تحكم بوساطة رني من الأفلاتوكسين في الفول السوداني: طريقة لتحليل الإنتاج السموم الفطرية والتعبير التحوير في الفول السوداني /

Environment
 

Summary

ونحن لشرح طريقة لتحليل السموم الفطرية والتعبير التحوير في بذور الفول السوداني التي تحتوي على إشارات RNA للتدخل لإسكات الجينات الأفلاتوكسين التوليف في الفطر فلافس. لم يتم الإبلاغ عن السيطرة بوساطة رني من السموم الفطرية في النباتات سابقا.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Arias, R. S., Dang, P. M., Sobolev, V. S. RNAi-mediated Control of Aflatoxins in Peanut: Method to Analyze Mycotoxin Production and Transgene Expression in the Peanut/Aspergillus Pathosystem. J. Vis. Exp. (106), e53398, doi:10.3791/53398 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

وتشير تقديرات منظمة الأغذية والزراعة التابعة للأمم المتحدة أن 25٪ من المحاصيل الغذائية في العالم ملوثة الأفلاتوكسين. الذي يمثل 100 مليون طن من المواد الغذائية التي يجري تدميرها أو تحويلها إلى الاستهلاك غير البشرية كل عام. الأفلاتوكسين المسرطنة قوية المتراكمة عادة من قبل الفطريات فلافس وA. الطفيلي في الحبوب والمكسرات والمحاصيل الجذرية وغيرها من المنتجات الزراعية. تم استخدام إسكات خمس جينات الأفلاتوكسين التوليف التي تدخل الحمض النووي الريبي (رني) في النباتات الفول السوداني للسيطرة على تراكم الأفلاتوكسين بعد التلقيح مع A. فلافس. في السابق، لم يكن هناك أي طريقة لتحليل فعالية رني في الفول السوداني الفردي الأحداث المعدلة وراثيا، وهذه عادة ما تنتج البذور قليلة، والأساليب التقليدية للتجارب ميدانية كبيرة في ظل ظروف مواتية الأفلاتوكسين وليس خيارا. في هذا المجال، واحتمال العثور على بذور ملوثة بشكل طبيعي في كثير من الأحيان 1/100 إلى 1/1،000. وبالإضافة إلى ذلك، لا يتم توزيع تلوث الافلاتوكسين بشكل موحد. يستخدم أسلوب لدينا عدد قليل من البذور المعدلة وراثيا في الحدث، مع قطع صغيرة معالجتها في الوقت الحقيقي PCR (RT-PCR) أو تسلسل الحمض النووي الريبي الصغيرة، وتحليل تراكم الأفلاتوكسين بواسطة فائقة الأداء اللوني السائل (UPLC). خطوط الفول السوداني، معربا عن رني 288-72 و288-74، وأظهر ما يصل إلى الحد 100٪ (p≤0.01) في الأفلاتوكسين ب 1 و ب 2 مقارنة بالمجموعة الضابطة التي تراكمت حتى 14000 نانوغرام. ز -1 الأفلاتوكسين ب 1 عندما تلقيح مع aflatoxigenic A. فلافس. كمرجع، فإن مجموع الحد الأقصى المسموح به من السموم الفطرية للاستهلاك البشري في الولايات المتحدة هو 20 نانوغرام. ز -1. يصف هذا البروتوكول تطبيق مراقبة بوساطة رني من السموم الفطرية في بذور الفول السوداني المعدلة وراثيا وطرق تقييمها. ونحن نعتقد أن تطبيقه في تربية الفول السوداني وغيرها من المحاصيل سوف يجلب التقدم السريع في هذا المجال الهام من العلوموالطب والتغذية البشرية، وسوف تسهم إسهاما كبيرا في الجهود الدولية للسيطرة على السموم الفطرية، والسموم الفطرية المحتملة الأخرى في المحاصيل الغذائية الرئيسية.

Introduction

ويتعرض ما يقرب من 4.5 مليار شخص مزمن لالأفلاتوكسين 1، والمواد المسببة للسرطان أقوى المعروفة في الطبيعة 2. هذه السموم الفطرية تلوث 25٪ من المحاصيل الغذائية في العالم بما في ذلك الذرة والمنيهوت والأرز والمكسرات والحبوب والتوابل. 4. الأفلاتوكسين سبب التقزم لدى الأطفال يضعف الجهاز المناعي موجودة في 58٪ من الكبد، سرطان في الخزعات الإنسان 7،8، وقتل مئات الاشخاص خلال تفشي الدورية للتسمم أفلاتوكسيني 9،10. الأفلاتوكسين هي السموم الفطرية المستمدة متعدد الكيتيد تنتج عادة عن طريق فلافس وA. الطفيلي. ويتم إنتاج السموم الفطرية B 1 و B 2 بواسطة A. فلافس، في حين A. الطفيلي كما تنتج G 1 و 2 G. ويبين التركيب الكيميائي لهذه المركبات واللوني يظهر انفصالهما قبل UPLC في الشكل 1.

الشكل 1
الشكل 1. الأفلاتوكسين ورني إدراج الأعلى: التركيب الكيميائي (يسار) ومثال اللوني (يمين) من السموم الفطرية المستمدة متعدد الكيتيد الأكثر شيوعا أربعة: B B G 1 و 2 G، التي تنتجها الرشاشيات الطفيلي، A وينتج فلافس B 1 و B 2 القاع: رسم تخطيطي من شظايا الجينات في رني بناء p5XCAPD المستخدمة للتحول الفول السوداني، وأرقام تحت السهام أرقام الانضمام الجينات جزء في فلافس الجينوم الرشاشيات؛ PIV2: إنترون البطاطا. أزواج الأساس؛: BP RT_5X_1 وRT_5X_2: في الوقت الحقيقي مواقع PCR التمهيدي الرجاء النقر هنا لمشاهدة نسخة أكبر من هذا الرقم.

الخسائر الاقتصادية في الصادرات بسبب السموم الفطرية في الفول السوداني وحده تتجاوز 450 مليون $ دولار أمريكي اذا حسبت على أساس 4 نانوغرام. ز -1 الحد من الأفلاتوكسين يسمح للاستهلاك البشري في الاتحاد الأوروبي 11. من المعروف أن السموم الفطرية لمدة 60 عاما 12؛ ومع ذلك، على الرغم من وضعت العديد من الممارسات الزراعية للحد من تأثيرها، بما في ذلك تطبيق السلالات الفطرية الأخرى 13،14، لا توجد طريقة ثابت من السيطرة موجودا، والأصناف النباتية المقاومة غير متوفرة. اختبار الأصول الوراثية النباتية لمقاومة السموم الفطرية أمر صعب للغاية، لأنه حتى في ظل ظروف مواتية لغزو الممرض، وتراكم السموم الفطرية لا يمكن التنبؤ بها ولا تتبع التوزيع الطبيعي. وبالتالي، تتطلب عادة التجارب المساحات المنزرعة كبيرة، ومئات من البذور وعينات متعددة من 100-1،700 ز للحد من تقلب من 15،16 البيانات.

كان التدخل RNAاكتشف في عام 1998 17؛ وفوائد "إسكات" يجري حاليا بحث في عدد من التطبيقات الجديدة، على سبيل المثال، في العلاجات الإنسان ضد سرطان الثدي النقيلي 18، سرطان الكبد 19، سرطان الدم النخاعي 20، وحماية النباتات من الحشرات والديدان الخيطية 22 21. في النباتات، يمكن أن إشارات تدخل RNA السفر خلية إلى أخرى، مع RNA الصغيرة التدخل (سيرنا) وارتفاع الجزيئي RNA الوزن هي المسؤولة عن الجين posttranscriptional النظامية إسكات 23،24، حتى داخل مسببات الأمراض الفطرية التي هي على اتصال وثيق مع مضيفه مصنع 25. وقد وصفت فعالية رني على إسكات بوساطة مصنع للجينات للفطريات الممرض في عدد قليل من pathosystems النبات، لهذه، والفحص البصري للأعراض في الأجزاء الهوائية للنباتات (يترك) يسمح الكمي المرض، أي oomycete Bremia في الخس 26 ، بوسينيا في القمح والفيوزاريوم في الموز 28. أصعب بكثير هو تقييم فعالية رني للسيطرة على السموم الفطرية في النباتات، وعلى الأخص السموم الفطرية في الفول السوداني كما تظهر لا يترك أي أعراض للعدوى، وأجهزة غزت (بذور) تحت عدة بوصات من التربة، وحدوث عدوى لا يمكن التنبؤ بها، والكيميائي فقط تحليل يمكن تحديد وجود الأفلاتوكسين. بالإضافة إلى ذلك، كل حدث المعدلة وراثيا في الفول السوداني ينتج عادة عدد قليل من البذور (4-6 في النبات)؛ وبالتالي، الاختبار التقليدي لتراكم سمة عدم الأفلاتوكسين في مؤامرات ميدانية كبيرة ودائم المواسم الزراعية بأكملها، واستخدام المئات من البذور غير ممكن. ووصف طريقة هنا لتحليل في أقل من أسبوع واحد، وبذور الفول السوداني رني لحضور التحوير ولعدم تراكم الأفلاتوكسين سمة، وذلك باستخدام عدد قليل فقط البذور.

Protocol

1. تعبيد الجزيئية والفول السوداني التحول

  1. الجمع بين شظايا الحمض النووي لخمسة A. الجينات فلافس، AFL2G_07223 (aflS أو aflJ)، AFL2G_07224 (aflR)، AFL2G_07228 (aflC / pksA / pksL1)، AFL2G_07731 (pes1) وAFL2G_05027 (الأفلاتوكسين مضخة هروب رأس المال، aflep). لهذا، استخدم الاشعال وultramers التالية: DIR-1، القصير Dir1-R، DIR-2 مقلوب، القصير Dir2-R، DirAll-ضابط صف-RV، وDirAll-BamEco-مهاجم، الجدول 1.
    1. جعل DIR-1 حبلا مزدوجة بنسبة 5 دورات PCR (تفاعل 25 ميكرولتر، 95 ° C 2 دقيقة، تليها 5 دورات من 94 درجة مئوية و 45 ثانية و 55 درجة مئوية و 30 ثانية، 68 ° C 15 ثانية) باستخدام البلمرة DNA وفقا لالصانع تعليمات والتمهيدي القصير Dir1-R لترك CCCGT 3 "فيض. كرر هذه الخطوات لجعل DIR-2 مقلوب حبلا مزدوجة باستخدام التمهيدي القصير Dir2-R لترك ACGGG 3 "فيض مكملة لDIR-1.
    2. Ligate وfragme اثنين من 199 سنة مضتاليلة مع T4 DNA يغاز حسب تعليمات الشركة الصانعة. PCR تضخيم الناتج 393 سنة مضت جزء كما هو مبين في 1.1.1 باستخدام بادئات DirAll-cacc-مهاجم وDirAll-ضابط صف-رف (الجدول 1)، واستنساخ المنتج باستخدام التقنيات القياسية في pENTR1A لجعل البلازميد P2 + 4ENTR.
    3. تتحد P2 + 4ENTR إلى pCAPD 29 (NCBI الانضمام: KC176455.1) باستخدام LR clonase II انزيم مزيج فقا لتعليمات الشركة الصانعة لجعل البلازميد p5XCAPD، وتحويلها إلى كولاي DH5α باستخدام التقنيات القياسية تليها التسلسل الجزئي. ملاحظة: يظهر إدراج رني الكامل في الجدول 1.
  2. تحويل الأجرعية سلالة C58C1 30 مع البلازميد p5XCAPD كما ذكرت سابقا 30، واستخدام البكتيريا الناتجة لتحويل نباتات الفول السوداني على النحو التالي:
    1. ينمو بمعدل 30 درجة مئوية الأجرعية إيواء p5XCAPD، واستخدام لهذا، على أن تستكمل 50 مل LB-مرق مع 500ميكروغرام مل -1 الستربتوميسين، 25 ميكروغرام مل -1 جنتاميسين، 10 ميكروغرام مل -1 كانامايسين، وتهز الثقافة عند 250 دورة في الدقيقة حتى تصل إلى 1 OD 260.
    2. حصاد الخلايا الأجرعية بواسطة الطرد المركزي (6000 x ج) لمدة 10 دقيقة، resuspend في 50 مل AB الحد الأدنى من المتوسط ​​31 مع 100 ميكرومتر acetosyringone لمدة 1 ساعة، ومكان في تعليق البكتيرية لل explants من العمر الشتلات 10-14 يوم Exp27-1516، عداء من نوع الفول السوداني خط تربية. وصمة عار الجافة لل explants على 3MM الورق النشاف بعد 30 دقيقة، ووضعها على تبادل لاطلاق النار الحث المتوسطة (SIM) [MS الملح 32، 3٪ سكروز و 20 ميكرومتر benzylaminopurine (BAP)، كما تم استخدام 10 ميكرومتر (TDZ)، ودرجة الحموضة 5.8، 0.3 ٪ جيلان اللثة] بدون المضادات الحيوية في الظلام لمدة ثلاثة أيام.
    3. هل اختيار الأنسجة وتجديدها كما ذكرت من قبل 33. نقل الأنسجة إلى بطاقة SIM (السيفوتاكسيم 500 ميكرومتر و 100 ميكرومتر كانامايسين) لتكوين تبادل لاطلاق النار، مع نقل كل أسبوعين لمدة 2 أشهر. ثم مكانتوسيع يطلق النار على تبادل لاطلاق النار استطالة المتوسطة (SEM) [5 ميكرومتر BAP، 1 ميكرومتر حمض الجبريليك (GA 3)]، مرتين أسبوعيا لعدة أشهر.
    4. وضع براعم الفردية، 2 سم في الحجم، في الجذر الحث المتوسطة (RIM) [02/01 MS، 1،5٪ سكروز، 5 ميكرومتر α-النفثالين-حمض الخليك (NAA)، و 2.5 ميكرومتر، الإندول زبدي حامض (IBA)]، ثم تأقلم الشتلات ونقلها إلى المسببة للاحتباس الحراري.

2. تحديد النباتات الفول السوداني ايواء رني إلى الجينات الصمت الأفلاتوكسين التجميعي

  1. طقم استخدام محطة صغيرة في محطة عمل الروبوت مع 200 شطف ميكرولتر وفقا لتعليمات الشركة الصانعة لاستخراج الحمض النووي من يترك الشباب من النباتات الفول السوداني التي كانت تخضع لعملية التحول (كما هو موضح سابقا) مع رني بناء من p5XCAPD (الشكل 1) التي لديها كما العمود الفقري البلازميد pCAPD 29 لإسكات الجينات.
  2. فحص عينات الحمض النووي عن طريق أنبوب واحد متداخل PCR (STN-PCR) كما وصفها PREVIously 34 للكشف عن علامة NPTII اختيار ورني إدراج من p5XCAPD. نشر متطابق بسلالة من التخفيضات (04/03 العقد) PCR النباتات إيجابية لإنتاج البذور كافية للاختبار في هذا الجيل الأول.
    1. استخدام أربعة التخفيفات 2-أضعاف من الحمض النووي (50-100 نانوغرام ميكرولتر -1 قبل تمييع) في جميع التفاعلات STN-PCR. لNPTII، استخدم الاشعال الخارجية PCAPD 5714F: 5'-AGGCTATTCGGCTATGACTG-3 "وPCAPD 6446R: 5'-CGTCAAGAAGGCGATAGAAG-3"، والاشعال الداخلية PCAPD 5730F: 5'-ACTGGGCACAACAGACAATC-3 "وPCAPD 6249R: 5'-ATATTCGGCAAGCAGGCATC- 3.
    2. للكشف عن رني إدراج في ردود الفعل STN-PCR استخدام بادئات الخارجية 35S-PDSFw: 5'-CCTAACAGAACTCGCCGTAA-3 "وDirAll-ضابط صف-رف: 5'-ATGCCATGGGGTTATTGGGTGCAGAATGG-3 'الاشعال الداخلية، وProbe_5027_Fw: 5'-gtatttgtgaccatgtttctg-3 "وProbe_7228_Rv: 5'-GGACGGATAGTAAACTGCGG-3".
  3. حصاد القرون الفول السوداني من النباتات إيجابية STN-PCR ويخدع محطات المحول المتعدد العادي نمت في نفس الظروف. خطوة حاسمة: تأكد من أن السيطرة تزرع النباتات في نفس الظروف ونفس الموسم حيث النباتات رني. انفجار الماء القرون مع غسالة الضغط على كثافة منخفضة أو كشط باليد لإزالة exocarp، وتحديد لون ميزوكارب عن طريق وضع القرون على لوحة النضج والقرون منفصلة في مجموعات (الأصفر والبرتقالي والبني والأسود) 35 (الشكل 2).

الرقم 2
الشكل 2. إعداد القرون الفول السوداني لتحليلها. اليسار: أحجام مختلفة الفول السوداني وجدت في حصاد الفول السوداني كما هو نبات النمو غير محدد. مركز: وضع الفول السوداني في سلة والمعادن لإزالة ضغط المياه من exocarp؛ اليمين: مجموعة النضج حسب اللون ميزوكارب على لوحة البيانات الشخصية الفول السوداني (الأصفر والبرتقالي والبني والأسود).98fig2large.jpg "الهدف =" _ فارغة "> الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

3. إعداد التجريبي

  1. إزالة قشر، عملية الأصفر والبني البذور بشكل منفصل. حساب عدد البذور لاستخدامها في التجربة وفقا للجدول 2. لاحظ أن ما لا يقل عن ثلاث قطع البذور (قطعة 1 البذور = نصف فلقة) في كل سطر الفول السوداني وتاريخ أخذ العينات المطلوبة لإجراء التحليل الإحصائي وتقليل الخطأ المعياري.
اسم تسلسل
DIR-1 5'-
GCCAGCTCAAAAGTGCGATGCACCAAGGAGAAACCGGCCTGTGCT
CGGTGTATCGAACGTGGTCTTGCCTGTCAATACATGGTCGTATTTG
TGACCATGTTTCTGGTGGCATTGGACCGTCTTGTCATCTCTACAGCC
ATTCCCCAGATCACGGACGAATCCCCTGCATCTACGCGCACGCATC
ACTTGGGGTACCCGT-3 "
القصير Dir1-R 5'-فوس-TACCCCAAGTGATGCGTGCGCG-3 "
DIR-2 مقلوب 5'- GGTTATTGGGTGCAGAATGGTAAACCACCCAACAGTACGCGAAATG
TCAATTCCAGAGTCCCAAACCTCCCTACCGTGGCCTGGACGGATAG
TAAACTGCGGAGCTTGGGAACAAAATCCGCTGTCTGATCGCCGAAG
AGAAAGAGTTGCCTTGATTGAGCCGCATCGAGGACAGGTTGTGTTG
CTGTTGATAGACGGG-3 "
القصير Dir2-R 5'-فوس-CTATCAACAGCAACACAACC-3 "
DirAll-cacc-مهاجم 5'-CACCGCCAGCTCAAAAGTGCGATGC-3 "
DirAll-ضابط صف، رف 5'-ATGCCATGGGGTTATTGGGTGCAGAATGG-3 "
DirAll-BamEco-مهاجم 5'-ATGGGATCCGAATTCGCCAGCTCAAAAGTGCGATGC-3 "
إدراج رني الكامل 5'- GCCAGCTCAAAAGTGCGATGCACCAAGGAGAAACCGGCCTGTGCT
CGGTGTATCGAACGTGGTCTTGCCTGTCAATACATGGTC / GTATTTG
TGACCATGTTTCTGGTGGCATTGGACCGTCTTGTCATCTCTACAGCC
ATTCCCCAGATCACGGACGAAT / CCCCTGCATCTACGCGCACGCAT
CACTTGGGGTACCCGTCTATCAACAGCAACACAACCTGTCCTCGAT
GCG / GCTCAATCAAGGCAACTCTTTCTCTTCGGCGATCAGACAGCG
GATTTTGTTCCCAAGCTCCGCAGTTTACTATCCGTCCA / GGCCACGG
TAGGGAGGTTTGGGACTCTGGAATTGACATTTCGCGTACTGTTGGG
TGGTTTACCATTCTGCACCCAATAACC-3 "

الجدول 1. [أليغنوكليوتيد] وultramers المستخدمة لبناء رني بناء p5XCAPD فوس: مفسفر "نهاية 5؛ "/" يفصل بين شظايا الجينات الخمسة المستخدمة؛ كامل رني إدراج: تسلسل تستخدم 2 يكرر مقلوب لتشكيل p5XCAPD.

  1. وضع بذور الفول السوداني بأكمله في طبقة واحدة بحيث تغطي الجزء السفلي من الكأس العقيمة. إضافة 75٪ من الإيثانول / الماء (V / V) حل لتغطية البذور ثم إضافة حجم مساو من نفس الحل. يحضن في درجة حرارة الغرفة لمدة 30 ثانية ثم يشطف بالماء منزوع الأيونات معقمة (SDW).
  2. إضافة 2٪ هيبوكلوريت إلى دورق يحتوي على الايثانول معاملة البذور على النحو التالي: إضافة ما يكفي من 2٪ محلول هيبوكلوريت لتغطية البذور، ثم إضافة حجم مساو من نفس الحل واحتضان لمدة 5 دقائق. خطوة حاسمة: يشطف جيدا ثلاث مرات مع حجم SDW أي ما يعادل 5 أضعاف حجم هيبوكلوريت المستخدمة (الشكل 3).

الشكل (3)
الشكل 3. التجريبية الإعداد. الأعلى: تعقيم سطح بذور الفول السوداني قبل وبعد هيبوكلوريت، وإزالة المعاطف البذور (تيستا)؛ الأوسط: إزالة الجنين وجهة نظر قريبة من الجنين، ثم قطع فلقة في نصف؛ القاع: النبتات النصف في الماء المقطر المعقم، النشاف على عقيمة ماصة ورقة، والخدوش على أجار المياه، ووضع من النبتات نصف (قطع الجانب صعودا) على سطح أجار. الرجاء النقر هنا لمشاهدة نسخة أكبر من هذا الرقم.

  1. السماح للبذور تعقيم السطح لتشرب غارقة في SDW لمدة 2 ساعة. وضع البذور على طبق بتري معقمة، وإزالة البذور المعاطف مع ملقط، فصل النبتات، ومع مشرط إزالة الأجنة. ملاحظة:الأجنة يمكن التخلص منها أو استخدامها لتجديد محطات جديدة.
  2. قطع كل فلقة في نصف باستخدام مشرط. لتجنب الجفاف، والحفاظ على القطع قطع البذور في الماء المعقم حتى تتم معالجة كافة البذور.
  3. وقد أعدت أطباق بتري تحتوي على أجار الماء المعقم (1.5٪ أجار / المياه؛ ث / ت)، واحد لكل قطعة البذور الثلاثة. جعل الخدوش الصغيرة في أجار باستخدام ملقط، وصمة عار لفترة وجيزة المياه الزائدة من القطع البذور على مناشف ورقية معقمة، ثم ضع قطعة البذور (قطع الوجه صعودا) في الماء / لوحات أجار.
  4. من ثقافة جديدة من aflatoxigenic فلافس NRRL 3357 في وسط أجار تشابك ونمت عند 25 درجة مئوية لمدة 10 أيام، وإعداد تعليق 50،000 الجراثيم في ميكرولتر SDW، تحسب مع haemocytometer.
  5. ضع 2 ميكرولتر من تعليق بوغ على خفض أسطح كل قطعة نصف فلقة-تجنب جولة الاعادة على الجانبين، للتأكد من الحصول على تتعرض الجراثيم إلى الأنسجة البذور التي تؤوي رني (الشكل 4).

    الرقم 4
    الرقم 4. التلقيح والحضانة لتحليل الأفلاتوكسين. الأعلى: نصف فلقة، التلقيح مع بوغ تعليق، وفلافس نمو فطر على نصف فلقة بعد 24 ساعة حضانة أسفل، يسار:. الحضانة من 48 ساعة على 1.5٪ أجار؛ مركز: الحضانة لمدة 72 ساعة على 1.5٪ أجار؛ الصحيح: مثال على الإعداد التجريبية غير صحيح، الحضانة لمدة 72 ساعة على 0.5٪ أجار الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

    1. احتضان أطباق بتري تحتوي على تلقيح وغير الملقحة النبتات نصف عند 30 درجة مئوية في الظلام حتى أخذ العينات.

    4. أخذ العينات للتحليل الافلاتوكسين والتعبير الجيني

    1. جمع العينات فيثلاث نسخ في 24 و 48 و 72 ساعة (اختياري 96 ساعة) من الحضانة، سواء بالنسبة للRT-PCR وتحليل الأفلاتوكسين، كل تكرار كونها قطعة واحدة (نصف فلقة). اختيار العينات عشوائيا من لوحات مختلفة في كل تاريخ أخذ العينة. باستخدام الأنسجة، وإزالة بهدوء الجراثيم الفطرية أجار والزائدة قبل وضع قطع البذور في قوارير أو أنابيب الاختبار.
    2. لتحليل الأفلاتوكسين، ضع كل تكرار (قطعة واحدة) في 4 مل الزجاج المسمار غطاء قارورة وتخزينها في -80 ° C. ملاحظة: نظرا للاستقرار الكيميائي للالأفلاتوكسين، والعينات ويمكن تخزينها في هذه الحالة لعدة أشهر (في التجارب الحالية عادة 1-2 أشهر).
    3. المركز RT-PCR كل تكرار (قطعة واحدة) في بالفعل إعداد 2 مل طحن أنابيب تحتوي على اثنين حبات الفولاذ المقاوم للصدأ (2.5 ملم بقطر) وثلاث حبات الزركونيوم (2 مم بقطر).
    4. تجمد على الفور (ويفضل في النيتروجين السائل) جميع العينات والاحتفاظ بها في -80 درجة مئوية حتى المعالجة.

    5. تحليل الافلاتوكسين من فرد نصف Cotyledon قطع

    1. استخدام A. فلافس تلقيح عينات لهذا التحليل. جلب عينات لدرجة حرارة الغرفة لمدة 30 دقيقة، إضافة أربعة مجلدات (عادة 2-3 مل؛ ث / ت) من الميثانول (الاحتفاظ بسجل لإجراء العمليات الحسابية في وقت لاحق)، أغلق القبعات، واحتضان O / N (~ 16 ساعة) في الظلام دون أن الانفعالات.
    2. وضع فريت إلى مطابقة 1.5 مل البروبيلين minicolumn، إضافة 200 ملغ الأساسي آل 2 O 3 والأنكى من ذلك هو مع فريت آخر كما هو موضح سابقا 36؛ ثم، وضع فائقة الأداء السائل Chomatographer (UPLC) قارورة الاوتوماتيكى تحت عمود قريبة بما فيه الكفاية لتجنب التبخر ممكن من شطافة.
    3. في أنبوب اختبار يمكن التخلص منها الزجاج (لا تستخدم البلاستيك)، ضع 0.5 مل من مستخلص الميثانول حصلت عليه في الخطوة 4.1، إضافة 0.5 مل الأسيتونتريل، مزيج من قبل ماصة وتطبيق 0.5 مل من الخليط في العمود أعدت في الخطوة 4.2. السماح شطف في قارورة الاوتوماتيكى عن طريق الجاذبية (لا تنطبق الضغط). شطف عادة ما يستغرق 2-4 دقائق، عشر قريبةالبريد القارورة فورا باستخدام غطاء متوافق مع UPLC الحاجز. حافظ على قارورة في درجة حرارة الغرفة وتحليلها في نفس اليوم على UPLC.
    4. لفصل الأفلاتوكسين، قارورة تحتوي على مكان الاوتوماتيكى eluates عينة وقوارير الاوتوماتيكى مع المعايير الأفلاتوكسين (B 1 و B 2 عند استخدام فطر A. flavus) في صك UPLC مجهزة مطابقة مدير UPLC الرباعي المذيبات، مدير عينة UPLC، UPLC نيون الكاشف، وC 18 2.1 مم × 50 مم، و 1.7 ميكرون العمود.
      1. استخدام الطور المتحرك isocratic تتألف من الثلج / MeOH / CH 3 CN (64:23:13، ت / ت / ت) خليط بمعدل تدفق 0،30 مل دقيقة -1. الحصول الاستشرابية ضمان فصل خط الأساس استقرت لحساب دقيق للتركيز الأفلاتوكسين، وفقا لتعليمات الشركة الصانعة 37.
      2. تأكد من هوية السموم الفطرية عن طريق الحصول على بيانات الكتلة الطيفي ومقارنتها مع البيانات المنشورة 38. استخدام طفي فخ مطياف الكتلة مجهزة واجهة ESI والبرامج المقابلة وفقا لتعليمات الشركة الصانعة.
    5. تحديد تركيزات الأفلاتوكسين بالرجوع إلى منحنيات المعايرة التي تم الحصول عليها عن طريق حقن كميات مختلفة من المعايير التجارية من الأفلاتوكسين ب 1، ب 2 المقابلة، G 1 و 2 G كما اقترح من قبل الشركة المصنعة UPLC والتي يحددها البرنامج 37.
    6. قطع مكان البذور استخراج بالفعل مع الميثانول، في قوارير زجاجية الفردية لO / N (~ 16 ساعة) تجفيد لتحديد وزنهم الجافة. ثم، وحساب تركيز الأفلاتوكسين في نانوغرام. ز -1 من الوزن الجاف للقطعة البذور.
    7. لتحليل البيانات، وتحويل النتائج الأفلاتوكسين إلى تسجيل (نانوغرام. ز -1 +1)، تليها اختبار توكي للمقارنات متوسط.

    6. التعبير الجيني، تجهيز RT-PCR العينات

    1. اتخاذ مل 2 طحن أنابيب تحتوي علىعينات جي من -80 ° C الثلاجة، وعلى الفور (دون الذوبان) تطحن لهم في الخالط طاحونة حبة في 3100 دورة في الدقيقة لمدة 40 ثانية، ثم الشروع في استخراج الحمض النووي الريبي باستخدام Trizol وفقا لتعليمات الشركة الصانعة.
    2. إعداد كدنا] من كل عينة باستخدام RNA 1 ميكروغرام وكميات متساوية من جزئية دينارا وhexamers عشوائي، وجعل 1: 8 التخفيف من كدنا] واستخدامها 2 ميكرولتر في رد الفعل في RT-PCR (كما هو موضح سابقا 39).
      1. للكشف عن التعبير عن رني الاشعال استخدام إدراج: RT_5X_1_105F: 5'GGTGGCATTGGACCGTCTTG-3 "، RT_5X_1_232R: 5'-CGCATCGAGGACAGGTTGTG-3؛ وRT_5X_2_95F: 5'-CCATGTTTCTGGTGGCATTG-3 "، RT_5X_2_229R: 5'-ATCGAGGACAGGTTGTGTTG-3".
      2. للكشف عن التعبير عن علامة NPTII اختيار واستخدام الاشعال: RT_NPTII_1_6871F: 5'-CTCGCTCGATGCGATGTTTC-3 "، RT_NPTII_1_7004R: 5'-GCAGGATCTCCTGTCATCTC-3". استخدام الجينات التدبير المنزلي أكتين للتوحيد، والاشعال: أكتين-FW: CACATGCCATCCTTCGATTG. الأكتين-رف: CCAAGGCAACATATGCAAGCT 40.
    3. تحليل النتائج وفقا لدلتا دلتا C T طريقة موحدة ل41 أكتين التعبير. تمثل النتائج على النحو أضعاف خلال السيطرة.

Representative Results

وقدم البلازميد p5XCAPD كما مشتق من pCAPD 29، واستخدامه لتحويل نباتات الفول السوداني. هذا ناقلات يحمل يكرر مقلوب من خمسة أجزاء صغيرة، 70-80 سنة مضت كل من الجينات الأفلاتوكسين-توليف A. فلافس مفصولة إنترون (الشكل 1). واستخدمت أجزاء من AFL2G_07224 (aflR)، AFL2G_07223 (aflS أو aflJ)، AFL2G_05027 (الأفلاتوكسين مضخة هروب رأس المال، aflep)، AFL2G_07228 (aflC / pksA / pksL1)، وAFL2G_07731 (pes1) للبناء، والأرقام على الشكل 1 تتوافق مع . فلافس الجينوم الشرح في معهد برود، كامبردج، MA، والأدب 42. تم توليده ما مجموعه 99 خطوط الفول السوداني بعد أن يمر في عملية التحول، 50 كانت PCR إيجابية لNPTII الكشف عنها بواسطة STN-PCR، وكانت 33 خطوط PCR بذور الإيجابية والمنتجة. سبعة خطوط إيجابية PCR فقط تم نشر متطابق بسلالة واختبارها من قبل حاضراطريقة ر لتراكم الأفلاتوكسين، وأظهر كل سبعة بين 60٪ و 100٪ تراكم الأفلاتوكسين أقل من السيطرة. نحن هنا تظهر نتائج اثنين من تلك الخطوط سبعة. كأحداث المعدلة وراثيا الفردية عادة ما تنتج البذور قليلة، تم تطوير طريقة لاستخدام الحد الأدنى لعدد البذور في حين لا تزال قادرة على القيام التحليل الإحصائي حدودي. ويرد مخطط لإعداد العينات والإعداد التجريبية في الشكل 5 والجدول 1. على الرغم من أن الجيل الأول من البذور المعدلة وراثيا هو عادة فرداني الزيجوت، فمن المتوقع أن الخلية الى خلية والحركة النظامية من الحمض النووي الريبي التدخل الصغيرة (سيرنا) التي تم إنشاؤها من خلال التدخل RNA يجب منح الأفلاتوكسين التوليف إسكات جميع أنحاء المصنع.

الرقم 5
الرقم 5. مخطط توضيحي لطريقة لتحليل فعالية رني في إسكات الرشاشيات الجينات الأفلاتوكسين التوليف في بذور الفول السوداني. التمثيل البياني للتدفق العمل عند معالجة عينات الفول السوداني للتعبير الجين أو تحليل الأفلاتوكسين. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

رني خطوط الفول السوداني 288-72 و288-74 أظهرت وجود صانع اختيار NPTII عند اختبارها من قبل STN-PCR، يتم عرض المقاطع جل في الشكل 6 (أعلى)، تتوفر من المؤلفين بناء على طلب الصور الأصلية. لم يستخدم البلازميد pCAPD كعنصر تحكم التحول لأنه يشفر يكرر مقلوب من اثنين من الجينات الكاميرون (مقاومة الكلورامفينيكول) وCcdB (توكسين) من تأثير غير معروف على النباتات. استخدمت PCR سلبي خط الفول السوداني 288-9 وغيرها التي مرت عملية تجديد وكانت تزرع في نفس الظروف كخطوط رني، كما يخدع سلبيالمحول المتعدد العادي.

الشكل (6)
. الشكل 6. الكشف عن الجينات والوقت الحقيقي التعبير عن رني إدراج الأعلى: أحادية الأنبوب، كشف متداخلة PCR خطوط الفول السوداني المعدلة وراثيا رني 288-72 و288-74 رني والنباتات إيجابية. الضوابط: W (الماء)، PP (مصنع إيجابي)، MM (مزيج الرئيسي)، ص (البلازميد p5XCAPD)؛ الكسور 02/01 04/01 08/01 16/01 تمثل التخفيفات 2-أضعاف من الحمض النووي القاع: في الوقت الحقيقي PCR الكشف عن التعبير عن رني إدراج (مجموعات التمهيدي: RT_5X_1، RT_5X_2، كما في الشكل على غير ناضجة ( الأصفر) وناضجة (البني) النبتات من خطوط المعدلة وراثيا في 24 و 48hr الحضانة؛ خط رمادي: تمثيل C T = 1. المدرج الإحصائي الوسائل وأشرطة الخطأ القياسية (T) من ثلاث عينات بيولوجيةمع ثلاثة مكررات التقنية. كان الكمي النسبي للرني إدراج تطبيع فيما يتعلق الجينات التدبير المنزلي أكتين بمثابة الرقابة الداخلية والمقارن التعبير حظيرة التحوير تحسب كما هو موضح في 5.2.2 و 5.3. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

لاختبار فعالية النبات المضيف رني بوساطة السيطرة المحتملة لتراكم الأفلاتوكسين، طبقت غبيرات المقطوع حديثا من فلافس NRRL 3357 على سطح قطع من النبتات نصف من الذي قد أزيلت الأجنة وتيستا (الأرقام 3، 4). ألف فلافس NRRL 3357، التي تم التسلسل الجينوم، وكان أساسا لتصميم p5XCAPD، يعود الفضل للدكتور القرن في USDA-ARS-NPRL. الغزو الفطرية الناتجة من نصف فلقة بعد 24 و 48 و 72 ساعة على 30 ° C هو المعرض ن في الشكل (4). وقد تم جمع عينات من النبتات نصف الملقحة في 24، 48، 72، 96 ساعة من الحضانة، وتحليلها لأربعة الأفلاتوكسين الرئيسي للB B G 1 و G 2 باستخدام UPLC وأكد LC-MS ؛ يتم عرض النتائج في الشكل (6). تم تحديد تركيزات الأفلاتوكسين باستخدام أسلوب نشرت مع بعض التعديلات 36. في 96 ساعة الحضانة، النبتات تبدأ في التفكك بسبب عدوى فطرية. خط رني 288-72 أظهرت مستويات أقل بكثير من الأفلاتوكسين من السيطرة على جميع مواعيد أخذ العينات في الفلقات غير الناضجة وعلى معظم مواعيد أخذ العينات في الاقتصادات الناضجة. أظهر خط رني 288-74 مستويات أقل بكثير من الأفلاتوكسين في معظم مواعيد أخذ العينات. يشار إلى مستويات من أهمية اختبار توكي مع العلامات النجمية في الرسم في الشكل 7.

g7.jpg "/>
. الرقم 7. الأفلاتوكسين ب 1 و ب 2 في النبتات الفول السوداني نصف بعد الحضانة (24، 48، 72 و 96 ساعة) مع فلافس التحكم: بذور 288-9 سطر غير المعدلة وراثيا. رني: البذور من رني 288-72 ورني 288-74، المعدلة وراثيا لرني p5XCAPD لإسكات خمس جينات الأفلاتوكسين التوليف. (A) الأفلاتوكسين ب 1 في البذور الناضجة (البني)؛ (B) الأفلاتوكسين ب 2 البذور الناضجة. (C) الأفلاتوكسين ب 1 في بذور غير ناضجة (الأصفر) و (D) الأفلاتوكسين ب 2 في البذور غير الناضجة. يتم تمثيل القيم المتوسطة مع ما يوازيها من أشرطة الخطأ القياسية (T) من العينات البيولوجية مكررة. فروق ذات دلالة إحصائية في اختبار توكي *: ص ≤ 0.05 **: P ≤ 0.01، ***: P ≤ 0.001.الصورة: //www.jove.com/files/ftp_upload/53398/53398fig7large.jpg "الهدف =" _ فارغة "> الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

أظهر رني 288-72 عموما في كافة مراحل التجربة (24-96 ساعة الحضانة)، و 94٪ انخفاضا -100٪ في الأفلاتوكسين ب و 90٪ انخفاضا -100٪ في الأفلاتوكسين ب 1 مقارنة بالمجموعة الضابطة. أظهر رني 288-74 63٪ تخفيض -100٪ في الأفلاتوكسين ب 2 و 60٪ -100٪ تخفيض في الأفلاتوكسين بالشكل 7.

وترد الاشعال تستخدم لفي الوقت الحقيقي الكشف PCR للتعبير عن إدراج رني في الشكل 1. وقد تم تحليل النبتات الفول السوداني البذور دون الأجنة، لإزالة دفاعاتهم الطبيعية، وتكون قادرة على الكشف عن التأثير المحتمل لرني على المنطقة الأكثر تعرضا لل غزو ​​الفطرية، النبتات. التعبير عن رني الكشف عن إدراج في الفلقات غير الناضجة (الأصفر) من خط 288-74 قبل التمهيدي تعيين RT_5X_1 كان أربعة أضعاف على مدى C T (الشكل 1، 6). لم يتم الكشف عن التعبير عن رني إدراج في النبتات ناضجة في 24 ساعة، أو على النبتات ناضجة أو غير ناضجة في 48 حضانة ساعة، الشكل 6 (القاع).

الفول السوداني الخط وقت أخذ العينات عينات لRT-PCR عينات للتحليل الأفلاتوكسين (تلقيح) Nبني مصفر من البذور
(غير الملقحة)
مندوب 1 مندوب 2 مندوب 3 مندوب 1 مندوب 2 مندوب 3
رني (أصفر) 24 ساعة 1 1 1 1 1 1 4.5
48 ساعة 1 1 1 1 1
72 ساعة 1 1 1 1 1 1
التحكم 24 ساعة 1 1 1 1 1 1 4.5
(أصفر) 48 ساعة 1 1 1 1 1 1
72 ساعة 1 1 1 1 1 1

الجدول 2. مثال على الإعداد عينة صغيرة لتحليل التعبير الجيني وتراكم الأفلاتوكسين في بذور الفول السوداني رني. تحليل كامل التعبير والسموم الفطرية لمجموعة النضج واحد (أي.، الأصفر)، مع ثلاثة أوقات لأخذ العينات (24 و 48 و 72 ساعة) ، في ثلاث نسخ، يتطلب 4،5 البذور، كل رقم واحد في الجدول يمثل نصف فلقة.

Discussion

وقد تجلى إسكات الجينات في مسببات الأمراض الفطرية 27،43، ولكن النبات المضيف رني بوساطة، لا توجد المنشورات التي تبين جدوى تحكم رني بوساطة من تراكم السموم الفطرية في النباتات. وكان أحد العوامل المحددة لهذه الدراسات في الفول السوداني لعدم وجود طريقة لتقييم تراكم النمط الظاهري عدم الأفلاتوكسين في النباتات الفردية، كما تظهر أوراق أي أعراض على العدوى الفطرية القرون تحت الأرض. وبالإضافة إلى ذلك، وتراكم توزيع يست عادة من السموم الفطرية، والحاجة للحصول على عينات كبيرة للتحليل الكيميائي 15،16 أعاقت القياس الكمي لتأثير رني المحتمل على محطة واحدة. الطريقة المعروضة هنا يتكون من 72 ساعة التجارب باستخدام خمسة بذور لأداء ثلاث عينات 24 ساعة بعد الفترة في ثلاث نسخ (الجدول الشكل 7). مقارنة لتحليل الأفلاتوكسين النموذجية التي تتطلب ما لا يقل عن 100 غرام من البذور، وأسلوبنا هو مناسبة خاصة لindividuaأحداث ل المعدلة وراثيا من النباتات الفول السوداني التي تنتج في البداية لا يزيد عن اثنين أو ثلاثة قرون.

وقد تجلى إسكات بوساطة الحمض النووي الريبي التوليف الأفلاتوكسين عن طريق تحويل وراثيا فلافس وA. الطفيلي. منذ aflR غير منظم الرئيسي لإنتاج الأفلاتوكسين في A. فلافس وA. الطفيلي 44،45، فإنه يصبح هدفا للاهتمام لإسكات بوساطة الحمض النووي الريبي في النباتات. ومع ذلك، فقد ثبت الاختلافات الجينية في aflR بين الرشاشيات الأنواع 46، وتلك المتغيرات الجينية يمكن الهروب إسكات إذا لم يكن هناك تسلسل الكمال مطابقة مع الإشارة رني المنتجة في البلد المضيف النبات. وهكذا، كان aflR واحدا من الأهداف لإسكات في ناقلات p5XCAPD، ولكنه لم يكن الوحيد. يكرر مقلوب من الجين aflR أدخلت A. فلافس وA. أدى الطفيلي عن طريق التحول في إسكات والحد الأدنى أو أي منتجأيون من الأفلاتوكسين 47 (ماكدونالد وآخرون، 2005b). أيضا، منع إسكات الجينات aflD إنتاج الأفلاتوكسين بنسبة تصل إلى 98٪ في A. فلافس وA. الطفيلي في التحول المباشر 48. لزيادة احتمال النجاح في نظامنا، تحولت الفول السوداني مع تكرار شظايا مقلوب خمس جينات لها دور في إنتاج الأفلاتوكسين في A. فلافس. هنا يتبين أن استخدام p5XCAPD الذي يستهدف لإسكات جينات عديدة في مسار تخليق الأفلاتوكسين، و 90٪ انخفاض مستويات -100٪ من الأفلاتوكسين ب 1 و ب 2 تحققت في خط 288-72، وانخفاض مستويات 60-100٪ تراكمت في خط 288-74 مقارنة بالمجموعة الضابطة، عندما تم تلقيح النبتات نصف مع A. فلافس، أرقام 4 و 7. والأهم من ذلك، الكشف عن هذه الطريقة فروق ذات دلالة إحصائية في تراكم الأفلاتوكسين من خطوط 288-72، 288-74 مقابل السيطرة في كافة مراحل التجربة من خلال تطبيق statis حدوديالتشنجات اللاإرادية، الشكل (7). ونظرا لصغر حجم العينة، من المهم تسليط الضوء على الحاجة إلى استخدام وسيلة قوية للكشف عن السموم الفطرية، وقد تم تحليل هذه التجارب من قبل UPLC التي لديها ارتفاع القرار، وخمسة أضعاف الأداء العالي وحساسية أعلى ثلاث مرات من HPLC 49.

التعبير عن رني إدراج في 288-74 تم الكشف فقط في الفلقات غير الناضجة (الأصفر) في 24 ساعة الحضانة. لم يتم الكشف عن إدراج رني بواسطة RT-PCR على النبتات ناضجة من 288-74 في 24 ساعة، أو على أي مجموعة النضج في 48 ساعة، الشكل (6). وقد لوحظ هذه الظاهرة نفسها في رني خطوط الفول السوداني المعدلة وراثيا أخرى (أرياس، RS، 2015 غير منشورة)، حيث تم الكشف عن عادة النصوص رني فقط على النبتات غير ناضجة في 24 ساعة. وعولج عينات الحمض النووي الريبي مع الدناز قبل التوليف [كدنا، كانت البيانات تطبيع إلى مستوى الأكتين التعبير وأي دليل على تلوث DNA لوحظ. كان ينبغي أن يكون DNA الموجودة في العينات، ينبغي عليهتم الكشف في العينات ساعة 48 أيضا، ولكن باستمرار أن الأمر لم يكن كذلك. التعبير تحت سيطرة 35S-المروج ليست دائما موحدة. يمكن أن تتأثر الظروف البيئية 50، ونوع الأنسجة والمرحلة التنموية 51،52. وفي الوقت نفسه، في مسار التدخل RNA، فإن معدل تسوس مرنا ومعدل تسوس سيرنا يمكن أن تختلف بشكل كبير 53. فمن الممكن أن التدهور السريع للمرنا من خلال آلية التدخل RNA يمكن أن يمنع الكشف عن مرنا في 48 ساعة الحضانة. إذا كان غياب التعبير في 48 ساعة نظرا لانخفاض 35S-المروج مدفوعة النسخ، أو إلى تدهور سريع من الرنا المزدوج الجديلة التي المقامر ينتظر الجواب. وبالتالي، فإن الكشف عن الرنا الصغيرة عالية الإنتاجية تسلسل تعطي فكرة أفضل عن العمليات التي تجري من خلال رني 54 في هذه التجارب. ومع ذلك، منذ RNA إسكات ينتشر بشكل منتظم، وذلك أساسا من خلال اللحاء من photosyntأكره المصادر إلى السكروز المصارف (في هذه الحالة بذور الفول السوداني) 55، يمكن أن يحدث إسكات الأفلاتوكسين التوليف في البذور دون التعبير المحلي للرني إدراج. لا يزال الكثير من الأبحاث إلى أن يتم تحديد مستوى الحد الأدنى من الرنا التدخل الصغيرة (الرناوات siRNAs) اللازمة لمنع تراكم الأفلاتوكسين في البذور. ومن المهم أن نؤكد على حقيقة أن كلا من والتعبير مرنا للرني بناء (الشكل 6)، وأظهر تراكم السموم الفطرية B 1 و B 2 (الشكل 7) نتائج مختلفة عن غير ناضجة (الصفراء) مقابل. ناضجة (البني) النبتات. نباتات الفول السوداني لها النمو غير محدد، أي أنها تقدم عند الحصاد مجموعة من القرون النضج، الشكل 2. وبالإضافة إلى ذلك، والبذور من جماعات النضج المختلفة تختلف في تركيبتها الكيميائية، على سبيل المثال، 2،4٪ سكروز في البذور غير الناضجة، و 1.9٪ في البذور الناضجة تحت نفس الظروف الميدانية 56،57. وهكذا، لفهم الكفاءه الفعليةذ السيطرة بوساطة RNA تراكم الأفلاتوكسين، فمن المهم تحليل مجموعة النضج بشكل منفصل.

A دفاع الطبيعي للبذور الفول السوداني هو إنتاج phytoalexins، والتي تختلف في تنوع المركبات المنتجة وكمياتها النسبية تبعا لنضج البذور والظروف البيئية 58-61، وكان أعلى بشكل خاص في الأجنة مقارنة النبتات 62. يكون الأجنة أيضا على تركيزات أعلى بكثير من الأحماض النووية، سواء DNA و RNA من النبتات (أرياس RS، غير منشورة). كما بذور الفول السوداني تنضج، والتغيرات في علم وظائف الأعضاء، والتركيب الكيميائي تحدث 63. مضادات الأكسدة الفينولية في شكل تيستا الفول السوداني العفص مكثف مع نشاط كابح الفطريات 64؛ وهذا هو أيضا واضح في لون ميزوكارب التي تعكس مراحل النضج والأصفر إلى الأسود 35، ومحتواه من العفص والمركبات الفينولية يزيد مع استحقاق 65. وبالتالي، وجود رتهت أو الأجنة في التجربة، نظرا خصائصها المضادة للميكروبات، يمكن أن يقتصر نمو الفطريات، وبالتالي المبالغة في تقدير تأثير رني إسكات، وبالتالي، تم إزالتها. أيضا، إزالة تيستا والأجنة تساعد لحد من مصادر التباين في التحليل، ونصف فلقة الذي يحمل فإن الجنين يكون أكثر phytoalexins والمزيد من المحتوى RNA.

بالإضافة إلى تحليل من قبل الجماعات النضج وإزالة تيستا والجنين في هذه التجارب، من المهم أن نشير إلى عدد قليل من أكثر الملاحظات: أ) على الرغم من ظهور نتائج لمدة تصل إلى 96 ساعة الحضانة، فمن المستحسن استخدام ما لا يزيد عن 72 ساعة للحصول على نتائج متسقة، والحصول على تدهور البذور بنسبة 96 ساعة. وب) في حين أن نصف النبتات من نفس البذور، وعلى الرغم من العينة عشوائيا، لا تشكل عينات مستقلة تماما، وأظهر RT-PCR وتراكم الأفلاتوكسين ضمن أحداث المعدلة وراثيا الحد الأدنى الاختلاف بين البذور. أيضا، الاعتماد على الجراثيم الفطرية دقيق، وحجم اللقاحالصورة من 2 ميكرولتر، وتطبيق جراثيم على السطح قطع من النبتات تجنب نازف على جانبي مهمة للتأكد من يتعرضون للجراثيم نبتت إلى الأنسجة النباتية. يجب أن يكون الماء / أجار على لوحات عند 1.5٪ (ث / ت)، ليونة أجار يسبب جريان المياه من الجراثيم كما هو مبين في الإطار الأخير من الشكل 4 (القاع). يجب توافر البذور المعدلة وراثيا عن حدث معين تكون محدودة، ويمكن أن يتم أخذ العينات في نسختين بدلا من ثلاث نسخ الحصول على نتائج مماثلة (أي الشكل 7). ومع ذلك، فإن عينات من ثلاث نسخ يساعد على التقليل من الخطأ المعياري. والقيد الوحيد من هذا الأسلوب هو أنه يتطلب نظام حساسة للغاية (UPLC) للكشف عن الأفلاتوكسين / الكمي، ولكن في نفس الوقت وهذا يقلل من احتمال المبالغة في تقدير تأثير رني أن الأفلاتوكسين لا يتم الكشف عن طريق وسائل أقل حساسية.

في الختام، هذا الأسلوب يقدم لأول مرة نهج يمكن الاعتماد عليها لدراسةتأثير رني في السيطرة على السموم الفطرية. تقليل الوقت لتجربة من الموسم الزراعي بأكمله إلى أقل من أسبوع واحد، وهذه الطريقة سوف يتسارع بشكل كبير للبحث عن رني الفول السوداني / الرشاشيات pathosystem نحو التخفيف و / أو القضاء على السموم الفطرية.

Materials

Name Company Catalog Number Comments
Primers, oligonucleotides DNA Technologies, Coralville, IA, USA n/a
Dneasy Plant Mini Kit Qiagen, Valencia, CA 69106
Czapek Dox agar medium Oxoid, by Thermo Fisher Scientific, Waltham, MA CM0095
Agar Thermo Fisher Scientific, Waltham, MA BP 1423
Freezer -80 °C n/a n/a
Aluminum Oxide, Al2O3 Fisher Scientific A941
SPE Reservoirs 1.5 ml Grace Davison Discovery Scientific 210011
Frits for 1.5 ml SPE reservoir Grace Davison Discovery Scientific 211401
Autosampler vials Waters Corporation, Milford, MA 186005221
Waters Acquity Ultra-Performance Liquid-Chromatography (UPLC) instrument; UPLC-H-Class Quaternary Solvent Manager; UPLC Sample Manager; UPLC Fluorescent detector (FLR); UPLC BEH C18 2.1 mm x 50 mm, 1.7 mm column Waters Corporation, Milford, MA
Finnigan LCQ Advantage MAX ion trap mass spectrometer, with Xcalibur version 1.4 software Thermo Electron Corp., San Jose, CA
Aflatoxin standards, B1, B2, G1 and G2 Sigma-Aldrich, St. Louis, MO A6636; A9887; A0138; A0263
Systat Software 12.2 SYSTAT Software Inc., Point Richmond, CA
Trizol reagent Invitrogen, CA 15596-018
SuperScript III First Strand Synthesis Super Mix Invitrogen, CA 11752-050
ABI 7500 Real-Time PCR Lifetechnologies, Grand Island, NY 4406984
Luria Broth-Miller Fisher Scientific R453642
pENTR1A Invitrogen, CA A10462
LR Clonase II enzyme mix Invitrogen, CA 11791-020
T4 DNA Ligase NEB Biolabs M0202L
Gelrite Sigma-Aldrich, St. Louis, MO G1919
Acetosyringone Sigma-Aldrich, St. Louis, MO D134406
QIAcube robot workstation Qiagen, Valencia, CA 9001292
Antibiotics: kanamycin, cefotaxime, gentamicin; streptomycin Goldbio, St. Louis, MO cef.: C-104-25; kan: K-120-5; gent.: G-400-1; strep.: S-150-50
Platinum Taq DNA Polymerase High Fidelity Invitrogen, CA 11304-029

DOWNLOAD MATERIALS LIST

References

  1. Williams, J. H., et al. Human aflatoxicosis in developing countries: a review of toxicology, exposure, potential health consequences, and interventions. The American Journal of Clinical Nutrition. 80, 1106-1122 (2004).
  2. American Association for Cancer Research: AACR. An evaluation of chemicals and industrial processes associated with cancer in humans based on human and animal data: IARC Monographs Volumes 1 to 20. Cancer Research. 40, 1-12 (1980).
  3. Turner, P. C. The molecular epidemiology of chronic aflatoxin driven impaired child growth. Scientifica. (2013).
  4. Rasooly, R., Hernlem, B., He, X., Friedman, M. Non-linear relationships between aflatoxin B1 levels and the biological response of monkey kidney vero cells. Toxins (Basel). 5, 1447-1461 (2013).
  5. Gong, Y. Y., et al. Determinants of aflatoxin exposure in young children from Benin and Togo, West Africa: the critical role of weaning. International Journal of Epidemiology. 32, 556-562 (2003).
  6. Eaton, D. L., Groopman, J. D. The toxicology of aflatoxins: human health, veterinary, and agricultural significance. Academic Press. (1994).
  7. Murugavel, K. G., et al. Prevalence of aflatoxin B1 in liver biopsies of proven hepatocellular carcinoma in India determined by an in-house immunoperoxidase test. Journal of Medical Microbiology. 56, 1455-1459 (2007).
  8. Wang, J. S., et al. Hepatocellular carcinoma and aflatoxin exposure in Zhuqing Village, Fusui County, People's Republic of China. Cancer Epidemiology, Biomarkers & Prevention. 10, American Association for Cancer Research. 143-146 (2001).
  9. Azziz-Baumgartner, E., et al. Case-control study of an acute aflatoxicosis outbreak, Kenya, 2004. Environmental Health Perspectives. 113, 1779-1783 (2005).
  10. Lye, M. S., Ghazali, A. A., Mohan, J., Alwin, N., Nair, R. C. An outbreak of acute hepatic encephalopathy due to severe aflatoxicosis in Malaysia. American Journal of Tropical Medicine and Hygiene. 53, 68-72 (1995).
  11. Villers, P. Aflatoxins and safe storage. Frontiers in Microbiology. 5, 158 (2014).
  12. Kensler, T. W., Roebuck, B. D., Wogan, G. N., Groopman, J. D. Aflatoxin: A 50-year odyssey of mechanistic and translational toxicology. Toxicological Sciences. 120, S28-S48 (2011).
  13. Dorner, J. W., Cole, R. J., Wicklow, D. T. Aflatoxin reduction in corn through field application of competitive fungi. Journal of Food Protection. 62, 650-656 (1999).
  14. Cotty, P. J., Bhatnagar, D. Variability among atoxigenic Aspergillus flavus strains in ability to prevent aflatoxin contamination and production of aflatoxin biosynthetic-pathway enzymes. Applied and Environmental Microbiology. 60, 2248-2251 (1994).
  15. Whitaker, T. B. Standardisation of mycotoxin sampling procedures: an urgent necessity. Food Control. 14, 233-237 (2003).
  16. Whitaker, T. B., Dorner, J. W., Giesbrecht, F. G., Slate, A. B. Variability among aflatoxin test results on runner peanuts harvested from small field plots. Peanut Science. 31, 59-63 (2004).
  17. Fire, A., et al. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature. 391, 806-811 (1998).
  18. Rafael, D., et al. EMT blockage strategies: Targeting Akt dependent mechanisms for breast cancer metastatic behaviour modulation. Current Gene Therapy. (2015).
  19. Li, G., Chang, H., Zhai, Y. P., Xu, W. Targeted silencing of inhibitors of apoptosis proteins with siRNAs: a potential anti-cancer strategy for hepatocellular carcinoma. Asian Pacific. Journal of Cancer Prevention: APJCP. 14, 4943-4952 (2013).
  20. Koldehoff, M. Targeting bcr-abl transcripts with siRNAs in an imatinib-resistant chronic myeloid leukemia patient: challenges and future directions. Methods in Molecular Biology. 1218, 277-292 (2015).
  21. Zhang, J., et al. Pest control. Full crop protection from an insect pest by expression of long double-stranded RNAs in plastids. Science. 347, 991-994 (2015).
  22. Ajjappala, H., Chung, H. Y., Sim, J. S., Choi, I., Hahn, B. S. Disruption of prefoldin-2 protein synthesis in root-knot nematodes via host-mediated gene silencing efficiently reduces nematode numbers and thus protects plants. Planta. 241, 773-787 (2015).
  23. Jose, A. M., Hunter, C. P. Transport of sequence-specific RNA interference information between cells. Annual Review of Genetics. 41, 305-330 (2007).
  24. Vazquez, F., Hohn, T. Biogenesis and biological activity of secondary siRNAs in plants. Scientifica. Hindawi Publishing Corporation. (2013).
  25. Tinoco, M. L. P., Dias, B. B. A., Dall'Astta, R. C., Pamphile, J. A., Aragao, F. J. L. In vivo trans-specific gene silencing in fungal cells by in planta expression of a double-stranded RNA. BMC Biology. 8, (2010).
  26. Govindarajulu, M., Epstein, L., Wroblewski, T., Michelmore, R. W. Host-induced gene silencing inhibits the biotrophic pathogen causing downy mildew of lettuce. Plant Biotechnology Journal. (2014).
  27. Yin, C., Jurgenson, J. E., Hulbert, S. H. Development of a host-induced RNAi system in the wheat stripe rust fungus Puccinia striiformis f. sp. tritici. Molecular Plant-Microbe Interactions. 24, 554-561 (2011).
  28. Ghag, S. B., Shekhawat, U. K., Ganapathi, T. R. Host-induced post-transcriptional hairpin RNA-mediated gene silencing of vital fungal genes confers efficient resistance against Fusarium. wilt in banana. Plant Biotechnology Journal. 12, 541-553 (2014).
  29. Filichkin, S. A., et al. Efficiency of gene silencing repeats vs. transitive RNAi in Arabidopsis: direct inverted vectors. Plant Biotechnology Journal. 5, 615-626 (2007).
  30. Sciaky, D., Montoya, A. L., Chilton, M. D. Fingerprints of Agrobacterium Ti Plasmids. Plasmid. 1, 238-253 (1978).
  31. Clark, D. J., Maaloe, O. DNA Replication and Division Cycle in Escherichia coli. Journal of Molecular Biology. 23, 99-112 (1967).
  32. Murashige, T., Skoog, F. A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol Plantarum. 15, 473-497 (1962).
  33. Srinivasan, T., Kumar, K. R. R., Kirti, P. B. Establishment of efficient and rapid regeneration system for some diploid wild species of Arachis. Plant Cell Tissue and Organ Culture. 101, 303-309 (2010).
  34. Gomes, A. L. V., et al. Single-tube nested PCR using immobilized internal primers for the identification of dengue virus serotypes. Journal of Virology Methods. 145, 76-79 (2007).
  35. Williams, E. J., Drexler, J. S. A non-destructive method for determining peanut pod maturity. Peanut Science. 8, 134-141 (1981).
  36. Sobolev, V. S., Dorner, J. W. Cleanup procedure for determination of aflatoxins in major agricultural commodities by liquid chromatography. Journal of AOAC International. 85, 642-645 (2002).
  37. Empower Software, Getting Started Guide. Waters Corporation. Milford, MA. Available from: http://sites.chem.colostate.edu/diverdi/C431/experiments/high%20pressure%20liquid%20chromatography/references/Empower%20getting%20started%2071500031203rA.pdf (2002).
  38. Biselli, S., Hartig, L., Wegner, H., Hummert, C. Analysis of Fusarium. toxins using LC-MS-MS: Application to various food and feed matrices. LC GC North America. 23, 404-413 (2005).
  39. Arias, R. S., Sobolev, V. S., Orner, V. A., Dang, P. M., Lamb, M. C. Potential involvement of Aspergillus flavus laccases in peanut invasion at low water potential. Plant Pathology. 63, 353-363 (2014).
  40. Dang, P. M., Chen, C. Y., Holbrook, C. C. Evaluation of five peanut (Arachis hypogaea) genotypes to identify drought responsive mechanisms utilising candidate-gene approach. Functional Plant Biology. 40, 1323-1333 (2013).
  41. Schmittgen, T. D., Livak, K. J. Analyzing real-time PCR data by the comparative C-T method. Nature Protocols. 3, 1101-1108 (2008).
  42. Amaike, S., Keller, N. P. Aspergillus flavus. Annual Review of Phytopathology. 49, 107-133 (2011).
  43. Nowara, D., et al. HIGS: Host-induced gene silencing in the obligate biotrophic fungal pathogen Blumeria graminis. Plant Cell. 22, 3130-3141 (2010).
  44. Woloshuk, C. P., et al. Molecular characterization of aflR, a regulatory locus for aflatoxin biosynthesis. Applied and Environmental Microbiology. 60, 2408-2414 (1994).
  45. Price, M. S., et al. The aflatoxin pathway regulator AflR induces gene transcription inside and outside of the aflatoxin biosynthetic cluster. FEMS Microbiology Letters. 255, 275-279 (2006).
  46. Ehrlich, K. C., Montalbano, B. G., Cotty, P. J. Sequence comparison of aflR from different Aspergillus. species provides evidence for variability in regulation of aflatoxin production. Fungal Genetics and Biology. 38, 63-74 (2003).
  47. McDonald, T., Brown, D., Keller, N. P., Hammond, T. M. RNA silencing of mycotoxin production in Aspergillus and Fusarium species. Molecular Plant Microbe Interactions. 18, 539-545 (2005).
  48. Abdel-Hadi, A. M., Caley, D. P., Carter, D. R., Magan, N. Control of aflatoxin production of Aspergillus flavus. and Aspergillus parasiticus. using RNA silencing technology by targeting aflD. (nor-1) gene. Toxins (Basel). 3, 647-659 (2011).
  49. Swartz, M. E. Ultra performance liquid chromatography (UPLC): An introduction: Separation Science Redefined. LCGC North America. Suppl ement 8. 8-14 (2005).
  50. Maghuly, F., Khan, M. A., Fernandez, E. B., Druart, P., Watillon, B., Laimer, M. Stress regulated expression of the GUS-marker gene (uidA) under the control of plant calmodulin and viral 35S promoters in a model fruit tree rootstock: Prunus incisa x serrula. Journal of Biotechnology. 135, 105-116 (2008).
  51. de Mesa, M. C., Santiago-Doménech, N., Pliego-Alfaro, F., Quesada, M. A., Mercado, J. A. The CaMV 35S promoter is highly active on floral organs and pollen of transgenic strawberry plants. Plant Cell Reports. 23, 32-38 (2004).
  52. Sunilkumar, G., Mohr, L., Lopata-Finch, E., Emani, C., Rathore, K. S. Developmental and tissue-specific expression of CaMV 35S promoter in cotton as revealed by GFP. Plant Molecular Biology. 50, 463-474 (2002).
  53. Groenenboom, M. A. C., Maree, A. F. M., Hogeweg, P. The RNA silencing pathway: The bits and pieces that matter. PLoS Computational Biology. 1, 155-165 (2005).
  54. Zhao, D., Song, G. Q. High-throughput sequencing as an effective approach in profiling small RNAs derived from a hairpin RNA expression vector in woody plants. Plant Science: an International Journal of Experimental Plant Biology. 228, 39-47 (2014).
  55. Kamthan, A., Chauduri, A., Kamthan, M., Datta, A. Small RNAs in plants: recent development and application for crop improvement. Frontiers in Plant Science. 6, 208 (2015).
  56. Manda, A., Bodapati, P. N., Rachaputi, N. C., Wright, G., Fukai, S. Aflatoxins and their relationship with sugars in peanut (Arachis hypogaea L). 4th International Crop Science Congress, 2004, Available from: http://www.cropscience.org.au/icsc2004/poster/5/1/3/625_manda.htm (2004).
  57. Uppala, S. S. Factors affecting pre-harvest aflatoxin contamination of peanut (Arachis hypogaea L). Auburn University. (2011).
  58. Sobolev, V. S. Localized production of phytoalexins by peanut (Arachis hypogaea) kernels in response to invasion by Aspergillus species. Journal of Agricultural and Food Chemistry. 56, 1949-1954 (2008).
  59. Sobolev, V. S., Guo, B. Z., Holbrook, C. C., Lynch, R. E. Interrelationship of phytoalexin production and disease resistance in selected peanut genotypes. Journal of Agricultural and Food Chemistry. 55, 2195-2200 (2007).
  60. Sobolev, V. S., Neff, S. A., Gloer, J. B. New stilbenoids from peanut (Arachis hypogaea) seeds challenged by an Aspergillus caelatus strain. Journal of Agricultural and Food Chemistry. 57, 62-68 (2009).
  61. Dorner, J. W., Cole, R. J., Sanders, T. H., Blankenship, P. D. Interrelationship of kernel water activity, soil temperature, maturity, and phytoalexin production in preharvest aflatoxin contamination of drought-stressed peanuts. Mycopathologia. 105, 117-128 (1989).
  62. Sobolev, V. S. Production of phytoalexins in peanut (Arachis hypogaea) seed elicited by selected microorganisms. Journal of Agricultural and Food Chemistry. 61, 1850-1858 (2013).
  63. Basha, S. M. M., Cherry, J. P., Young, C. T. Changes in free amino acids, carbohydrates, and proteins of maturing seeds from various peanut (Arachis hypogaea L.) cultivars. Cereal Chemistry. 53, 586-596 (1976).
  64. Lansden, J. A. Aflatoxin inhibition and fungistasis by peanut tannins. Peanut Science. 9, 17-20 (1982).
  65. Yen, G. C., Duh, P. D., Tsai, C. L. Relationships between antioxidant activity and maturity of peanut hulls. Journal of Agricultural and Food Chemistry. 41, 67-70 (1993).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics