Fluoriserende

Immunology and Infection
 

Summary

Blant de tre mygg slekter, nemlig

Cite this Article

Copy Citation | Download Citations

Timoshevskiy, V. A., Sharma, A., Sharakhov, I. V., Sharakhova, M. V. Fluorescent in situ Hybridization on Mitotic Chromosomes of Mosquitoes. J. Vis. Exp. (67), e4215, doi:10.3791/4215 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Fluorescerende in situ hybridisering (FISH) er en teknikk som rutinemessig brukes ved mange laboratorier for å bestemme den kromosomale posisjonen av DNA og RNA prober. En viktig anvendelse av denne metoden er utviklingen av høykvalitets fysiske kart som er nyttige for å forbedre Genomet samlinger for forskjellige organismer. Den naturlige banding mønster av polytene og mitotiske kromosomer gir veiledning for nøyaktig bestilling og orientering av de genomiske supercontigs. Blant de tre mygg slekter, nemlig Anopheles, Aedes, og Culex, en veletablert kromosom-baserte kartlegging teknikken har blitt utviklet bare for Anopheles, hvis medlemmer har lesbare polytene kromosomer en. Som et resultat av genomet kartlegging innsats, 88% av en. gambiae genom er plassert til presise kromosom stillinger 2,3. To andre mygg slekter, Aedes og Culex, har dårlig polytenized kromosomer because av betydelig overrepresentasjon av transposable elementer i sine genomer 4, 5, 6. Bare 31 og 9% av de genomiske supercontings er tilordnet uten ordre eller orientering til kromosomer av Ae. aegypti 7 og Cx. quinquefasciatus 8, henholdsvis. Mitotisk kromosom forberedelse for disse to artene hadde tidligere vært begrenset til hjernen ganglier og cellelinjer. Men kromosom lysbilder laget fra hjernen ganglia av mygg vanligvis inneholder lave mengder metafase plater 9. Også, selv om en FISH teknikk har blitt utviklet for mitotiske kromosomer fra en cellelinje av Ae. aegypti 10, gjør opphopning av flere kromosomale rearrangements i cellelinje kromosomer 11 dem ubrukelig for genom kartlegging. Her beskriver vi en enkel, robust teknikk for oppnåelse av høy kvalitet mitotiske kromosom preparater fra imaginal plater (IDS) av 4 th instar larver som cen brukes for alle tre slekter av mygg. En standard FISK protokoll 12 er optimalisert for bruk BAC kloner av genomisk DNA som en sonde på mitotiske kromosomer av Ae. aegypti og Cx. quinquefasciatus, og for å utnytte et intergeniske spacer (IGS) region av ribosomal DNA (rDNA) som probe på en. gambiae kromosomer. I tillegg til fysisk kartlegging, kan det utvikles teknikken kan brukes til befolkningen cytogenetikk og kromosom taksonomi / systematikk av mygg og andre insekter grupper.

Protocol

1. Kromosom Forberedelse

Mygglarver ble oppdratt med en standard protokoll beskrevet i Metoder i Anopheles Forskning tilgjengelig på nettstedet til Malaria Forskning og Reference Reagent Resource Center (MR4) 13. Temperaturer på mygg oppdrett ble endret for å gi den høyeste antall kromosomer i imaginal plater og lavest dødelighet av larvene. Stadier av mygglarver utvikling ble bestemt på grunnlag av størrelsen på deres hode kapsler 13.

  1. Hatch mygg egg på 28 ° C, og etter 2-3 dager, overføre 2. eller 3. instar larver til 16 ° C for Ae. aegypti og Cx. quinquefasciatus og til 22 ° C for en. gambiae.
  2. Sted 4. instar larver på is i flere minutter for immobilisering.
  3. Overfør larve til et lysbilde med en dråpe kaldt hypoton løsning (0,5% sådium citrate eller 0.075 M kaliumklorid), og legg den under stereo mikroskop.
  4. Velg larve med ovale IDer (figur 1B) for videre disseksjon.
  5. Halshogge larve, og kutte cuticle fra baksiden siden av larvenes thorax med dissecting saks (figur 2A). Gjøre ytterligere kutt i andre eller tredje abdominal segmentet å dissekere tarmen fra larve. Retningene kuttene vises med piler.
  6. Åpne cuticle, og fjern tarmen og fett kroppen fra larve. Fjern den hypoton løsning fra raset med filter papir, og legge til en fersk dråpe hypoton løsning direkte til IDer (figur 2B). Hold larve i hypoton løsning i 10 minutter ved RT.
  7. Fjern hypoton løsning med filter papir, og bruke Carnoy løsning (etanol / eddiksyre i 3:1). Etter å legge fiksativ løsning, IDS slå umiddelbart hvit og blir lett synlig under mikroskop (Figur 2C
  8. Ved hjelp av dissekere nåler, fjerne IDer fra larve (Figur 2D), og overføre dem til en nedgang på 50% propionsyre. Fjern eventuelle andre vev, slik som tarm og fett kroppen, fra lysbildet. Dekk IDer med en unsiliconized 22x22 dekkglass, og holde i 10 minutter ved romtemperatur.
  9. Dekk lysbildet med filter papir, og squash vevet ved å trykke på viskelæret på en blyant på omkretsen av dekkglass.
  10. Kort analyse av kvaliteten av lysbildet bruke fase-kontrast mikroskop ved 100x eller 200x forstørrelse (Figur 3). Preparater med> 50 kromosom sprer seg kan anses som egnet for fisk.
  11. Dypp og hold raset i flytende nitrogen til det stopper bobler. Fjern dekkglass fra lysbildet hjelp et barberblad, og overføre lysbildet umiddelbart til en beholder av 70% etanol kjølt ved -20 ° C. Oppbevar ved 4 ° C i minst 1 time for best dehydrering resultat (om nødvendig, kan lysbilder lagres ved thans skritt fra flere minutter til flere dager).
  12. Dehydrere lysbilder i en serie av etanol (70%, 80%, 100%) ved 4 ° C i 5 min hver, og lufttørke ved RT.
  13. Lagres tørt lysbilder ved -20 ° C før bruk dem for fisk.

2. Utvinning av repetitive DNA Brøker

Utføre FISH av BAC klone DNA probe på kromosomer fra Ae. aegypti og Cx. quinquefasciatus krever bruk umerkede repetitive DNA fraksjoner å blokkere uspesifikk hybridisering av DNA gjentar til kromosomene. Den assosiering av single-strand DNA fragmentert til stykker av flere hundre bp følger en C 0 t kurve der C 0 er den opprinnelige konsentrasjonen av enkelt-trådet DNA og t er reannealing tid. DNA fraksjoner med C0t verdier lik 10 -4 -10 -1 eller 10 ° -10 to regnes som høyt og moderat repeterende, henholdsvis.

  1. Pakk 400-500 ug av genomisk DNA fra hele voksen mygg med Qiagen Blood and Cell Culture Maxikit, og forberede 100-1,000 ng / ul DNA løsning i 1,2 x SSC.
  2. Denaturerer DNA ved å plassere en trygg-lock rør med genomisk DNA inn i en varmeblokk forvarmet til 120 ° C i 2 min. Høy temperatur bidrar til å variere DNA i 200-500 bp fragmenter.
  3. Avhengig DNA-konsentrasjon, reassociate DNA ved å plassere røret ved 60 ° C i 15-150 minutter for å oppnå C 0 t DNA fraksjoner opp til C 0 T3 (Tabell 1).
  4. Plasser røret med DNA på isen i 2 min.
  5. Overfør DNA til 42 ° C, tilsett forvarmet 10x S1-nuklease buffer og S1-nuklease til en endelig konsentrasjon på 100 enheter per 1 mg av DNA, og inkuber i 1 time.
  6. Bunnfall DNA ved å tilsette 0,1 volum av 3 M natriumacetat og 1 volum av isopropanol ved RT.
  7. Sentrifuger ved 14.000 rpm i 20 min ved 4 ° C.
  8. Vask DNA i 70% etanol, og sentrifuger på nytt på 14.000 opm i 10 minved 4 ° C.
  9. Air-tørke og oppløse DNA pellet i TE buffer.
  10. Måle DNA-konsentrasjon, og visualisere ved gelelektroforese. Sendes det endelige mengde repeterende DNA fraksjoner representerer 35-50% av den opprinnelige DNA-mengde.

3. DNA Probe Merking

To forskjellige protokoller ble benyttet for merkingen BAC klone DNA-probe og IGS rDNA sonde.

3,1 BAC klone merking med nick-oversettelse

  1. Pakk BAC klone DNA fra BAC biblioteket ved hjelp Qiagen Large Construct Kit.
  2. Forbered reaksjonsblandingen for nick-translasjon merking på isen med sluttvolum på 50 ul: 1 ug isolert BAC klone DNA, 0,05 mM hver av umerket dATP, dCTP, og dGTP og 0,015 mM dTTP; 1 ul Cy3-dUTP (eller en annen fluorokrom); 0,05 mg / ml av BSA, 5 pl 10x nick-translasjon buffer, 20 U av DNA-polymerase I, og 0,0012 U av DNase.
  3. Inkuber ved 15 ° C i 20.5 hr.
  4. Stopp reaksjonen ved å tilsette 1 pl 0,5 M EDTA.
  5. Butikk sonde ved -20 ° C i et mørkt sted.

3,2 IGS rDNA merking med PCR

  1. Forbered reaksjonsblandingen på is med sluttvolum på 50 ul: 200 ng genomisk DNA, 0,05 mM hver av umerket dATP, dCTP, og dGTP; 0,015 mM dTTP; 1 ul Cy3-dUTP (eller en annen fluorokrom), 5 pl av 10x PCR-buffer, 50 pmol av forover, FN (GTGTGCCCCTTCCTCGATGT) og omvendt; GA (CTGGTTTGGTCGGCACGTTT) primere for IGS forsterkning, og 10 U av Taq DNA polymerase 14.
  2. Utfør PCR reaksjon ved hjelp av standard PCR-parametere for IGS forsterkning: 95 ° C / 5 min x 1 syklus; (95 ° C / 30 sek, 50 ° C / 30 sek, 72 ° C / 30 sek) x 30 sykluser; 72 ° C / 5 min x 1 syklus, og 4 ° C hold 14.
  3. Butikk sonde ved -20 ° C i et mørkt sted.

4. Fluorescerende in situ hybridisering

og Cx. quinquefasciatus og den andre for å bruke IGS rDNA på mitotiske kromosomer An. gambiae. Hvis du bruker BAC klone DNA-prober, trinn hopp RNase behandling 4.3, 4.4, og samtidig lysbilde / probe denaturering trinn 4.19. Hvis du bruker IGS rDNA probe, forberede hybridiseringsblanding uten C 0 t DNA fraksjoner, og hoppe separat lysbilde / probe denaturering trinn 4.10, 4.11, 4.16, og 4.17.

  1. Inkuber lysbilder i 2x SSC i 30 minutter ved 37 ° C.
  2. Dehydrere lysbilder i serie av 70%, 80%, og 100% etanol i 5 min hver ved RT, og lufttørk. Ved utføre Fisk med BAC klone DNA, gå direkte til trinn 4,5.
  3. Inkuber kromosom forberedelse i 0,1 mg / ml RNase-løsning under Parafilm i 30 minutter ved 37 ° C.
  4. Vask to ganger i 2x SSC i 5 min hver ved 37 ° C.
  5. Sett lysbilder ina krukke med 0,01% pepsin og 0,037% HCl-løsning, og inkuber i 5 minutter ved 37 ° C.
  6. Vask lysbilder i 1x PBS i 5 min ved RT.
  7. Fix kromosom preparat i en krukke med 1% formalin i 1x PBS fremstilt fra 10% nøytral-bufret formalin i 10 min ved RT.
  8. Vask lysbilder i 1x PBS i 5 min ved RT.
  9. Dehydrere lysbilder i serie av 70%, 80%, og 100% etanol i 5 min hver ved RT, og lufttørk preparater ved 37 ° C. Hvis performing fisk med IGS, gå direkte til trinn 4,12
  10. Denature lysbilder i en krukke med forvarmet 70% formamid i 2 min ved 72 ° C.
  11. Dehydrere lysbilder i serie av kalde (-20 ° C) 70%, 80%, og 100% etanol i 5 min hver, og lufttørke ved 37 ° C.
  12. Forbered hybridiseringsblanding:. 5 pl merket probe-DNA fra trinn 3, 10 pl av C 0 t DNA fra trinn 2 med endelig konsentrasjon på 0,5 ng / ul, og 5 ul av 1 ug / ul sonikert laksesperm DNA for fisk med IGS rDNA, forberedehybridiseringsblanding uten C 0 t DNA fraksjoner.
  13. Bunnfall DNA ved å tilsette 0,1 volum av 3 M natriumacetat og 2 volumer etanol. Hold ved -20 ° C i 1-3 timer.
  14. Sentrifuger ved 14.000 rpm ved 4 ° C i 20 min, fjerne etanol, og lufttørker pellet ved RT.
  15. Grundig oppløse pelleten i 10 pl hybridiseringsbuffer:. 50% formamid, 20% dekstransulfat, 2x SSC Hvis performing fisk med IGS, gå direkte til trinn 4,18
  16. Denaturerer hybridiseringsblanding i 7 minutter ved 97 ° C, og umiddelbart satt på is i 1 minutt.
  17. Prehybridize blanding ved 37 ° C i 30 min for å unngå uspesifikk hybridisering av repeterende DNA til kromosomene.
  18. Plasser 10 pl hybridiseringsblandingen på lysbildet, og dekk med et 22x22 dekkglass. Forhindre bobledannelse - luftbobler bør fjernes med lett trykk til dekkglasset Hvis du utfører FISH med BAC klone DNA, fortsett direkte til steg 4,20 <./ Em>
  19. Denature sonden og kromosom DNA samtidig ved hjelp av en varmeblokk ved 75 ° C i 5 min.
  20. Lim dekkglass rundt omkretsen bruke gummi sement.
  21. Utfør overnatter hybridisering i et fuktig kammer ved 37 ° C.
  22. Fjern gummi sement og dekkglass fra lysbildet.
  23. Vask lysbilde 2 min i forvarmet Løsning 1 (0,4 x SSC, 0,3% Nonidet-P40) ved 73 ° C.
  24. Vask lysbilder i Løsning 2 (2x SSC, 0,1% Nonidet-P40) i 5 min ved RT.
  25. Counterstain lysbilde med 0,001 mm YOYO-1 i 1x PBS i 10 minutter i fuktig kammer ved RT.
  26. Montere i en liten mengde Forleng Gold antifade reagens med lokk.
  27. Analyser forberedelser under et fluorescerende mikroskop ved hjelp av egnede filtersett på 1000 x forstørrelse (figur 4).

5. Representant Resultater

Insekt IDer er lokalisert i hvert segment av larve. Avhengig av stillingen, they forvandle seg til forskjellige vev på det voksne stadiet av insekt. IDene, som brukes for kromosom forberedelse i denne protokollen, utvikle seg til bena på det voksne stadiet av mygg. Disse IDer er plassert på den ventrale side av toraks larve og er klart synlig gjennom hårstråene under mikroskopet (Figur 1). På tidlig 4 th instar larvestadiet, IDer har en rund form (Figur 1A). De største antall mitose, er ~ 175 i én ID 9, samlet på et senere "oval" scenen (figur 1B), som må anses optimal scenen for lysbilde forberedelse. På denne tiden, deler den mellomliggende ID i to: en forvandles til et bein og en annen forvandles til en vinge. Vi foretrekker å bruke de store beinet IDer på "oval-formet" scenen for kromosom lysbilde forberedelse. Figur 1C representerer IDer senest stadiet av 4. instar larve utvikling. På dette stadiet,IDer er allerede utviklet seg til bein og vinger, og inneholder en betydelig mengde differensierte vev og et lavt antall mitose. Denne fasen av ID utviklingen bør unngås for kromosom lysbilde forberedelse. Vi anbefaler også oppdrett mygglarver ved lave temperaturer:. 16 ° C for Aedes og Culex og 22 ° C for Anopheles Dette bidrar til å øke mengden av mitose i IDer 9.

Figur 2 illustrerer ID disseksjon fra thorax av 4 th instar larve. Fordi cuticle av en live insekt er vanskelig å dissekere, anbefaler vi at du bruker dissecting saks i stedet for nåler brukte for larve forberedelse. Det mest avgjørende prosedyre for oppnåelse av høy kvalitet kromosom forberedelse er hypoton oppløsningsbehandling. For best resultat, fjerner vi tarmen og fett kroppen fra larve thorax før denne behandlingen. Hevelse av ID-celler under denne prosedyren bidrar til å spre kromosoms på et lysbilde (Figur 3A). Den riktige kvalitet av hypoton løsning behandling kan lett gjenkjennes av den runde formen av celler i preparater (figur 3A, B). Celler med en oval form indikerer utilstrekkelig hypoton løsning behandling (Figur 3C). Å bli valgt for fisk, bør kromosom forberedelse inneholde minst 50 av høy kvalitet kromosom oppslag. Normalt ~ 90% av lysbildene utarbeidet ved hjelp av denne protokollen har tilstrekkelig kvalitet for FISH 9.

Vi presenterer to litt forskjellige fisk protokoller: en avansert protokoll for fisk ved hjelp genom BAC klone DNA probe på mitotiske kromosomer Aedes og Culex og en enkel FISH protokoll for IGS rDNA probe på mitotiske kromosomer Anopheles. Genomene til Aedes og Culex er svært repeterende grunn av overvekt av transposable elementer 7,8. Dermed utfører fisk, som utilizes genomisk BAC klone DNA som en probe, trenger å legge umerkede repetitive DNA fraksjoner til sonden for å blokkere uspesifikk hybridisering av DNA repeteres til kromosomer. For utvinning av de repetitive DNA fraksjoner, er genomisk DNA denaturert ved 120 ° C i 2 min. Kokende DNA ved en høy temperatur bidrar også til å skaffe DNA i bruddstykker av 200-500 bp. DNA er lov vil knytte etter denne behandlingen. De gjentatte DNA-fragmenter tendens til å finne sin make for assosiering raskere enn DNA med unike sekvenser gjør. Som et resultat, følger assosiering av DNA en C 0 x t kurve der C 0 er den opprinnelige konsentrasjonen av enkelt-trådet DNA, og t er reannealing tid. DNA fraksjoner med C 0 t-verdier lik til 10-4 - 10-1 eller 100-102 anses høyt og moderat repeterende, henholdsvis. Tidspunktet for assosiering for ulike C 0 t DNA fraksjoner kan beregnes ved hjelp the formel t = C 0 t X × 4,98 / C 0, hvor t - tid av inkubasjon, C 0 t X - C 0 t fraksjon (C0t 1 = 1, C 0 t 2 = 2, osv.) og C 0 - innledende DNA konsentrasjon i ug / ul 15 (Tabell 1). Etter assosiering, blir enkelt-trådet DNA fordøyd hjelp S1-nuklease. Vi foretrekker å bruke alle C 0 t DNA fraksjoner opp til C 0 t 3 sammen i stedet for den vanlige C 0 t 1 DNA fraksjon. Disse C 0 t fraksjoner inkluderer noen av de moderat repetitive DNA-sekvenser og sammen representerer vanligvis 35-50% av den opprinnelige mengden av genomisk DNA i Ae. aegypti. Riktig andel mellom merket DNA-probe og umerket C 0 t DNA fraksjon avhenger repetitive DNA komponent i hver bestemt BAC klone. I gjennomsnitt bruker vi 1:20 sonde til C 0 tDNA brøkdel andel for å oppnå en akseptabel signaler / bakgrunn forholdet mellom FISH resultat. Prehybridization av DNA probe med C 0 t DNA fraksjoner i et rør i 30 min før den faktiske hybridisering på lysbildet bidrar også til å redusere bakgrunnen. Merking, hybridisering selv, og vask i denne protokollen er utført ved hjelp standardvilkår 12.

Fisken resultatene fra to forskjellig merket BAC klone DNA-prober på mitotiske kromosomer Ae. aegypti og Cx. quinquefasciatus er vist i figurene 4A og B, henholdsvis. Bac klone DNA prober produsere sterke signaler i en enkelt stilling på kromosomene. Kromosomer vist på figur 1 er med kontrafarget YOYO-1 jodid. Dette fargestoffet gir de beste båndmønstre på Ae. aegypti kromosomene 9. Alternativt, kan andre fluorescerende fargestoffer, for eksempel DAPI eller propidium jodid, utnyttes for the kromosom kontrafarging. For å undertrykke fotobleking av lysbildene, bruker vi forlenge Gold antifade montering medium. Denne reagensen har gode signal bevaring evner og kan også lett fjernes fra raset ved å skylle i 1x PBS om det er nødvendig å bruke samme lysbilde for flere hybridizations.

En enkel versjon av FISH protokollen er utformet for hybridisering av IGS rDNA probe på mitotiske kromosomer Anopheles. Ribosomale gener i Anopheles er representert som en polymorf klynge av gener som ligger på kjønnskromosomene 16. En DNA probe i denne protokollen er merket med standard PCR reaksjonen ved å tilsette fluorescensmerkede Cy3 eller Cy5 dNTPs. Fordi blokkere uspesifikk hybridisering av repeterende DNA i eukromatin ikke er nødvendig, er alle trinnene knyttet til bruk av C 0 t DNA fraksjoner utelatt. I stedet er kromosom preparater forbehandles med RNase for å hindre hybridisering av IGS rDNA proben tilde kjerne. Kromosomer og DNA-sonden blir denaturert samtidig ved oppvarming av lysbildet sammen med en sonde i et hybridiserings-system ved 75 ° C i 5 min. Hybridisering og vasking i denne protokollen er også utført ved hjelp av standard vilkår for FISH 12. Resultatet av fisk er vist i figur 4C: den polymorfisme av IGS rDNA hybridisering mellom to X-kromosomer er godt synlig.

0 t 3
DNA-konsentrasjon ug / ul Reannealing tid, min
C 0 t 2 0.1 100
0.3 33
0.5 20
0.7 14
0.9 11
1 10
0.1 150
0.3 50
0.5 30
0.7 21
0.9 17
1 15

Tabell 1. DNA konsentrasjon og reannealing ganger for utarbeidelse av C 0 T2 og C 0 t3 fraksjoner.

Figur 1
Figur 1 stadier av ID utviklingen i 4. instar larve: A) en tidlig "rund form" scene, B) en mellomliggende "oval form" scenen - optimal for kromosomet forberedelse, C) et sent stadium - upassende for kromosom forberedelser. . Posisjonene til IDer er angitt ved piler på den ventrale side av larvenes thorax.

Figur 2
Figur 2 trinn av ID disseksjon: A) halshugget larve (retning av kutt er angitt ved piler), B) larver med dissekert gut henhold hypoton oppløsningsbehandling (IDS hovne opp og bli nesten usynlig), C) larve etter Carnoy løsning applikasjonen (. IDer blir hvite og godt synlig), D) dissekert IDer i Carnoy løsning. Posisjoner IDer i larve er merket med en stjerne.

Figur 3
Figur 3 Forskjellige kvaliteter av kromosom sprer: A) en perfekt kromosom spredning - rund form av cellene demonstrerer tilstrekkelig behandling av IDS i hypoton løsning, b) en perfekt hypoton behandling - kromosomene litt undersquashed, c) en dårlig kromosom spredning. - resultatet avutilstrekkelig hypoton behandling er angitt med oval form av cellene.

Figur 4
Figur 4. Eksempler på fisk med BAC kloner (A, B) og IGS rDNA (C) i kromosomene i Ae. aegypti (A), Cx. quinquefasciatus (B), og An. gambiae (C). 1, 2 og 3 - er antall kromosomer, X - kvinnelige sex kromosom i An. gambiae.

Discussion

Nonfluorescent in situ hybridisering på mitotiske kromosomer av mygg ble fremført for første gang i 1990 av A. Kumar og K. Rai 17. I den studien, 18S og 28S ribosomale DNA gener, klonet sammen i en plasmid, ble plassert på kromosomene av 20 arter av mygg. DNA-proben ble radioaktivt merket og hybridisert til de kromosomer fra hjernen ganglier. Mellom tre mygg slekter, har en FISH teknikk blitt utviklet kun for mitotiske kromosomer fra cellelinje av Ae. aegypti 10,18,19 og har aldri blitt utført på mitotiske kromosomer fra levende mygg. Nylig har vi utviklet en enkel, robust teknikk for å oppnå høy kvalitet kromosom preparater fra IDene 4. instar larver 9. Denne metoden tillater et høyt antall kromosomer å oppnås i en slide og kan være universelt brukes for alle arter av mygg. Nødvendigheten av å bruke bare larvenes, ikke pupal eller voksen STAger av mygg, for slide forberedelse er trolig den eneste begrensningen av metoden. Standarden FISH metoden 12 er optimalisert for bruk genomisk BAC klone og IGS rDNA som prober for mitotiske kromosomer Aedes, Culex, og Anopheles.

I tillegg til disse spesielle anvendelser, kan fisken protokollen beskrevet her også brukes til andre formål. Den avanserte FISH-protokollen, som utnytter C 0 t DNA fraksjoner for å blokkere uspesifikk hybridisering, kan også brukes for hybridisering av BAC kloner eller andre store DNA-fragmenter i heterochromatic regioner Anopheles. Heterochromatic regionene er beriket med transposable elementer og andre gjentar, og sonder fra disse regionene normalt produserer sterk bakgrunn på kromosomene 3. Bruke umerket C 0 t DNA fraksjoner vil bidra til å redusere uspesifikk hybridisering av proben til kromosomene. Den enkle versjonen av FISH protocol kan brukes for enhver rDNA eller repeterende DNA-prober for mitotiske kromosomer mygg og andre insekter. I tillegg er det også kan anvendes for hybridisering av BAC klone DNA i arter med lav repetitive DNA-innhold i euchromatic regioner som Anopheles eller Drosophila. Protokollen foreslått her vil bidra til å oppnå høyt ferdige kromosom-baserte genomet samlinger for mygg og kan grovt brukes til ulike cytogenetiske applikasjoner i andre grupper av insekter.

Disclosures

Ingen interessekonflikter erklært.

Acknowledgments

Vi takker Sergei Demin og Tatyana Karamysheva for deres hjelp med kromosom forberedelse og fisk på Anopheles. Vi vil også takke David Severson for å gi oss Aedes og Culex genomisk DNA BAC kloner og Melissa Wade for å redigere teksten. Dette arbeidet ble støttet av to tilskudd fra National Institutes of Health: 1R21 AI88035-01 til Maria V. Sharakhova og 1R21 AI094289-01 til Igor V. Sharakhov.

Materials

Name Company Catalog Number Comments
MZ6 Leica stereomicroscope Leica VA-OM-E194-354 A different stereomicroscope can be used
Olympus CX41 phase microscope Olympus CX41 A different phase microscope can be used
Olympus BX61 fluorescent microscope Olympus BX61 A different fluorescent microscope can be used
ThermoBrite Slide Denaturation/Hybridization System Abbott Molecular 30-144110 Serves as a heating block and a humid chamber
Dissecting needles Fine ScienceTools 10130-10
Needle holders Fine Science Tools 26018-17
Dissecting scissors Fine Science Tools 15000-03
75x25 double frosted micro slides Corning 2949-75x25
22x22 mm microscope coverslips Fisher Scientific 12-544-10
Parafilm Fisher Scientific 13-374-10
Rubber Cement Fisher Scientific 50-949-105
Acetic acid Fisher Scientific A491-212
Alcohol 200 Proof Decon Laboratories 2701
Propionic acid Sigma-Aldrich 402907
Hydrochloric acid Fisher Scientific A144-500
Sodium citrate dihydrate Fisher Scientific S279-500
Sodium acetate trihydrate Fisher Scientific BP334-500
Potassium chloride Fisher Scientific BP366-500
EDTA Fisher Scientific S311-500
Tris base Fisher Scientific BP152-1
10x PBS Invitrogen P5493
10% NBF (neutral buffered formalin) Sigma-Aldrich HT501128
99% formamide Fisher Scientific BP227500
Dextran sulfate sodium salt Sigma-Aldrich D8906
20x SSC buffer Invitrogen AM9765
1 mM YOYO-1 iodide (491/509) solution Invitrogen Y3601
Antifade Prolong Gold reagent Invitrogen P36930
dATP, dCTP, dGTP, dTTP Fermentas R0141, R0151, R0161, R0171
Cy3-dUTP, Cy5-dUTP GE Healthcare PA53022, PA55022
BSA Sigma-Aldrich A3294
DNA Polymerase I Fermentas EP0041
DNase I Fermentas EN0521
S1 Nuclease Fermentas EN0321
Taq DNA Polymerase Invitrogen 18038-042
RNase Sigma-Aldrich 9001-99-4
Pepsin USB 9001-75-6
Salmon sperm DNA Sigma-Aldrich D7656
Nonidet-P40 (NP40) US Biological NC9375914
Qiagen Blood and Cell Culture Maxikit Qiagen 13362
Qiagen Large Construct Kit Qiagen 12462

DOWNLOAD MATERIALS LIST

References

  1. Sharakhov, I. V., Sharakhova, M. V. Chromosome Mapping Research Developments. Verrity, J. F., Abbington, L. E. Nova Science Publishers, Inc. (2008).
  2. Holt, R. A., et al. The genome sequence of the malaria mosquito Anopheles gambiae. Science. 298, 129-149 (2002).
  3. Sharakhova, M. V., et al. Update of the Anopheles gambiae PEST genome assembly. Genome biology. 8, R5 (2007).
  4. Campos, J., Andrade, C. F., Recco-Pimentel, S. M. A technique for preparing polytene chromosomes from Aedes aegypti (Diptera, Culicinae). Memorias do Instituto Oswaldo Cruz. 98, 387-390 (2003).
  5. Campos, J., Andrade, C. F., Recco-Pimentel, S. M. Malpighian tubule polytene chromosomes of Culex quinquefasciatus (Diptera, Culicinae). Memorias do Instituto Oswaldo Cruz. 98, 383-386 (2003).
  6. McAbee, R. D., Christiansen, J. A., Cornel, A. J. A detailed larval salivary gland polytene chromosome photomap for Culex quinquefasciatus (Diptera: Culicidae) from Johannesburg, South Africa. J. Med. Entomol. 44, 229-237 (2007).
  7. Nene, V., et al. Genome sequence of Aedes aegypti, a major arbovirus vector. Science. 316, 1718-1723 (2007).
  8. Arensburger, P., et al. Sequencing of Culex quinquefasciatus establishes a platform for mosquito comparative genomics. Science. 330, 86-88 (2010).
  9. Sharakhova, M. V., et al. Imaginal discs--a new source of chromosomes for genome mapping of the yellow fever mosquito Aedes aegypti. PLoS neglected tropical diseases. 5, e1335 (2011).
  10. Brown, S. E., et al. Toward a physical map of Aedes aegypti. Insect Mol. Biol. 4, 161-167 (1995).
  11. Steiniger, G. E., Mukherjee, A. B. Insect chromosome banding: technique for G- and Q-banding pattern in the mosquito Aedes albopictus. Can. J. Genet. Cytol. 17, 241-244 (1975).
  12. Garimberti, E., Tosi, S. Fluorescence in situ hybridization (FISH). Bridger, J. M., Volpi, E. V. Springer Science and Business Media. (2010).
  13. Methods in Anopheles Research [Internet]. The Malaria Research and Reference Reagent Resource Center. Atlanta, GA. Available from: http://www.mr4.org/Portals/3/Pdfs/ProtocolBook/MethodsAnophelesResearchV4c.pdf (2007).
  14. Scott, J. A., Brogdon, W. G., Collins, F. H. Identification of single specimens of the Anopheles gambiae complex by the polymerase chain reaction. The American journal of tropical medicine and hygiene. 49, 520-529 (1993).
  15. Trifonov, V. A., Vorobyeva, N. N., Rens, W. Fluorescence in situ hybridization (FISH). Leiehr, T. Spriger-Verlag. (2009).
  16. Collins, F. H., et al. A ribosomal RNA gene probe differentiates member species of the Anopheles gambiae complex. The American journal of tropical medicine and hygiene. 37, 37-41 (1987).
  17. Kumar, A., Rai, K. S. Chromosomal localization and copy number of 18S+28S ribosomal RNA genes in evolutionary diverse mosquitoes (Diptera, Culicidae). Hereditas. 113, 277-289 (1990).
  18. Brown, S. E., Knudson, D. L. FISH landmarks for Aedes aegypti chromosomes. Insect Mol. Biol. 6, 197-202 (1997).
  19. Brown, S. E., Severson, D. W., Smith, L. A., Knudson, D. L. Integration of the Aedes aegypti mosquito genetic linkage and physical maps. Genetics. 157, 1299-1305 (2001).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics