AAV peptide display library generation and subsequent validation through the barcoding of candidates with novel properties for the creation of next-generation AAVs.
A subscription to JoVE is required to view this content. Sign in or start your free trial.
Method Article
Isolation of Next-Generation Gene Therapy Vectors through Engineering, Barcoding, and Screening of Adeno-Associated Virus (AAV) Capsid Variants
In This Article
Summary
Abstract
Gene delivery vectors derived from Adeno-associated virus (AAV) are one of the most promising tools for the treatment of genetic diseases, evidenced by encouraging clinical data and the approval of several AAV gene therapies. Two major reasons for the success of AAV vectors are (i) the prior isolation of various naturally occurring viral serotypes with distinct properties, and (ii) the subsequent establishment of powerful technologies for their molecular engineering and repurposing in high throughput. Further boosting the potential of these techniques are recently implemented strategies for barcoding selected AAV capsids on the DNA and RNA level, permitting their comprehensive and parallel in vivo stratification in all major organs and cell types in a single animal. Here, we present a basic pipeline encompassing this set of complementary avenues, using AAV peptide display to represent the diverse arsenal of available capsid engineering technologies. Accordingly, we first describe the pivotal steps for the generation of an AAV peptide display library for the in vivo selection of candidates with desired properties, followed by a demonstration of how to barcode the most interesting capsid variants for secondary in vivo screening. Next, we exemplify the methodology for the creation of libraries for next-generation sequencing (NGS), including barcode amplification and adaptor ligation, before concluding with an overview of the most critical steps during NGS data analysis. As the protocols reported here are versatile and adaptable, researchers can easily harness them to enrich the optimal AAV capsid variants in their favorite disease model and for gene therapy applications.
Introduction
Gene transfer therapy is the introduction of genetic material in cells to repair, replace, or alter the cellular genetic material to prevent, treat, cure, or ameliorate disease. Gene transfer, both in vivo and ex vivo, relies on different delivery systems, non-viral and viral. Viruses have evolved naturally to efficiently transduce their target cells and can be used as delivery vectors. Amongst the different types of viral vectors employed in gene therapy, adeno-associated viruses have been increasingly used, owing to their lack of pathogenicity, safety, low immunogenicity, and most importantly their ability to sustain long-term, non-integrating expr....
Access restricted. Please log in or start a trial to view this content.
Protocol
1. AAV2 random 7-mer peptide display library preparation
NOTE: For the preparation of an AAV2 random peptide display library, synthesize the degenerate oligonucleotides as single-stranded DNA, convert it to double-stranded DNA, digest, ligate to the acceptor plasmid, and electroporate.
- Design of degenerate oligonucleotides
- Order the degenerate oligonucleotides and avoid codon bias. In the oligonucleotide 5' CAGTCGGCCAG AG W GGC (X01)7 GCCCAGGCGGCTGACGAG 3', X01 corresponds to 20 codons, each encoding one of the 20 amino acids. The W can be A or T, producing the codons AGA or AGT, which enc....
Access restricted. Please log in or start a trial to view this content.
Results
Generation of an AAV2 peptide display library. As a first step toward the selection of engineered AAVs, the generation of a plasmid library is described. The peptide insert is produced by using degenerate primers. Reducing the combination of codons in those from 64 to 20 has the advantages of eliminating stop codons and facilitating NGS analysis, by reducing library diversity on the DNA but not the protein level. The oligonucleotide insert is purchased as single-stranded DNA (Figure .......
Access restricted. Please log in or start a trial to view this content.
Discussion
In this protocol, the steps needed for peptide display AAV capsid engineering and for barcoded AAV library screening, as well as for bioinformatic analysis of library composition and capsid performance, are outlined. This protocol focuses on the steps that facilitate the bioinformatic analysis of these types of libraries, because most virology laboratories lag in programming skills to match their proficiency in molecular biology techniques. Both types of libraries have been extensively described in the literature, as out.......
Access restricted. Please log in or start a trial to view this content.
Disclosures
D.G. is a co-founder of AaviGen GmbH. D.G. and K.R. are inventors on a pending patent application related to the generation of immune-evading AAV capsid variants. The rest of the authors have nothing to disclose.
Acknowledgements
D.G. greatly appreciates support by the German Research Foundation (DFG) through the DFG Collaborative Research Centers SFB1129 (Projektnummer 240245660) and TRR179 (Projektnummer 272983813), as well as by the German Center for Infection Research (DZIF, BMBF; TTU-HIV 04.819).
....Access restricted. Please log in or start a trial to view this content.
Materials
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| Amplification primer | ELLA Biotech (Munich, Germany) | - | Second-strand synthesis of oligonucleotide insert |
| Agilent DNA 1000 Reagents | Agilent Technologies (Santa Clara, CA, USA) | 5067-1504 | DNA fragment validation |
| Agilent 2100 Bioanalyzer System | Agilent Technologies (Santa Clara, CA, USA) | G2938C | DNA fragment validation |
| AllPrep DNA/RNA Mini Kit | Qiagen (Venlo, Netherlands) | 80204 | DNA/RNA extraction |
| Agilent DNA 1000 Reagents | Agilent Technologies (Santa Clara, CA, USA) | 5067-1504 | NGS Library preparation |
| Agilent 2100 Bioanalyzer System | Agilent Technologies (Santa Clara, CA, USA) | G2938C | NGS Library preparation |
| BC-seq fw: | IDT (San Joce, CA, CA, USA) | ATCACTCTCGGCATGGACGAGC | NGS Library preparation |
| BC-seq rv: | IDT (San Joce, CA, CA, USA) | GGCTGGCAACTAGAAGGCACA | NGS Library preparation |
| β-Mercaptoethanol | Millipore Sigma (Burlington, MA, USA) | 44-420-3250ML | DNA/RNA extraction |
| BglI | New England Biolabs (Ipswich, MA, USA) | R0143 | Digestion of double-stranded insert |
| C1000 Touch Thermal Cycler | Bio-Rad (Hercules, CA, USA) | 1851196 | dd-PCR cycler |
| dNTPS | New England Biolabs (Ipswich, MA, USA) | N0447S | NGS Library preparation |
| ddPCR Supermix for probes (no dUTP) | Bio-Rad (Hercules, CA, USA) | 1863024 | dd-PCR supermix |
| Droplet Generation Oil for Probes | Bio-Rad (Hercules, CA, USA) | 1863005 | dd-PCR droplet generation oil |
| DG8 Cartridges for QX100 / QX200 Droplet Generator | Bio-Rad (Hercules, CA, USA) | 1864008 | dd-PCR droplet generation cartridge |
| DG8 Cartridge Holder | Bio-Rad (Hercules, CA, USA) | 1863051 | dd-PCR cartridge holder |
| Droplet Generator DG8 Gasket | Bio-Rad (Hercules, CA, USA) | 1863009 | dd-PCR cover for cartridge |
| ddPCR Plates 96-Well, Semi-Skirted | Bio-Rad (Hercules, CA, USA) | 12001925 | dd-PCR 96-well plate |
| E.cloni 10G SUPREME Electrocompetent Cells | Lucigen (Middleton, WI, USA) | 60081-1 | Electrocompetent cells |
| Electroporation cuvettes, 1mm | Biozym Scientific (Oldendorf, Germany) | 748050 | Electroporation |
| GAPDH primer/probe mix | Thermo Fischer Scientific (Waltham, MA, USA) | Mm00186825_cn | Taqman qPCR primer |
| Genepulser Xcell | Bio-Rad (Hercules, CA, USA) | 1652660 | Electroporation |
| High-Capacity cDNA Reverse Transcription Kit | Applied Biosystems (Waltham, MA, USA) | 4368814 | cDNA reverse transcription |
| ITR_fw | IDT (San Joce, CA, USA) | GGAACCCCTAGTGATGGAGTT (https://signagen.com/blog/2019/10/25/qpcr-primer-and-probe-sequences-for-raav-titration/) | dd-PCR primer |
| ITR_rv | IDT (San Joce, CA, USA) | CGGCCTCAGTGAGCGA (https://signagen.com/blog/2019/10/25/qpcr-primer-and-probe-sequences-for-raav-titration/) | dd-PCR primer |
| ITR_probe | IDT (San Joce, CA, USA) | HEX-CACTCCCTCTCTGCGCGCTCG-BHQ1 (https://signagen.com/blog/2019/10/25/qpcr-primer-and-probe-sequences-for-raav-titration/) | dd-PCR probe |
| Illumina NextSeq 500 system | Illumina Inc (San Diego, CA, USA) | SY-415-1001 | NGS Library sequencing |
| KAPA HiFi HotStart ReadyMix (2X)* | Roche AG (Basel, Switzerland) | KK2600 07958919001 | NGS sample prepration |
| MagnaBot 96 Magnetic Separation Device | Promega GmbH (Madison, WI, USA) | V8151 | Sample prepration for NGS library |
| NanoDrop 2000 spectrophotometer | Thermo Fischer Scientific (Waltham, MA, USA) | ND-2000 | Digestion of double-stranded insert |
| NGS_frw | Sigma-Aldrich (Burlinght, MA, USA) | GTT CTG TAT CTA CCA ACC TC | NGS primer |
| NGS_rev | Sigma-Aldrich (Burlinght, MA, USA) | CGC CTT GTG TGT TGA CAT C | NGS primer |
| NextSeq 500/550 High Output Kit (75 cycles) | Illumina Inc (San Diego, CA, USA) | FC-404-2005 | NGS Library sequencing |
| Ovation Library System for Low Complexity Samples Kit | NuGEN Technologies, Inc. (San Carlos, CA, USA) | 9092-256 | NGS Library preparation |
| PX1 Plate Sealer | Bio-Rad (Hercules, CA, USA) | 1814000 | dd-PCR plate sealer |
| Pierceable Foil Heat Seal | Bio-Rad (Hercules, CA, USA) | 1814040 | dd-PCR sealing foil |
| Phusion High-Fidelity DNA-Polymerase | Thermo Fischer Scientific (Waltham, MA, USA) | F530S | Second-strand synthesis of oligonucleotide insert |
| PEI MAX - Transfection Grade Linear Polyethylenimine Hydrochloride (MW 40,000) | Polysciences, Inc. (Warrington, PA, USA) | 24765-1G | AAV library preparation |
| ProNex Size-Selective Purification System | Promega GmbH (Madison, WI, USA) | NG2002 | Sample prepration for NGS library |
| Phusion Hot Start II Polymerase | Thermo Fischer Scientific (Waltham, MA, USA) | F549L | NGS Library preparation |
| Proteinase K | Roche AG (Basel, Switzerland) | 5963117103 | DNA/RNA extraction |
| pRep2Cap2_PIS | ITR-Rep2Cap2-ITR vector. Peptide insertion site within the Cap2 ORF, manufactured/prepared in the lab | ||
| QX200 Droplet Generator | Bio-Rad (Hercules, CA, USA) | 1864002 | dd-PCR droplet generator |
| QX200 Droplet Reader | Bio-Rad (Hercules, CA, USA) | 1864003 | dd-PCR droplet analysis |
| QIAquick Nucleotide Removal Kit | Qiagen (Venlo, Netherlands) | 28306 | Second-strand synthesis of oligonucleotide insert purification |
| QIAquick Gel Extraction Kit | Qiagen (Venlo, Netherlands) | 28704 | Plasmid vector purification |
| QIAGEN Plasmid Maxi Kit | Qiagen (Venlo, Netherlands) | 12162 | Plasmid library DNA preparation |
| Qiaquick PCR Purification kit | Qiagen (Venlo, Netherlands) | 28104 | Sample prepration for NGS library |
| Qubit fluorometer | Invitrogen (Waltham, MA, USA) | Q32857 | NGS Library preparation |
| Qubit dsDNA HS | Thermo Fischer Scientific (Waltham, MA, USA) | Q32851 | NGS Library preparation |
| QuantiFast PCR Master Mix | Qiagen (Venlo, Netherlands) | 1044234 | Taqman qPCR |
| rep_fw | IDT (San Joce, CA, USA) | AAGTCCTCGGCCCAGATAGAC | dd-PCR primer |
| rep_rv | IDT (San Joce, CA, USA) | CAATCACGGCGCACATGT | dd-PCR primer |
| rep_probe | IDT (San Joce, CA, USA) | FAM-TGATCGTCACCTCCAACA-BHQ1 | dd-PCR probe |
| RNase-free DNase | Qiagen (Venlo, Netherlands) | 79254 | DNA/RNA extraction |
| SfiI | New England Biolabs (Ipswich, MA, USA) | R0123 | Digestion of vector |
| 5 mm, steel Beads | Qiagen (Venlo, Netherlands) | 69989 | DNA/RNA extraction |
| TRIMER-oligonucleotides | ELLA Biotech (Munich, Germany) | - | Degenerate oligonucleotide |
| T4 Ligase | New England Biolabs (Ipswich, MA, USA) | M0202L | Plasmid library ligation |
| TissueLyserLT | Qiagen (Venlo, Netherlands) | 85600 | DNA/RNA extraction |
| YFP_fw | IDT (San Joce, CA, USA) | GAGCGCACCATCTTCTTCAAG | dd-PCR primer |
| YFP_rv | IDT (San Joce, CA, USA) | TGTCGCCCTCGAACTTCAC | dd-PCR primer |
| YFP_probe | IDT (San Joce, CA, USA) | FAM-ACGACGGCAACTACA-BHQ1 | dd-PCR probe |
| Zymo DNA Clean & Concentrator-5 (Capped) | Zymo research (Irvine, CA, USA) | D4013 | Vector and Ligation purification |
References
- Wang, D., Tai, P. W. L., Gao, G. Adeno-associated virus vector as a platform for gene therapy delivery. Nature Reviews Drug Discovery. 18 (5), 358-378 (2019).
- Muhuri, M., Levy, D. I., Schulz, M., McCarty, D., Gao, G. Durability of transgene expression after rAAV gene ....
Access restricted. Please log in or start a trial to view this content.
Reprints and Permissions
