Controllo RNAi mediata di aflatossine in arachidi: metodo per analizzare produzione di micotossine e transgene espressione nel Peanut /

Environment
 

Summary

Abbiamo dimostrato un metodo per l'analisi delle aflatossine e espressione del transgene in semi di arachidi che contengono segnali di RNA-interferenza per il silenziamento dei geni aflatossine-sintesi nel fungo Aspergillus flavus. Controllo RNAi mediata di micotossine nelle piante non è stata segnalata in precedenza.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Arias, R. S., Dang, P. M., Sobolev, V. S. RNAi-mediated Control of Aflatoxins in Peanut: Method to Analyze Mycotoxin Production and Transgene Expression in the Peanut/Aspergillus Pathosystem. J. Vis. Exp. (106), e53398, doi:10.3791/53398 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

L'Organizzazione per l'Alimentazione e l'Agricoltura delle Nazioni Unite stimano che il 25% delle colture alimentari nel mondo sono contaminati con aflatossine. Che rappresenta 100 milioni di tonnellate di cibo distrutte o dirottati verso il consumo non umano di ogni anno. Le aflatossine sono potenti agenti cancerogeni normalmente accumulati dal funghi Aspergillus flavus e A. parasiticus in cereali, noci, tuberi e altri prodotti agricoli. Silenziamento di cinque geni aflatossina-sintesi di RNA interference (RNAi) negli impianti di arachidi è stato utilizzato per controllare l'accumulo di aflatossina a seguito dell'inoculazione con A. flavus. In precedenza, nessun metodo esisteva per analizzare l'efficacia di RNAi in arachidi singoli eventi transgenici, come questi di solito producono pochi semi e metodi tradizionali di esperimenti sul campo di grandi dimensioni in condizioni di aflatossina-favorevoli non erano un'opzione. Nel campo, la probabilità di trovare semi naturalmente contaminati è spesso 1/100 a 1/1,000. Inoltre, la contaminazione da aflatossine non è distribuito in modo uniforme. Il nostro metodo si avvale di alcuni semi per evento transgenico, con piccoli pezzi lavorati per real-time PCR (RT-PCR) o piccoli RNA sequencing, e per l'analisi di accumulo di aflatossina mediante cromatografia liquida ultra-prestazioni (UPLC). -RNAi esprimendo linee di arachidi 288-72 e 288-74, ha mostrato una riduzione fino al 100% (p≤0.01) in aflatossina B 1 e B 2 rispetto al controllo che si sono accumulati fino a 14.000 ng. G -1 di aflatossina B 1 quando inoculati con aflatoxigenic A. flavus. Come riferimento, il totale massimo di aflatossine consentiti per il consumo umano negli Stati Uniti è di 20 ng. G -1. Questo protocollo descrive l'applicazione del controllo RNAi mediata di aflatossine nei semi e metodi per la sua valutazione di arachidi transgenici. Noi crediamo che la sua applicazione in allevamento di arachidi e altre colture porterà un rapido progresso in questo importante settore della scienza, La medicina e nutrizione umana, e contribuirà in modo significativo allo sforzo internazionale per il controllo aflatossine, e potenzialmente altre micotossine nelle principali colture alimentari.

Introduction

Circa 4,5 miliardi di persone sono cronicamente esposti a aflatossine 1, le più potenti agenti cancerogeni noti in natura 2. Queste micotossine contaminano il 25% delle colture alimentari del mondo 3, tra cui mais, manioca, riso, noci, cereali e spezie. 4. Le aflatossine causare arresto della crescita nei bambini di 5, compromettono il sistema immunitario 6, sono presenti nel 58% dei carcinomi epatocellulari-in biopsie umane 7,8, e uccidono centinaia di persone durante le epidemie periodiche di aflatoxicosis 9,10. Le aflatossine sono micotossine polyketide di derivazione normalmente prodotti da Aspergillus flavus e A. parasiticus; aflatossine B 1 e B 2 sono prodotte da A. flavus, mentre A. parasiticus produce anche G 1 e G 2. La struttura chimica di questi composti e un cromatogramma che mostra la loro separazione dal UPLC sono mostrati in Figura 1.

Figura 1
Figura 1. Le aflatossine e RNAi inserire Top:. Struttura chimica (a sinistra) e con l'esempio di cromatogramma (a destra) dei quattro aflatossine polyketide di derivazione più comuni: B 1, B 2, G 1 e G 2, prodotta da Aspergillus parasiticus, A . flavus produce B 1 e B 2 In basso: Schema di frammenti di geni nel RNAi costruire p5XCAPD utilizzato per la trasformazione di arachidi, numeri sotto le frecce sono numeri di accesso gene-frammento del genoma Aspergillus flavus;. PIV2: introne patate; coppie di basi;: bp RT_5X_1 e RT_5X_2:. Real-Time PCR Primer siti Cliccate qui per vedere una versione più grande di questa figura.

Le perdite economiche delle esportazioni a causa di aflatossine in arachidi solo superano $ 450 milioni di dollari, se calcolata in base al 4 ng. G -1 limite di aflatossine consentito per il consumo umano nell'Unione europea 11. Le aflatossine sono note da 60 anni 12; Tuttavia, anche se molte pratiche agricole sono state sviluppate per mitigare l'effetto, compresa l'applicazione di altri ceppi fungini 13,14, nessun metodo coerente di controllo esiste, e varietà vegetali resistenti non sono disponibili. Test germoplasma vegetale per la resistenza di aflatossine è particolarmente difficile, perché anche in condizioni favorevoli per l'agente patogeno invasione, l'accumulo di micotossine è imprevedibile e non segue una distribuzione normale. Così, gli esperimenti di solito richiedono aree di impianto di grandi dimensioni, centinaia di semi e campioni multipli di 100-1,700 g per ridurre la variabilità del 15,16 dati.

RNA interferenza erascoperto nel 1998 17; ed i benefici di "tacere" sono attualmente in fase di studio in una serie di nuove applicazioni, ad es., nelle terapie umani contro il cancro al seno metastatico 18, il cancro al fegato 19, leucemia mieloide 20, e in protezione delle piante contro gli insetti 21 e 22 nematodi. Nelle piante, segnali di disturbo RNA possono viaggiare una cella all'altra, con piccoli RNA interferenti (siRNA) e alta RNA peso molecolare responsabile per il gene posttranscriptional sistemica silenziamento 23,24, anche all'interno di patogeni fungini che si trovano a stretto contatto con pianta ospite 25. L'efficacia di RNAi sulla pianta mediato silenziamento di geni fungini-patogeno è stata descritta in poche patosistemi vegetali, per questi, l'esame visivo dei sintomi nelle parti aeree delle piante (foglie) consentita la quantificazione della malattia, vale a dire, oomicete Bremia nella lattuga 26 , Puccinia nel grano Fusarium in banane 28. Molto più difficile è quello di valutare l'efficacia RNAi per controllare micotossine nelle piante, in particolare aflatossine in arachidi come le foglie mostrano sintomi di infezione, gli organi invasi (semi) sono sotto parecchi pollici di suolo, l'insorgenza di infezione è imprevedibile, e solo chimica analisi può determinare la presenza di aflatossine. Inoltre, ogni evento transgenico in arachidi normalmente produce alcuni semi (4-6 per pianta); Pertanto, il test tradizionale per un no-aflatossina accumulo tratto in grandi appezzamenti di campo, della durata di intere stagioni di coltivazione, e l'utilizzo di centinaia di semi non è fattibile. Un metodo è descritto qui di analizzare in meno di una settimana, RNAi semi di arachidi per presenza di transgene e di un no-aflatossina accumulo tratto, utilizzando solo pochi semi.

Protocol

1. Costruire Molecolare e Peanut Trasformazione

  1. Unire frammenti di DNA di cinque A. geni flavus, AFL2G_07223 (AFLS o aflJ), AFL2G_07224 (AFLR), AFL2G_07228 (aflC / pksA / pksL1), AFL2G_07731 (pes1) e AFL2G_05027 (pompa di efflusso aflatossina, aflep). Per questo, utilizzare i seguenti primer e ultramers: DIR-1, Short-Dir1-R, DIR-2-rovesciata, Short-Dir2-R, DirAll-NCO-Rv, e DirAll-BamEco-Fw, tabella 1.
    1. Fai DIR-1 doppio filo da 5 cicli di PCR (reazione di 25 ml; 95 ° C 2 min, seguito da 5 cicli di 94 ° C 45 sec, 55 ° C 30 sec, 68 ° C 15 sec), utilizzando la DNA polimerasi secondo il fornitore di istruzioni e fondo Short-Dir1-R per lasciare un CCCGT 3 'overhang. Ripetere questi passaggi per fare doppio filo DIR-2-invertita con iniettore a breve Dir2-R per lasciare un ACGGG 3 'overhang complementare alla DIR-1.
    2. Legare il Fragme due 199 bpnti con T4 DNA Ligase come da istruzioni del produttore. PCR amplifica la risultante frammento di 393 bp, come indicato in 1.1.1 con primer DirAll-CACC-FW e DirAll-NCO-Rv (Tabella 1), e clonare il prodotto utilizzando tecniche standard in pENTR1A fare plasmide p2 + 4ENTR.
    3. Ricombinare p2 + 4ENTR in pCAPD 29 (NCBI adesione: KC176455.1) utilizzando LR clonase II mix enzima secondo le istruzioni del produttore per fare plasmide p5XCAPD, e trasformarlo in Escherichia coli DH5α utilizzando tecniche standard seguiti da sequenziamento parziale. Nota: L'inserto RNAi finito è mostrato nella Tabella 1.
  2. Trasforma Agrobacterium ceppo C58C1 30 con il plasmide p5XCAPD come riportato in precedenza 30, e utilizzare il batterio risultante di trasformare le piante di arachidi come segue:
    1. Grow a 30 ° C la Agrobacterium ospitare p5XCAPD, utilizzare per questo, da 50 ml LB-Broth integrato con 500mg ml -1 streptomicina, 25 mg ml -1 gentamicina, 10 mg ml -1 kanamicina, e scuotere la cultura a 250 rpm fino a raggiungere 1 260 OD.
    2. Raccogliere le cellule tumefaciens per centrifugazione (6000 x g) per 10 minuti, risospendere in 50 ml di AB minima quantità di terreno 31 con 100 micron acetosyringone per 1 ora, e il luogo in sospensione batterica espianti di 10-14 giorni di età piantine Exp27-1516, corridore tipo linea di riproduzione di arachidi. Blot asciugare gli espianti su 3MM carta assorbente dopo 30 minuti, e metterli a medio shoot-induzione (SIM) [MS sale 32, 3% di saccarosio, 20 mM benzilaminopurina (BAP), 10 mM thidiazuron (TDZ), pH 5,8, 0,3 % gellano gomma] senza antibiotici al buio per tre giorni.
    3. Fare selezione tessuti e la rigenerazione come riportato prima 33. Spostare i tessuti su SIM (500 micron cefotaxime e 100 micron kanamicina) per la formazione di riprese, con trasferimenti bisettimanali per 2 mesi. Poi postoespansione spara a medio shoot-allungamento (SEM) [5 micron BAP, 1 mM acido gibberellico (GA 3)], bi-settimanale per diversi mesi.
    4. Posizionare i singoli tiri, 2 cm di dimensioni, in media radice-induzione (RIM) [1/2 ms, 1,5% di saccarosio, 5 micron α-naftalene-acido acetico (NAA), 2,5 micron indolo-butirrico (IBA)], quindi acclimatare le piante e trasferirle alla serra.

2. Identificazione di arachidi piante ospitano RNAi di geni Silenzio Aflatossina sintesi

  1. Usa impianto mini kit in una stazione di lavoro robot con 200 eluizione microlitri secondo le istruzioni del produttore per estrarre il DNA da foglie giovani di piante di arachidi che sono state soggette al processo di trasformazione (come descritto in precedenza) con RNAi costruire p5XCAPD (Figura 1), che ha come spina dorsale plasmide pCAPD 29 per silenziamento genico.
  2. Schermo i campioni di DNA da parte del singolo-tubo nested PCR (STN-PCR), come descritto previneamente 34 per rilevare il marcatore NPTII selezionabili e la RNAi inserire da p5XCAPD. Clonale propagarsi dai tagli (3-4 nodi) PCR piante positivi per la produzione di sementi sufficienti per le prove in questa prima generazione.
    1. Utilizzare quattro diluizioni 2-fold di DNA (50-100 ng ml -1 prima della diluizione) in tutte le reazioni STN-PCR. Per NPTII, utilizzare primer esterni PCAPD 5714F: 5'-AGGCTATTCGGCTATGACTG-3 'e PCAPD 6446R: 5'-CGTCAAGAAGGCGATAGAAG-3', e fondi interni PCAPD 5730F: 5'-ACTGGGCACAACAGACAATC-3 'e PCAPD 6249R: 5'-ATATTCGGCAAGCAGGCATC- 3 '.
    2. Per il rilevamento di RNAi inserire nelle reazioni STN-PCR utilizzare primer esterni 35S-PDSFw: 5'-CCTAACAGAACTCGCCGTAA-3 'e DirAll-NCO-Rv: 5'-ATGCCATGGGGTTATTGGGTGCAGAATGG-3', e primer interni Probe_5027_Fw: 5'-gtatttgtgaccatgtttctg-3 'e Probe_7228_Rv: 5'-GGACGGATAGTAAACTGCGG-3'.
  3. Harvest baccelli arachidi provenienti dagli impianti positivi STN-PCR e del con piante coltivate trollo nelle stesse condizioni. PUNTO CRITICO: Assicurarsi che il controllo piante sono coltivate nelle stesse condizioni e la stessa stagione, come le piante RNAi. Scoppio dell'acqua i baccelli con una idropulitrice a bassa intensità o raschiare a mano per rimuovere esocarpo, determinare il colore del mesocarpo mettendo i baccelli su una tavola di maturità e cialde separati in gruppi (giallo, arancio, marrone e nero) 35 (Figura 2).

Figura 2
Figura 2. Preparazione dei baccelli arachidi per l'analisi. Sinistra: I formati differenti arachidi trovato alla raccolta come arachide è una pianta di crescita indeterminata; Centro: ponendo arachidi nel cestino del metallo per la rimozione pressione dell'acqua esocarpo; Destra: gruppi di maturità in base al colore mesocarpo su una scheda profilo di arachidi (giallo, arancio, marrone e nero).98fig2large.jpg "target =" _ blank "> Clicca qui per vedere una versione più grande di questa figura.

3. Setup sperimentale

  1. Rimuovere il scafi, processo giallo e semi marroni separatamente. Calcolare il numero di semi da utilizzare nell'esperimento in base alla tabella 2. Si noti che un minimo di tre pezzi di semi (1 seme pezzo = metà cotiledone) per linea di arachidi e la data di campionamento è necessaria per eseguire analisi statistiche e di ridurre l'errore standard.
Nome Sequenza
DIR-1 5'-
GCCAGCTCAAAAGTGCGATGCACCAAGGAGAAACCGGCCTGTGCT
CGGTGTATCGAACGTGGTCTTGCCTGTCAATACATGGTCGTATTTG
TGACCATGTTTCTGGTGGCATTGGACCGTCTTGTCATCTCTACAGCC
ATTCCCCAGATCACGGACGAATCCCCTGCATCTACGCGCACGCATC
ACTTGGGGTACCCGT-3 '
Short-Dir1-R 5'-Phos-TACCCCAAGTGATGCGTGCGCG-3 '
DIR-2-invertita 5'-GGTTATTGGGTGCAGAATGGTAAACCACCCAACAGTACGCGAAATG
TCAATTCCAGAGTCCCAAACCTCCCTACCGTGGCCTGGACGGATAG
TAAACTGCGGAGCTTGGGAACAAAATCCGCTGTCTGATCGCCGAAG
AGAAAGAGTTGCCTTGATTGAGCCGCATCGAGGACAGGTTGTGTTG
CTGTTGATAGACGGG-3 '
Short-Dir2-R 5'-Phos-CTATCAACAGCAACACAACC-3 '
DirAll-CACC-Fw 5'-CACCGCCAGCTCAAAAGTGCGATGC-3 '
DirAll-NCO-Rv 5'-ATGCCATGGGGTTATTGGGTGCAGAATGG-3 '
DirAll-BamEco-Fw 5'-ATGGGATCCGAATTCGCCAGCTCAAAAGTGCGATGC-3 '
Completa inserto RNAi 5'-GCCAGCTCAAAAGTGCGATGCACCAAGGAGAAACCGGCCTGTGCT
CGGTGTATCGAACGTGGTCTTGCCTGTCAATACATGGTC / GTATTTG
TGACCATGTTTCTGGTGGCATTGGACCGTCTTGTCATCTCTACAGCC
ATTCCCCAGATCACGGACGAAT / CCCCTGCATCTACGCGCACGCAT
CACTTGGGGTACCCGTCTATCAACAGCAACACAACCTGTCCTCGAT
GCG / GCTCAATCAAGGCAACTCTTTCTCTTCGGCGATCAGACAGCG
GATTTTGTTCCCAAGCTCCGCAGTTTACTATCCGTCCA / GGCCACGG
TAGGGAGGTTTGGGACTCTGGAATTGACATTTCGCGTACTGTTGGG
TGGTTTACCATTCTGCACCCAATAACC-3 '

. Tabella 1. oligonucleotidi e ultramers utilizzati per creare il RNAi costruire p5XCAPD Phos: fosforilati 5 '; "/" Separa i cinque frammenti di geni usati; Completa inserto RNAi: sequenza usata come 2 ripetizioni invertite per formare p5XCAPD.

  1. Posizionare interi semi di arachidi in un unico strato in modo da coprire il fondo di un becher sterile. Aggiungere la soluzione 75% di etanolo / acqua (v / v) per coprire i semi e quindi aggiungere un volume uguale della stessa soluzione. Incubare a temperatura ambiente per 30 secondi e poi sciacquare con acqua deionizzata sterile (SDW).
  2. Aggiungere 2% di ipoclorito nel becher contenente i semi etanolo trattati come segue: aggiungere sufficiente soluzione di ipoclorito 2% per coprire i semi, poi aggiungere un volume uguale della stessa soluzione e incubare per 5 min. PUNTO CRITICO: Sciacquare accuratamente tre volte con un volume di SDW equivalente a 5 volte il volume di ipoclorito usato (figura 3).

Figura 3
Figura 3. installazione sperimentale. Top: la sterilizzazione superficiale di semi di arachidi, prima e dopo l'ipoclorito, la rimozione dei tegumenti (TESTA); Medio: rimozione di embrione e vedere da vicino embrione, poi tagliare cotyledon a metà; basso: cotiledoni metà in acqua distillata sterile, cancellando in sterili assorbente carta, ammaccature su agar acqua, e sistemazione di cotiledoni metà (parte tagliata verso l'alto) sulla superficie agar. Cliccate qui per vedere una versione più grande di questa figura.

  1. Lasciare che il semi-superficie sterilizzato per assorbire immersi in SDW per 2 ore. Mettere i semi su una piastra di Petri sterile, togliere i cappotti di seme con una pinza, separare i cotiledoni, e con un bisturi rimuovere gli embrioni. Nota:Gli embrioni possono essere scartati o utilizzati per rigenerare nuovi impianti.
  2. Tagliare ogni cotyledon a metà con un bisturi. Per evitare la disidratazione, tenere i pezzi di semi tagliati in acqua sterile fino a quando tutti i semi vengono elaborati.
  3. Hanno preparato piastre Petri contenenti agar acqua sterile (1,5% agar / acqua; w / v), uno per ogni tre pezzi seme. Fare piccole ammaccature in agar usando pinze, brevemente tamponare l'acqua in eccesso di pezzi di semi di asciugamani di carta sterili, e quindi disporre i pezzi di semi (taglio supino) sulle piastre di agar acqua /.
  4. Da una coltura fresca di Aspergillus flavus aflatoxigenic NRRL 3357 in terreno agar di Czapek cresciuto a 25 ° C per 10 giorni, preparare una sospensione di spore per 50.000 microlitri SDW, contate con un emocitometro.
  5. Mettere 2 microlitri della sospensione di spore sulle superfici di taglio di ogni pezzo mezza cotiledone evitando deflusso sui lati, per assicurarsi che le spore ottenere esposti al tessuto seme che ospita RNAi (Figura 4).

    Figura 4
    Figura 4. Semina ed incubazione per l'analisi delle aflatossine. Top: Mezza cotiledone inoculazione con sospensione di spore, e Aspergillus flavus crescita del micelio su metà cotyledon dopo 24 ore di incubazione In basso: a sinistra:. Incubazione di 48 ore su 1,5% agar; Centro: incubazione per 72 ore a 1,5% agar; a destra:. esempio di errata impostazione sperimentale, incubazione per 72 ore a 0,5% agar Cliccate qui per vedere una versione più grande di questa figura.

    1. Incubare le piastre Petri contenenti cotiledoni mezzo inoculate e non inoculate a 30 ° C al buio fino al campionamento.

    4. Il campionamento per l'analisi delle aflatossine e Gene Expression

    1. Un prelievo di campionitre esemplari a 24, 48 e 72 ore (opzionale a 96 ore) di incubazione, sia per RT-PCR e per l'analisi delle aflatossine, ogni replica essendo un pezzo (a metà cotyledon). Scegli campioni a caso da piatti diversi su ogni data di campionamento. Utilizzando un tessuto, dolcemente rimuovere spore fungine agar e in eccesso prima di mettere pezzi di sementi in fiale o provette.
    2. Per l'analisi delle aflatossine, svolge ogni replica (un pezzo) in 4 ml di vite vetro tappo flacone e conservare a -80 ° C. Nota: Data la stabilità chimica di aflatossine, campioni possono essere conservati in questa condizione per alcuni mesi (negli esperimenti correnti solito 1-2 mesi).
    3. Per la RT-PCR posto ogni replica (un pezzo) di già pronto da 2 ml di macinazione provette contenenti due perle in acciaio inox (2,5 mm di diametro) e tre perle zirconio (2 mm diam).
    4. Congelare immediatamente (preferibilmente in azoto liquido) tutti i campioni e tenerli a -80 ° C fino al trattamento.

    5. L'aflatossina analisi dei singoli Mezza Cotyledon Pezzi

    1. Utilizzare la A. flavus inoculati campioni per questa analisi. Portare i campioni a temperatura ambiente per circa 30 minuti, aggiungere quattro volumi (di solito 2-3 ml; w / v) di metanolo (tenere record per calcoli successivi), chiudere i tappi, e incubare O / N (~ 16 ore) nella scuro senza agitazione.
    2. Inserire una fritta in un minicolonna 1,5 ml di propilene corrispondenza, aggiungere 200 mg di base Al 2 O 3 e ricoprirlo con un altro fritta come descritto in precedenza 36; quindi, inserire un Ultra-High Performance Liquid Chomatographer (UPLC) campionatore automatico fiala sotto la colonna abbastanza vicino per evitare possibili evaporazione dell'eluato.
    3. In una provetta di vetro monouso (non utilizzare plastica), collocare 0,5 ml dell'estratto metanolo ottenuto nello stadio 4.1, aggiungere 0,5 ml di acetonitrile, mescolare e applicare pipetta 0,5 ml della miscela nella colonna preparato al punto 4.2. Lasciare eluizione nel flaconcino campionatore automatico per gravità (non applicare pressione). Eluizione di solito prende 2-4 minuti, vicino the fiala immediatamente con un berretto compatibili UPLC con setti. Tenere i flaconcini a temperatura ambiente e analizzare loro lo stesso giorno su un UPLC.
    4. Per la separazione delle aflatossine, fiale luogo autocampionatore contenenti eluati di esempio e fiale Autocampionatore con standard di aflatossine (B 1 e B 2 quando si usa A. flavus) in uno strumento UPLC dotato di un corrispondente UPLC Quaternario Solvent Manager, UPLC gestione campioni, UPLC fluorescente rivelatore, e C 18 2.1 mm x 50 mm, 1,7 micron colonna.
      1. Utilizzare una fase mobile isocratica composto da acqua / MeOH / CH 3 CN (64:23:13, v / v / v) ad un flusso di 0,30 ml min -1. Ottenere cromatogrammi che assicurano una separazione di base stabilizzato per il calcolo preciso della concentrazione aflatossina, secondo le istruzioni del produttore 37.
      2. Confermare l'identità di aflatossine ottenendo i propri dati di massa-spettrale e confrontandoli con i dati pubblicati 38. Utilizzare un isulla presa spettrometro di massa equipaggiato con una interfaccia ESI e relativo software in base alle istruzioni del produttore.
    5. Determinare le concentrazioni di aflatossine con riferimento alle curve di calibrazione ottenute iniettando diverse quantità di corrispondenti standard commerciali di aflatossine B 1, B 2, G 1 e G 2 come suggerito dal produttore UPLC e determinato dal software 37.
    6. Pezzi posto di semi già estratto con metanolo, in singoli flaconi in vetro per O / N (~ 16 ore) liofilizzazione per determinare il loro peso secco. Quindi, calcolare la concentrazione di aflatossine in ng. G -1 di peso a secco di pezzo seme.
    7. Per l'analisi dei dati, convertire i risultati aflatossine effettuare il login (ng. G -1 +1), seguito dal test di Tukey per confronti medi.

    6. espressione genica, RT-PCR Trattamento dei campioni

    1. Prendete i 2 ml di macinazione tubi contengonoing campioni dal -80 ° C freezer, e subito (senza scongelamento) li macinare in un mulino omogeneizzatore tallone a 3.100 rpm per 40 secondi, quindi procedere alla estrazione di RNA con Trizol secondo le istruzioni del produttore.
    2. Preparare cDNA da ciascun campione utilizzando 1 mg di RNA e la stessa quantità di oligo dT e esameri casuali, fare una diluizione 1: 8 del cDNA e utilizzare 2 pl per reazione RT-PCR (come descritto in precedenza 39).
      1. Per il rilevamento di espressione di RNAi uso dell'inserto primer: RT_5X_1_105F: 5'GGTGGCATTGGACCGTCTTG-3 ', RT_5X_1_232R: 5'-CGCATCGAGGACAGGTTGTG-3'; e RT_5X_2_95F: 5'-CCATGTTTCTGGTGGCATTG-3 ', RT_5X_2_229R: 5'-ATCGAGGACAGGTTGTGTTG-3'.
      2. Per il rilevamento di espressione del marcatore NPTII selezionabile, uso primer: RT_NPTII_1_6871F: 5'-CTCGCTCGATGCGATGTTTC-3 ', RT_NPTII_1_7004R: 5'-GCAGGATCTCCTGTCATCTC-3'. Utilizzare il gene housekeeping Actina per la standardizzazione, e primer: Actina-Fw: CACATGCCATCCTTCGATTG; Actina-Rv: CCAAGGCAACATATGCAAGCT 40.
    3. Analizzare i risultati di Delta-delta C T metodo standardizzato 41 per l'espressione actina. Rappresentare i risultati come volte maggiore rispetto al controllo.

Representative Results

Plasmide p5XCAPD è stato fatto come un derivato di pCAPD 29, e lo ha utilizzato per trasformare le piante di arachidi; questo vettore trasporta ripetizioni invertite di cinque piccoli frammenti, 70-80 bp ciascuna, di geni aflatossina-sintesi di A. flavus separati da un introne (Figura 1). Frammenti di AFL2G_07224 (AFLR), AFL2G_07223 (AFLS o aflJ), AFL2G_05027 (pompa di efflusso aflatossina, aflep), AFL2G_07228 (aflC / pksA / pksL1), e AFL2G_07731 (pes1) sono stati utilizzati per la costruzione, numeri sulla figura 1 corrispondono ad A . flavus annotazione del genoma in BROAD Institute, Cambridge, MA, e la letteratura 42. Un totale di 99 linee di arachidi sono stati rigenerati dopo aver attraversato il processo di trasformazione, 50 erano positivi alla PCR per NPTII rilevato da STN-PCR, e 33 linee erano PCR semi positivi e prodotti. Solo sette linee positive PCR sono stati clonale propagate e testati dal presenMetodo t di accumulo aflatossina, tutti e sette mostrato tra il 60% e il 100% in meno di accumulo aflatossina rispetto al controllo. Qui vi mostriamo i risultati di due di queste sette linee. Come singoli eventi transgenici di solito producono pochi semi, un metodo è stato sviluppato per utilizzare un numero minimo di sementi, pur essendo in grado di fare analisi statistica parametrica. Un diagramma di flusso della preparazione del campione e la configurazione sperimentale è mostrato in Figura 5 e nella tabella 1. Anche se la prima generazione di semi transgenici è tipicamente emizigote, si prevede che la cellula-cellula e circolazione sistemica di piccoli RNA interferenti (siRNA) generata attraverso RNA interference dovrebbe conferire aflatossina sintesi silenziamento in tutto l'impianto.

Figura 5
Figura 5. diagramma di flusso Schema del metodo per analizzare l'efficacia di RNAi in tacere Aspergillus geni aflatossine-sintesi di semi di arachidi. Rappresentazione grafica del flusso di lavoro durante l'elaborazione di campioni di arachidi per l'espressione genica e l'analisi delle aflatossine. Cliccate qui per vedere una versione più grande di questa figura.

RNAi linee arachidi 288-72 e 288-74 hanno evidenziato la presenza del creatore selezionabile NPTII quando testato da STN-PCR, le sezioni di gel sono mostrati in figura 6 (in alto), immagini originali sono disponibili su richiesta degli autori. Plasmid pCAPD non è stato utilizzato come controllo della trasformazione poiché esso codifica ripetizioni invertite di due geni CMR (resistenza al cloramfenicolo) e CCDB (tossina) ignota effetto sulle piante. PCR negativa linea di arachidi 288-9 e altri che sono passati attraverso il processo di rigenerazione e sia stata coltivata nelle stesse condizioni linee RNAi, sono stati utilizzati come con negativocontrollo.

Figura 6
. Figura 6. Individuazione di prodotti transgenici e Real Time espressione di RNAi dell'inserto Top: tubo singolo, nested PCR individuazione di linee transgeniche arachidi RNAi-288-72 e RNAi-288-74, piante positivi. Controlli: W (acqua), PP (pianta positivo), MM (master mix), p (plasmide p5XCAPD); frazioni 1/2 04/01 08/01 16/01 rappresentano diluizioni 2-fold di DNA inferiore:. Real-Time PCR rilevamento di espressione del RNAi inserto (set di primer: RT_5X_1, RT_5X_2, come nella figura 1, su immaturo ( giallo) e maturo (marrone) cotiledoni di linee transgeniche a 24 e 48hr incubazione; linea grigia: C T = 1. Gli istogrammi rappresentano i mezzi e le barre di errore standard (T) su tre campioni biologicicon tre repliche tecniche. La quantificazione relativa dell'inserto RNAi è stata normalizzata rispetto al gene housekeeping actina come controllo interno ed espressione volte comparativo del transgene calcolato come descritto in 5.2.2 e 5.3. Clicca qui per vedere una versione più grande di questa figura.

Per testare l'efficacia di pianta-host RNAi mediata controllo potenziale di accumulo di aflatossina, conidi appena raccolto di Aspergillus flavus NRRL 3357 sono stati applicati sulla superficie di taglio di cotiledoni mezzo da cui erano state rimosse embrioni e testa (figure 3, 4). A. flavus NRRL 3357, per i quali il genoma è stato sequenziato ed è stata la base per la progettazione p5XCAPD, è stato gentilmente fornito dal Dr. Horn a USDA-ARS-NPRL. L'invasione fungina risultante di mezzo cotiledone dopo il 24, 48 e 72 ore a 30 ° C è spettacolo n in Figura 4. Campioni di cotiledoni mezzo inoculati sono stati raccolti a 24, 48, 72, 96 ore di incubazione, e analizzati per la principale quattro aflatossine B 1, B 2, G 1 e G 2 utilizzando UPLC e confermati da LC-MS ; risultati sono mostrati in Figura 6. Alfatossina concentrazioni sono state determinate utilizzando un metodo pubblicato con modifiche 36. A 96 ore di incubazione, cotiledoni cominciano a disintegrarsi a causa della infezione fungina. RNAi linea 288-72 mostrato livelli significativamente più bassi di aflatossine rispetto al controllo in tutte le date di campionamento di cotiledoni immaturi e alla maggior parte le date di prelievo in quelli maturi. RNAi linea 288-74 ha mostrato livelli significativamente più bassi di aflatossine nella maggior parte le date di prelievo. I livelli di significatività del test di Tukey sono indicati con asterischi nel grafico di figura 7.

g7.jpg "/>
. Figura 7. Le aflatossine B 1 e B 2 di cotiledoni mezzo di arachidi dopo incubazione (24, 48, 72 e 96 ore) con Aspergillus flavus controllo: semi di 288-9 linea non transgenica; RNAi: semi di RNAi-288-72 e RNAi-288-74, transgenici per RNAi p5XCAPD al silenzio cinque geni aflatossine-sintesi. (A) aflatossina B 1 a semi maturi (marrone); (B) L'aflatossina B 2 semi maturi; (C) aflatossina B 1 nei semi immaturi (giallo) e (D) aflatossina B 2 nei semi immaturi. I valori medi con i corrispondenti barre di errore standard (T) di campioni biologici duplicati sono rappresentati. Differenze statisticamente significative di Tukey test *: p ≤ 0.05, **: p ≤ 0.01, ***: p ≤ 0,001.s: //www.jove.com/files/ftp_upload/53398/53398fig7large.jpg "target =" _ blank "> Clicca qui per vedere una versione più grande di questa figura.

Nel complesso, RNAi-288-72 mostrato tutto l'esperimento (24 a 96 ore di incubazione), una riduzione del 94% -100% in aflatossina B 2, e una riduzione del 90% -100% in aflatossina B 1 rispetto al controllo. RNAi-288-74 mostrato una riduzione del 63% -100% in aflatossina B 2 e il 60% di riduzione -100% in aflatossina B 1, Figura 7.

Primer utilizzati per Real-Time PCR rilevamento di espressione dell'inserto RNAi sono mostrati in Figura 1. Cotiledoni arachidi-seme sono stati analizzati senza embrioni, per rimuovere le difese naturali ed essere in grado di rilevare l'effetto potenziale di RNAi sulla zona più esposta invasione fungina, i cotiledoni. L'espressione della RNAi dell'inserto rilevata nel cotiledoni immaturi (giallo) della linea 288-74 da set di primer RT_5X_1 era quattro volte sopra la C T (Figura 1, 6). L'espressione di inserto RNAi non è stato rilevato in cotiledoni maturi a 24 ore, o su cotiledoni maturi o immaturi a 48 ore di incubazione, figura 6 (in basso).

Peanut Linea Tempo di campionamento I campioni per la RT-PCR I campioni per l'analisi delle aflatossine (inoculato) Numero di semi
(non inoculato)
Rep 1 Rep 2 Rep 3 Rep 1 Rep 2 Rep 3
RNAi (giallo) 24 ore 1 1 1 1 1 1 4.5
48 ore 1 1 1 1 1
72 ore 1 1 1 1 1 1
Controllo 24 ore 1 1 1 1 1 1 4.5
(giallo) 48 ore 1 1 1 1 1 1
72 ore 1 1 1 1 1 1

Tabella 2. Esempio di configurazione piccolo campione per l'analisi dell'espressione genica e l'accumulo di aflatossina in RNAi semi di arachidi. Analisi completa di espressione e di aflatossine per un gruppo di maturità (es., Di colore giallo), con tre tempi di campionamento (24, 48 e 72 ore) , in triplice copia, richiederebbe 4,5 semi, ogni numero uno nella tabella rappresenta la metà cotyledon.

Discussion

Plant-ospitante RNAi mediata silenziamento di geni patogeni fungini è stata dimostrata 27,43, tuttavia, non ci sono pubblicazioni che mostrano la fattibilità del controllo RNAi mediata di accumulo di micotossine nelle piante. Un fattore limitante per questi studi arachidi era la mancanza di un metodo per valutare un non-aflatossina accumulo fenotipo in singole piante, come foglie mostrano sintomi upon infezione fungina di baccelli sotterranee. Inoltre, l'accumulo non-normalmente distribuita di aflatossine, e la necessità di grandi campioni per l'analisi chimica 15,16 hanno ostacolato la quantificazione del potenziale effetto RNAi su un singolo impianto. Il metodo presentato qui è composto da 72 esperimenti hr con cinque semi di eseguire tre prelievi 24 ore di divisione, in triplice copia (Tabella 1, Figura 7). Rispetto alla tipica analisi aflatossine che richiede non meno di 100 g di semi, il nostro metodo è particolarmente adatto per individuaeventi l transgenici di piante di arachidi che inizialmente producono non più di due o tre baccelli.

RNA-mediata silenziamento di sintesi aflatossina è stata dimostrata da geneticamente trasformando Aspergillus flavus e A. parasiticus. Poiché AFLR è un regolatore principale della produzione di aflatossine in A. flavus e A. parasiticus 44,45, diventa un bersaglio interessante per silenziamento dell'RNA mediata nelle piante. Tuttavia, le variazioni genetiche in AFLR hanno dimostrato tra specie Aspergillus 46, e le varianti genetiche potrebbero sfuggire silenziamento se non c'è una sequenza perfetta corrispondenza con il segnale RNAi prodotto nella pianta ospite. Così, AFLR è stato uno dei bersagli per tacere nel vettore p5XCAPD, ma non fu l'unico. Ripetizioni invertite del gene AFLR introdotte A. flavus e A. parasiticus da trasformazione ha provocato tacere e minimi o nessun prodottoioni di aflatossine 47 (McDonald et al., 2005b). Inoltre, mettendo a tacere gene Afld impedito la produzione di aflatossina fino al 98% in A. flavus e A. parasiticus in trasformazione diretta 48. Per aumentare la probabilità di successo nel nostro sistema, arachidi è stato trasformato con frammenti ripetere invertite di cinque geni coinvolti nella produzione di aflatossine in A. flavus. Qui è dimostrato che utilizzando p5XCAPD che gli obiettivi per il silenziamento diversi geni in via di sintesi aflatossina, il 90% più bassi -100% i livelli di aflatossina B 1 e B 2 sono stati raggiunti in linea 288-72, e livelli inferiori 60-100% accumulato in Linea 288-74 rispetto al controllo, quando cotiledoni metà sono stati inoculati con A. flavus, Figure 4, 7. Ancora più importante, questo metodo ha rilevato differenze statisticamente significative nella accumulo di aflatossina di linee 288-72, 288-74 contro il controllo di tutto l'esperimento, applicando statis parametricatic, Figura 7. Data la piccola dimensione del campione, è importante sottolineare la necessità di utilizzare un metodo efficace per rilevare aflatossine, questi esperimenti sono stati analizzati da UPLC che ha una alta risoluzione, cinque volte maggiori prestazioni e sensibilità tre volte superiore HPLC 49.

L'espressione della RNAi inserto 288-74 è stato rilevato solo in cotiledoni immaturi (giallo) a 24 ore di incubazione. L'inserto RNAi non è stato rilevato mediante RT-PCR su cotiledoni maturi 288-74 a 24 ore, o in qualsiasi gruppo maturità a 48 ore, la Figura 6. Lo stesso fenomeno è stato osservato in altre linee di arachidi transgeniche RNAi (Arias, RS, 2015 inedito), dove di solito trascrizioni RNAi sono stati rilevati solo sulla cotiledoni immaturi a 24 ore. Campioni di RNA sono stati trattati con DNasi prima sintesi di cDNA, i dati sono stati normalizzati al livello di espressione Actina e nessuna evidenza di contaminazione del DNA è stata osservata. Nel caso del DNA sono stati presenti nei campioni, dovrebbesono stati rilevati nei campioni hr 48 pure, ma sempre che non era il caso. Espressione sotto il controllo del promotore 35S-non è sempre uniforme; può essere influenzata dalle condizioni ambientali 50, tipo di tessuto e stadio di sviluppo 51,52. Allo stesso tempo, nel percorso di interferenza RNA, il tasso di degradazione dell'mRNA e il tasso di decadimento siRNA possono variare significativamente 53. È possibile che la rapida degradazione dell'mRNA dal meccanismo di interferenza RNA avrebbe potuto evitare rilevamento mRNA a 48 ore di incubazione. Se l'assenza di espressione di 48 ore è stato a causa delle basse 35S-promotore guidato la trascrizione, o di veloce degrado di dsRNA da Dicer rimane da risolvere. Pertanto, l'individuazione di piccoli RNA di alta sequenziamento rendimento darebbe una migliore conoscenza sui processi che avvengono attraverso RNAi 54 in questi esperimenti. Tuttavia, dato che il silenziamento dell'RNA si diffonde per via sistemica, principalmente attraverso il floema da photosyntodiare fonti di saccarosio pozzi (in questo caso i semi di arachidi) 55, il silenziamento di aflatossina sintesi può verificarsi in semi senza espressione locale del RNAi dell'inserto. Molta ricerca resta da fare per determinare il livello di soglia di piccoli RNA interferenti (siRNA) necessari per evitare l'accumulo di aflatossine nei semi. È importante sottolineare il fatto che sia, l'espressione dell'mRNA del RNAi costrutto (Figura 6), e l'accumulo di aflatossine B 1 e B 2 (figura 7) ha mostrato risultati diversi per immaturi (giallo) vs. maturo (marrone) cotiledoni. Piante di arachidi hanno una crescita indeterminata, cioè, essi presentano alla raccolta una serie di baccelli scadenza, figura 2. Inoltre, i semi di diversi gruppi di maturità differiscono nella loro composizione chimica, per es., 2,4% di saccarosio nei semi immaturi, e 1,9% in semi maturi sotto lo stesso condizioni di campo 56,57. Così, per capire la reale efficiency del controllo RNA-mediata di accumulazione aflatossina, è importante analizzare i gruppi di maturità separatamente.

Una difesa naturale di semi di arachidi è la produzione di fitoalessine, che varia nella diversità dei composti prodotti e delle loro quantità relative a seconda della scadenza dei semi e delle condizioni ambientali 58-61, ed è particolarmente elevato negli embrioni rispetto al 62 cotiledoni. Gli embrioni hanno concentrazioni significativamente più elevati di acidi nucleici, entrambi DNA e RNA che i cotiledoni (Arias RS, non pubblicati). Come semi di arachidi maturi, cambiamenti nella loro fisiologia e composizione chimica si verificano 63. Antiossidanti fenolici in forma testa di arachidi tannini condensati con attività fungistatica 64; questo è evidente anche nel colore mesocarpo che riflette le fasi di maturità, giallo al nero 35, come il suo contenuto di tannini e composti fenolici aumenta con la maturità 65. Pertanto, la presenza di testa o embrioni nell'esperimento, date le loro proprietà antimicrobiche, potrebbero hanno limitato la crescita di funghi e quindi sopravvalutato l'effetto di silenziamento RNAi, di conseguenza, sono stati rimossi. Inoltre, la rimozione di testa ed embrioni aiuta limitare le fonti di variazione nell'analisi, come la metà cotyledon che porta l'embrione avrà più fitoalessine e più contenuti di RNA.

In aggiunta alle analisi da gruppi scadenza e rimozione di testa ed embrione in questi esperimenti, è importante sottolineare qualche osservazioni: a) se i risultati sono mostrati per fino a 96 ore di incubazione, si raccomanda di usare più di 72 hr per ottenere risultati consistenti, come i semi vengono degradati da 96 ore; e b), mentre la metà cotiledoni dello stesso seme, anche se campionata a caso, non costituiscono campioni perfettamente indipendenti, RT-PCR e l'accumulo di aflatossina all'interno di eventi transgenici hanno dimostrato variazione minima tra i semi. Inoltre, un accurato conteggio delle spore fungine, il volume inoculos di 2 microlitri, e l'applicazione di spore sulla superficie di taglio dei cotiledoni evitando gocciolamento sui lati sono importanti per assicurarsi che le spore germinati sono esposti al tessuto vegetale. L'acqua / agar sulle piastre dovrebbe essere al 1,5% (w / v), agar morbido provoca deflusso di spore, come mostrato sull'ultimo telaio di figura 4 (inferiore). Dovrebbe sementi disponibilità da un particolare evento transgenico essere limitato, il campionamento può essere effettuato in duplicato anziché triplicato ottenere risultati simili (ad esempio, figura 7); tuttavia, i campioni in triplicato contribuirà a ridurre l'errore standard. L'unica limitazione di questo metodo è che richiede un sistema altamente sensibile (UPLC) per il rilevamento aflatossina / quantificazione, ma allo stesso tempo si riduce la probabilità di sovrastimare l'effetto di RNAi dovrebbe aflatossine non essere rilevato con metodi meno sensibili.

In conclusione, questo metodo offre per la prima volta un approccio affidabile per studiare laeffetto RNAi nel controllo delle aflatossine. Riducendo il tempo per un esperimento da un'intera stagione di ritaglio per meno di una settimana, questo metodo tremendamente accelerare la ricerca sulle RNAi-arachidi / Aspergillus patosistema verso la mitigazione e / o l'eliminazione di aflatossine.

Materials

Name Company Catalog Number Comments
Primers, oligonucleotides DNA Technologies, Coralville, IA, USA n/a
Dneasy Plant Mini Kit Qiagen, Valencia, CA 69106
Czapek Dox agar medium Oxoid, by Thermo Fisher Scientific, Waltham, MA CM0095
Agar Thermo Fisher Scientific, Waltham, MA BP 1423
Freezer -80 °C n/a n/a
Aluminum Oxide, Al2O3 Fisher Scientific A941
SPE Reservoirs 1.5 ml Grace Davison Discovery Scientific 210011
Frits for 1.5 ml SPE reservoir Grace Davison Discovery Scientific 211401
Autosampler vials Waters Corporation, Milford, MA 186005221
Waters Acquity Ultra-Performance Liquid-Chromatography (UPLC) instrument; UPLC-H-Class Quaternary Solvent Manager; UPLC Sample Manager; UPLC Fluorescent detector (FLR); UPLC BEH C18 2.1 mm x 50 mm, 1.7 mm column Waters Corporation, Milford, MA
Finnigan LCQ Advantage MAX ion trap mass spectrometer, with Xcalibur version 1.4 software Thermo Electron Corp., San Jose, CA
Aflatoxin standards, B1, B2, G1 and G2 Sigma-Aldrich, St. Louis, MO A6636; A9887; A0138; A0263
Systat Software 12.2 SYSTAT Software Inc., Point Richmond, CA
Trizol reagent Invitrogen, CA 15596-018
SuperScript III First Strand Synthesis Super Mix Invitrogen, CA 11752-050
ABI 7500 Real-Time PCR Lifetechnologies, Grand Island, NY 4406984
Luria Broth-Miller Fisher Scientific R453642
pENTR1A Invitrogen, CA A10462
LR Clonase II enzyme mix Invitrogen, CA 11791-020
T4 DNA Ligase NEB Biolabs M0202L
Gelrite Sigma-Aldrich, St. Louis, MO G1919
Acetosyringone Sigma-Aldrich, St. Louis, MO D134406
QIAcube robot workstation Qiagen, Valencia, CA 9001292
Antibiotics: kanamycin, cefotaxime, gentamicin; streptomycin Goldbio, St. Louis, MO cef.: C-104-25; kan: K-120-5; gent.: G-400-1; strep.: S-150-50
Platinum Taq DNA Polymerase High Fidelity Invitrogen, CA 11304-029

DOWNLOAD MATERIALS LIST

References

  1. Williams, J. H., et al. Human aflatoxicosis in developing countries: a review of toxicology, exposure, potential health consequences, and interventions. The American Journal of Clinical Nutrition. 80, 1106-1122 (2004).
  2. American Association for Cancer Research: AACR. An evaluation of chemicals and industrial processes associated with cancer in humans based on human and animal data: IARC Monographs Volumes 1 to 20. Cancer Research. 40, 1-12 (1980).
  3. Turner, P. C. The molecular epidemiology of chronic aflatoxin driven impaired child growth. Scientifica. (2013).
  4. Rasooly, R., Hernlem, B., He, X., Friedman, M. Non-linear relationships between aflatoxin B1 levels and the biological response of monkey kidney vero cells. Toxins (Basel). 5, 1447-1461 (2013).
  5. Gong, Y. Y., et al. Determinants of aflatoxin exposure in young children from Benin and Togo, West Africa: the critical role of weaning. International Journal of Epidemiology. 32, 556-562 (2003).
  6. Eaton, D. L., Groopman, J. D. The toxicology of aflatoxins: human health, veterinary, and agricultural significance. Academic Press. (1994).
  7. Murugavel, K. G., et al. Prevalence of aflatoxin B1 in liver biopsies of proven hepatocellular carcinoma in India determined by an in-house immunoperoxidase test. Journal of Medical Microbiology. 56, 1455-1459 (2007).
  8. Wang, J. S., et al. Hepatocellular carcinoma and aflatoxin exposure in Zhuqing Village, Fusui County, People's Republic of China. Cancer Epidemiology, Biomarkers & Prevention. 10, American Association for Cancer Research. 143-146 (2001).
  9. Azziz-Baumgartner, E., et al. Case-control study of an acute aflatoxicosis outbreak, Kenya, 2004. Environmental Health Perspectives. 113, 1779-1783 (2005).
  10. Lye, M. S., Ghazali, A. A., Mohan, J., Alwin, N., Nair, R. C. An outbreak of acute hepatic encephalopathy due to severe aflatoxicosis in Malaysia. American Journal of Tropical Medicine and Hygiene. 53, 68-72 (1995).
  11. Villers, P. Aflatoxins and safe storage. Frontiers in Microbiology. 5, 158 (2014).
  12. Kensler, T. W., Roebuck, B. D., Wogan, G. N., Groopman, J. D. Aflatoxin: A 50-year odyssey of mechanistic and translational toxicology. Toxicological Sciences. 120, S28-S48 (2011).
  13. Dorner, J. W., Cole, R. J., Wicklow, D. T. Aflatoxin reduction in corn through field application of competitive fungi. Journal of Food Protection. 62, 650-656 (1999).
  14. Cotty, P. J., Bhatnagar, D. Variability among atoxigenic Aspergillus flavus strains in ability to prevent aflatoxin contamination and production of aflatoxin biosynthetic-pathway enzymes. Applied and Environmental Microbiology. 60, 2248-2251 (1994).
  15. Whitaker, T. B. Standardisation of mycotoxin sampling procedures: an urgent necessity. Food Control. 14, 233-237 (2003).
  16. Whitaker, T. B., Dorner, J. W., Giesbrecht, F. G., Slate, A. B. Variability among aflatoxin test results on runner peanuts harvested from small field plots. Peanut Science. 31, 59-63 (2004).
  17. Fire, A., et al. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature. 391, 806-811 (1998).
  18. Rafael, D., et al. EMT blockage strategies: Targeting Akt dependent mechanisms for breast cancer metastatic behaviour modulation. Current Gene Therapy. (2015).
  19. Li, G., Chang, H., Zhai, Y. P., Xu, W. Targeted silencing of inhibitors of apoptosis proteins with siRNAs: a potential anti-cancer strategy for hepatocellular carcinoma. Asian Pacific. Journal of Cancer Prevention: APJCP. 14, 4943-4952 (2013).
  20. Koldehoff, M. Targeting bcr-abl transcripts with siRNAs in an imatinib-resistant chronic myeloid leukemia patient: challenges and future directions. Methods in Molecular Biology. 1218, 277-292 (2015).
  21. Zhang, J., et al. Pest control. Full crop protection from an insect pest by expression of long double-stranded RNAs in plastids. Science. 347, 991-994 (2015).
  22. Ajjappala, H., Chung, H. Y., Sim, J. S., Choi, I., Hahn, B. S. Disruption of prefoldin-2 protein synthesis in root-knot nematodes via host-mediated gene silencing efficiently reduces nematode numbers and thus protects plants. Planta. 241, 773-787 (2015).
  23. Jose, A. M., Hunter, C. P. Transport of sequence-specific RNA interference information between cells. Annual Review of Genetics. 41, 305-330 (2007).
  24. Vazquez, F., Hohn, T. Biogenesis and biological activity of secondary siRNAs in plants. Scientifica. Hindawi Publishing Corporation. (2013).
  25. Tinoco, M. L. P., Dias, B. B. A., Dall'Astta, R. C., Pamphile, J. A., Aragao, F. J. L. In vivo trans-specific gene silencing in fungal cells by in planta expression of a double-stranded RNA. BMC Biology. 8, (2010).
  26. Govindarajulu, M., Epstein, L., Wroblewski, T., Michelmore, R. W. Host-induced gene silencing inhibits the biotrophic pathogen causing downy mildew of lettuce. Plant Biotechnology Journal. (2014).
  27. Yin, C., Jurgenson, J. E., Hulbert, S. H. Development of a host-induced RNAi system in the wheat stripe rust fungus Puccinia striiformis f. sp. tritici. Molecular Plant-Microbe Interactions. 24, 554-561 (2011).
  28. Ghag, S. B., Shekhawat, U. K., Ganapathi, T. R. Host-induced post-transcriptional hairpin RNA-mediated gene silencing of vital fungal genes confers efficient resistance against Fusarium. wilt in banana. Plant Biotechnology Journal. 12, 541-553 (2014).
  29. Filichkin, S. A., et al. Efficiency of gene silencing repeats vs. transitive RNAi in Arabidopsis: direct inverted vectors. Plant Biotechnology Journal. 5, 615-626 (2007).
  30. Sciaky, D., Montoya, A. L., Chilton, M. D. Fingerprints of Agrobacterium Ti Plasmids. Plasmid. 1, 238-253 (1978).
  31. Clark, D. J., Maaloe, O. DNA Replication and Division Cycle in Escherichia coli. Journal of Molecular Biology. 23, 99-112 (1967).
  32. Murashige, T., Skoog, F. A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol Plantarum. 15, 473-497 (1962).
  33. Srinivasan, T., Kumar, K. R. R., Kirti, P. B. Establishment of efficient and rapid regeneration system for some diploid wild species of Arachis. Plant Cell Tissue and Organ Culture. 101, 303-309 (2010).
  34. Gomes, A. L. V., et al. Single-tube nested PCR using immobilized internal primers for the identification of dengue virus serotypes. Journal of Virology Methods. 145, 76-79 (2007).
  35. Williams, E. J., Drexler, J. S. A non-destructive method for determining peanut pod maturity. Peanut Science. 8, 134-141 (1981).
  36. Sobolev, V. S., Dorner, J. W. Cleanup procedure for determination of aflatoxins in major agricultural commodities by liquid chromatography. Journal of AOAC International. 85, 642-645 (2002).
  37. Empower Software, Getting Started Guide. Waters Corporation. Milford, MA. Available from: http://sites.chem.colostate.edu/diverdi/C431/experiments/high%20pressure%20liquid%20chromatography/references/Empower%20getting%20started%2071500031203rA.pdf (2002).
  38. Biselli, S., Hartig, L., Wegner, H., Hummert, C. Analysis of Fusarium. toxins using LC-MS-MS: Application to various food and feed matrices. LC GC North America. 23, 404-413 (2005).
  39. Arias, R. S., Sobolev, V. S., Orner, V. A., Dang, P. M., Lamb, M. C. Potential involvement of Aspergillus flavus laccases in peanut invasion at low water potential. Plant Pathology. 63, 353-363 (2014).
  40. Dang, P. M., Chen, C. Y., Holbrook, C. C. Evaluation of five peanut (Arachis hypogaea) genotypes to identify drought responsive mechanisms utilising candidate-gene approach. Functional Plant Biology. 40, 1323-1333 (2013).
  41. Schmittgen, T. D., Livak, K. J. Analyzing real-time PCR data by the comparative C-T method. Nature Protocols. 3, 1101-1108 (2008).
  42. Amaike, S., Keller, N. P. Aspergillus flavus. Annual Review of Phytopathology. 49, 107-133 (2011).
  43. Nowara, D., et al. HIGS: Host-induced gene silencing in the obligate biotrophic fungal pathogen Blumeria graminis. Plant Cell. 22, 3130-3141 (2010).
  44. Woloshuk, C. P., et al. Molecular characterization of aflR, a regulatory locus for aflatoxin biosynthesis. Applied and Environmental Microbiology. 60, 2408-2414 (1994).
  45. Price, M. S., et al. The aflatoxin pathway regulator AflR induces gene transcription inside and outside of the aflatoxin biosynthetic cluster. FEMS Microbiology Letters. 255, 275-279 (2006).
  46. Ehrlich, K. C., Montalbano, B. G., Cotty, P. J. Sequence comparison of aflR from different Aspergillus. species provides evidence for variability in regulation of aflatoxin production. Fungal Genetics and Biology. 38, 63-74 (2003).
  47. McDonald, T., Brown, D., Keller, N. P., Hammond, T. M. RNA silencing of mycotoxin production in Aspergillus and Fusarium species. Molecular Plant Microbe Interactions. 18, 539-545 (2005).
  48. Abdel-Hadi, A. M., Caley, D. P., Carter, D. R., Magan, N. Control of aflatoxin production of Aspergillus flavus. and Aspergillus parasiticus. using RNA silencing technology by targeting aflD. (nor-1) gene. Toxins (Basel). 3, 647-659 (2011).
  49. Swartz, M. E. Ultra performance liquid chromatography (UPLC): An introduction: Separation Science Redefined. LCGC North America. Suppl ement 8. 8-14 (2005).
  50. Maghuly, F., Khan, M. A., Fernandez, E. B., Druart, P., Watillon, B., Laimer, M. Stress regulated expression of the GUS-marker gene (uidA) under the control of plant calmodulin and viral 35S promoters in a model fruit tree rootstock: Prunus incisa x serrula. Journal of Biotechnology. 135, 105-116 (2008).
  51. de Mesa, M. C., Santiago-Doménech, N., Pliego-Alfaro, F., Quesada, M. A., Mercado, J. A. The CaMV 35S promoter is highly active on floral organs and pollen of transgenic strawberry plants. Plant Cell Reports. 23, 32-38 (2004).
  52. Sunilkumar, G., Mohr, L., Lopata-Finch, E., Emani, C., Rathore, K. S. Developmental and tissue-specific expression of CaMV 35S promoter in cotton as revealed by GFP. Plant Molecular Biology. 50, 463-474 (2002).
  53. Groenenboom, M. A. C., Maree, A. F. M., Hogeweg, P. The RNA silencing pathway: The bits and pieces that matter. PLoS Computational Biology. 1, 155-165 (2005).
  54. Zhao, D., Song, G. Q. High-throughput sequencing as an effective approach in profiling small RNAs derived from a hairpin RNA expression vector in woody plants. Plant Science: an International Journal of Experimental Plant Biology. 228, 39-47 (2014).
  55. Kamthan, A., Chauduri, A., Kamthan, M., Datta, A. Small RNAs in plants: recent development and application for crop improvement. Frontiers in Plant Science. 6, 208 (2015).
  56. Manda, A., Bodapati, P. N., Rachaputi, N. C., Wright, G., Fukai, S. Aflatoxins and their relationship with sugars in peanut (Arachis hypogaea L). 4th International Crop Science Congress, 2004, Available from: http://www.cropscience.org.au/icsc2004/poster/5/1/3/625_manda.htm (2004).
  57. Uppala, S. S. Factors affecting pre-harvest aflatoxin contamination of peanut (Arachis hypogaea L). Auburn University. (2011).
  58. Sobolev, V. S. Localized production of phytoalexins by peanut (Arachis hypogaea) kernels in response to invasion by Aspergillus species. Journal of Agricultural and Food Chemistry. 56, 1949-1954 (2008).
  59. Sobolev, V. S., Guo, B. Z., Holbrook, C. C., Lynch, R. E. Interrelationship of phytoalexin production and disease resistance in selected peanut genotypes. Journal of Agricultural and Food Chemistry. 55, 2195-2200 (2007).
  60. Sobolev, V. S., Neff, S. A., Gloer, J. B. New stilbenoids from peanut (Arachis hypogaea) seeds challenged by an Aspergillus caelatus strain. Journal of Agricultural and Food Chemistry. 57, 62-68 (2009).
  61. Dorner, J. W., Cole, R. J., Sanders, T. H., Blankenship, P. D. Interrelationship of kernel water activity, soil temperature, maturity, and phytoalexin production in preharvest aflatoxin contamination of drought-stressed peanuts. Mycopathologia. 105, 117-128 (1989).
  62. Sobolev, V. S. Production of phytoalexins in peanut (Arachis hypogaea) seed elicited by selected microorganisms. Journal of Agricultural and Food Chemistry. 61, 1850-1858 (2013).
  63. Basha, S. M. M., Cherry, J. P., Young, C. T. Changes in free amino acids, carbohydrates, and proteins of maturing seeds from various peanut (Arachis hypogaea L.) cultivars. Cereal Chemistry. 53, 586-596 (1976).
  64. Lansden, J. A. Aflatoxin inhibition and fungistasis by peanut tannins. Peanut Science. 9, 17-20 (1982).
  65. Yen, G. C., Duh, P. D., Tsai, C. L. Relationships between antioxidant activity and maturity of peanut hulls. Journal of Agricultural and Food Chemistry. 41, 67-70 (1993).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics