection and stable expression in hESCs, as well as transient GFP expression in NPCs. Furthermore, western blot analysis showed a significant reduction in the expression of genes targeted by shRNAs. In addition, the cells retained their pluripotency as well as differentiation potential, as evidenced by their subsequent differentiation into different lineages of CNS. The current protocol deals with the delivery of shRNAs; however, the same approach could be used for the ectopic expression of cDNAs for overexpression studies.

Introduction

Human embryonic stem cells (hESCs) derived from the blastocyst inner cell mass are pluripotent and can be differentiated into different cell types depending upon external factors under in vitro conditions^1,2. In order to fully harness the potential of hESCs, it is imperative to have rapid and reliable gene delivery methods for these cells. Conventionally, the techniques used can be broadly classified into two types: nonviral and viral gene delivery systems^3,4. The more frequently used nonviral gene delivery systems are lipofection, electropora....

Protocol

1. Transfection of HEK293T cells using either PEI or Lipofectamine 3000 reagent

1. Culture HEK293T cells in DMEM + 10% FBS + 1x penicillin/streptomycin at 37 °C in a humidified incubator with an atmosphere of 5% CO₂ and 21% O₂ until they are 90% confluent before seeding for transfection. Use a relatively low passage number of cells for high titer virus production (ideally less than P30).
2. Seed 4 x 10⁶ cells in 10 mL of complete growth medium in a 100 mm tissue culture plate and grow overnight in a humidified tissue culture incubator with an atmosphere of 5% CO₂ and 21% O_2.

Results

Following gene transfer, high viability of hESCs is inevitably required. Despite the efforts and optimization of protocols to reduce cell death following electroporation of hESCs, more than 50% cell death is still observed after electroporation of these cells, along with low transfection efficiency²⁰. Lentiviral mediated gene transfer not only results in high efficiency of gene transfer but also demonstrates high levels of cell viability following transduction. The results below present two approa.......

Discussion

The ability to genetically modify stem cells for study or clinical purposes is limited both by technology and the basic understanding of the biology of hESCs. Techniques that have shown significant potential in mouse ESCs, like lipofection and electroporation, are not highly efficient for hESCs, which are notoriously difficult for gene delivery by conventional methods²⁰. This notion has led to not only the optimization of existing techniques but also the development of novel methods for increased .......

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
2-Mercaptoethanol	Invitrogen	31350010
38.5 mL, Sterile + Certified Free Open-Top Thinwall Ultra-Clear Tubes	Beckman Coulter	C14292
Accutase	Stem Cell Technologies	7920
bFGF Recombinant human	Invitrogen	PHG0261
Bovine serum albumin FRAC V	Invitrogen	15260037
Corning Matrigel Basement Membrane Matrix, LDEV-free	Corning	354234
Cyclopamine	Stem Cell Technologies	72074
DMEM media	Invitrogen	11995073
DMEM Nutrient mix F12	Invitrogen	11320033
DPBS w/o: Ca and Mg	PAN Biotech	P04-36500
Fetal bovie serum	Invitrogen	10270106
GAPDH (14C10) Rabbit mAb Antibody	CST	2118S
Gentle Cell Dissociation Reagent	Stem Cell Technologies	7174
HyClone Non Essential Amino Acids (NEAA) 100X Solution	GE healthcare	SH30238.01
L Glutamine, 100X	Invitrogen	2924190090
L2HGDH Polyclonal antibody	Proteintech	15707-1-AP
L2HGDH shRNA	Macrogen		Seq: CGCATTCTTCATGTGAGAAAT
Lipofectamine 3000 kit	Thermo Fisher	L3000001
mTesR1 complete media	Stem Cell Technologies	85850
Neurobasal medium 1X CTS	Invitrogen	A1371201
Neuropan 2 Supplement 100x	PAN Biotech	P07-11050
Neuropan 27 Supplement 50x	PAN Biotech	P07-07200
Penicillin streptomycin SOL	Invitrogen	15140122
pLKO.1 TRC vector	Addgene	10878
pLL3.7 vector	Addgene	11795
pMD2.G	Addgene	12259
Polybrene infection reagent	Sigma	TR1003- G
Polyethylenimine, branched	Sigma	408727
psPAX2.0	Addgene	12260
Purmorphamine	Tocris	4551/10
Puromycin	Invitrogen	A1113802
ROCK inhibitor Y-27632 dihydrochloride	Tocris	1254
SB 431542	Tocris	1614/10
Trypsin .05% EDTA	Invitrogen	25300062
XAV 939	Tocris	3748/10