Isolation of Next-Generation Gene Therapy Vectors through Engineering, Barcoding, and Screening of Adeno-Associated Virus (AAV) Capsid Variants

Summary

AAV peptide display library generation and subsequent validation through the barcoding of candidates with novel properties for the creation of next-generation AAVs.

Abstract

Gene delivery vectors derived from Adeno-associated virus (AAV) are one of the most promising tools for the treatment of genetic diseases, evidenced by encouraging clinical data and the approval of several AAV gene therapies. Two major reasons for the success of AAV vectors are (i) the prior isolation of various naturally occurring viral serotypes with distinct properties, and (ii) the subsequent establishment of powerful technologies for their molecular engineering and repurposing in high throughput. Further boosting the potential of these techniques are recently implemented strategies for barcoding selected AAV capsids on the DNA and RNA level, permitting their comprehensive and parallel in vivo stratification in all major organs and cell types in a single animal. Here, we present a basic pipeline encompassing this set of complementary avenues, using AAV peptide display to represent the diverse arsenal of available capsid engineering technologies. Accordingly, we first describe the pivotal steps for the generation of an AAV peptide display library for the in vivo selection of candidates with desired properties, followed by a demonstration of how to barcode the most interesting capsid variants for secondary in vivo screening. Next, we exemplify the methodology for the creation of libraries for next-generation sequencing (NGS), including barcode amplification and adaptor ligation, before concluding with an overview of the most critical steps during NGS data analysis. As the protocols reported here are versatile and adaptable, researchers can easily harness them to enrich the optimal AAV capsid variants in their favorite disease model and for gene therapy applications.

Introduction

Gene transfer therapy is the introduction of genetic material in cells to repair, replace, or alter the cellular genetic material to prevent, treat, cure, or ameliorate disease. Gene transfer, both in vivo and ex vivo, relies on different delivery systems, non-viral and viral. Viruses have evolved naturally to efficiently transduce their target cells and can be used as delivery vectors. Amongst the different types of viral vectors employed in gene therapy, adeno-associated viruses have been increasingly used, owing to their lack of pathogenicity, safety, low immunogenicity, and most importantly their ability to sustain long-term, non-integrating expr....

Protocol

1. AAV2 random 7-mer peptide display library preparation

NOTE: For the preparation of an AAV2 random peptide display library, synthesize the degenerate oligonucleotides as single-stranded DNA, convert it to double-stranded DNA, digest, ligate to the acceptor plasmid, and electroporate.

1. Design of degenerate oligonucleotides
   1. Order the degenerate oligonucleotides and avoid codon bias. In the oligonucleotide 5' CAGTCGGCCAG AG W GGC (X01)⁷ GCCCAGGCGGCTGACGAG 3', X01 corresponds to 20 codons, each encoding one of the 20 amino acids. The W can be A or T, producing the codons AGA or AGT, which enc....

Results

Generation of an AAV2 peptide display library. As a first step toward the selection of engineered AAVs, the generation of a plasmid library is described. The peptide insert is produced by using degenerate primers. Reducing the combination of codons in those from 64 to 20 has the advantages of eliminating stop codons and facilitating NGS analysis, by reducing library diversity on the DNA but not the protein level. The oligonucleotide insert is purchased as single-stranded DNA (Figure .......

Discussion

In this protocol, the steps needed for peptide display AAV capsid engineering and for barcoded AAV library screening, as well as for bioinformatic analysis of library composition and capsid performance, are outlined. This protocol focuses on the steps that facilitate the bioinformatic analysis of these types of libraries, because most virology laboratories lag in programming skills to match their proficiency in molecular biology techniques. Both types of libraries have been extensively described in the literature, as out.......

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
Amplification primer	ELLA Biotech (Munich, Germany)	-	Second-strand synthesis of oligonucleotide insert
Agilent DNA 1000 Reagents	Agilent Technologies (Santa Clara, CA, USA)	5067-1504	DNA fragment validation
Agilent 2100 Bioanalyzer System	Agilent Technologies (Santa Clara, CA, USA)	G2938C	DNA fragment validation
AllPrep DNA/RNA Mini Kit	Qiagen (Venlo, Netherlands)	80204	DNA/RNA extraction
Agilent DNA 1000 Reagents	Agilent Technologies (Santa Clara, CA, USA)	5067-1504	NGS Library preparation
Agilent 2100 Bioanalyzer System	Agilent Technologies (Santa Clara, CA, USA)	G2938C	NGS Library preparation
BC-seq fw:	IDT (San Joce, CA, CA, USA)	ATCACTCTCGGCATGGACGAGC	NGS Library preparation
BC-seq rv:	IDT (San Joce, CA, CA, USA)	GGCTGGCAACTAGAAGGCACA	NGS Library preparation
β-Mercaptoethanol	Millipore Sigma (Burlington, MA, USA)	44-420-3250ML	DNA/RNA extraction
BglI	New England Biolabs (Ipswich, MA, USA)	R0143	Digestion of double-stranded insert
C1000 Touch Thermal Cycler	Bio-Rad (Hercules, CA, USA)	1851196	dd-PCR cycler
dNTPS	New England Biolabs (Ipswich, MA, USA)	N0447S	NGS Library preparation
ddPCR Supermix for probes (no dUTP)	Bio-Rad (Hercules, CA, USA)	1863024	dd-PCR supermix
Droplet Generation Oil for Probes	Bio-Rad (Hercules, CA, USA)	1863005	dd-PCR droplet generation oil
DG8 Cartridges for QX100 / QX200 Droplet Generator	Bio-Rad (Hercules, CA, USA)	1864008	dd-PCR droplet generation cartridge
DG8 Cartridge Holder	Bio-Rad (Hercules, CA, USA)	1863051	dd-PCR cartridge holder
Droplet Generator DG8 Gasket	Bio-Rad (Hercules, CA, USA)	1863009	dd-PCR cover for cartridge
ddPCR Plates 96-Well, Semi-Skirted	Bio-Rad (Hercules, CA, USA)	12001925	dd-PCR 96-well plate
E.cloni 10G SUPREME Electrocompetent Cells	Lucigen (Middleton, WI, USA)	60081-1	Electrocompetent cells
Electroporation cuvettes, 1mm	Biozym Scientific (Oldendorf, Germany)	748050	Electroporation
GAPDH primer/probe mix	Thermo Fischer Scientific (Waltham, MA, USA)	Mm00186825_cn	Taqman qPCR primer
Genepulser Xcell	Bio-Rad (Hercules, CA, USA)	1652660	Electroporation
High-Capacity cDNA Reverse Transcription Kit	Applied Biosystems (Waltham, MA, USA)	4368814	cDNA reverse transcription
ITR_fw	IDT (San Joce, CA, USA)	GGAACCCCTAGTGATGGAGTT (https://signagen.com/blog/2019/10/25/qpcr-primer-and-probe-sequences-for-raav-titration/)	dd-PCR primer
ITR_rv	IDT (San Joce, CA, USA)	CGGCCTCAGTGAGCGA (https://signagen.com/blog/2019/10/25/qpcr-primer-and-probe-sequences-for-raav-titration/)	dd-PCR primer
ITR_probe	IDT (San Joce, CA, USA)	HEX-CACTCCCTCTCTGCGCGCTCG-BHQ1 (https://signagen.com/blog/2019/10/25/qpcr-primer-and-probe-sequences-for-raav-titration/)	dd-PCR probe
Illumina NextSeq 500 system	Illumina Inc (San Diego, CA, USA)	SY-415-1001	NGS Library sequencing
KAPA HiFi HotStart ReadyMix (2X)*	Roche AG (Basel, Switzerland)	KK2600 07958919001	NGS sample prepration
MagnaBot 96 Magnetic Separation Device	Promega GmbH (Madison, WI, USA)	V8151	Sample prepration for NGS library
NanoDrop 2000 spectrophotometer	Thermo Fischer Scientific (Waltham, MA, USA)	ND-2000	Digestion of double-stranded insert
NGS_frw	Sigma-Aldrich (Burlinght, MA, USA)	GTT CTG TAT CTA CCA ACC TC	NGS primer
NGS_rev	Sigma-Aldrich (Burlinght, MA, USA)	CGC CTT GTG TGT TGA CAT C	NGS primer
NextSeq 500/550 High Output Kit (75 cycles)	Illumina Inc (San Diego, CA, USA)	FC-404-2005	NGS Library sequencing
Ovation Library System for Low Complexity Samples Kit	NuGEN Technologies, Inc. (San Carlos, CA, USA)	9092-256	NGS Library preparation
PX1 Plate Sealer	Bio-Rad (Hercules, CA, USA)	1814000	dd-PCR plate sealer
Pierceable Foil Heat Seal	Bio-Rad (Hercules, CA, USA)	1814040	dd-PCR sealing foil
Phusion High-Fidelity DNA-Polymerase	Thermo Fischer Scientific (Waltham, MA, USA)	F530S	Second-strand synthesis of oligonucleotide insert
PEI MAX - Transfection Grade Linear Polyethylenimine Hydrochloride (MW 40,000)	Polysciences, Inc. (Warrington, PA, USA)	24765-1G	AAV library preparation
ProNex Size-Selective Purification System	Promega GmbH (Madison, WI, USA)	NG2002	Sample prepration for NGS library
Phusion Hot Start II Polymerase	Thermo Fischer Scientific (Waltham, MA, USA)	F549L	NGS Library preparation
Proteinase K	Roche AG (Basel, Switzerland)	5963117103	DNA/RNA extraction
pRep2Cap2_PIS			ITR-Rep2Cap2-ITR vector. Peptide insertion site within the Cap2 ORF, manufactured/prepared in the lab
QX200 Droplet Generator	Bio-Rad (Hercules, CA, USA)	1864002	dd-PCR droplet generator
QX200 Droplet Reader	Bio-Rad (Hercules, CA, USA)	1864003	dd-PCR droplet analysis
QIAquick Nucleotide Removal Kit	Qiagen (Venlo, Netherlands)	28306	Second-strand synthesis of oligonucleotide insert purification
QIAquick Gel Extraction Kit	Qiagen (Venlo, Netherlands)	28704	Plasmid vector purification
QIAGEN Plasmid Maxi Kit	Qiagen (Venlo, Netherlands)	12162	Plasmid library DNA preparation
Qiaquick PCR Purification kit	Qiagen (Venlo, Netherlands)	28104	Sample prepration for NGS library
Qubit fluorometer	Invitrogen (Waltham, MA, USA)	Q32857	NGS Library preparation
Qubit dsDNA HS	Thermo Fischer Scientific (Waltham, MA, USA)	Q32851	NGS Library preparation
QuantiFast PCR Master Mix	Qiagen (Venlo, Netherlands)	1044234	Taqman qPCR
rep_fw	IDT (San Joce, CA, USA)	AAGTCCTCGGCCCAGATAGAC	dd-PCR primer
rep_rv	IDT (San Joce, CA, USA)	CAATCACGGCGCACATGT	dd-PCR primer
rep_probe	IDT (San Joce, CA, USA)	FAM-TGATCGTCACCTCCAACA-BHQ1	dd-PCR probe
RNase-free DNase	Qiagen (Venlo, Netherlands)	79254	DNA/RNA extraction
SfiI	New England Biolabs (Ipswich, MA, USA)	R0123	Digestion of vector
5 mm, steel Beads	Qiagen (Venlo, Netherlands)	69989	DNA/RNA extraction
TRIMER-oligonucleotides	ELLA Biotech (Munich, Germany)	-	Degenerate oligonucleotide
T4 Ligase	New England Biolabs (Ipswich, MA, USA)	M0202L	Plasmid library ligation
TissueLyserLT	Qiagen (Venlo, Netherlands)	85600	DNA/RNA extraction
YFP_fw	IDT (San Joce, CA, USA)	GAGCGCACCATCTTCTTCAAG	dd-PCR primer
YFP_rv	IDT (San Joce, CA, USA)	TGTCGCCCTCGAACTTCAC	dd-PCR primer
YFP_probe	IDT (San Joce, CA, USA)	FAM-ACGACGGCAACTACA-BHQ1	dd-PCR probe
Zymo DNA Clean & Concentrator-5 (Capped)	Zymo research (Irvine, CA, USA)	D4013	Vector and Ligation purification