Name: Bottlenose Dolphin (Tursiops truncatus) Spermatozoa: Collection, Cryopreservation, and Heterologous In Vitro Fertilization (Video) | JoVE Journal
Uploaded: 2017-08-21T12:30:00.000+00:00
Duration: 11 min 42 s
Description: Learn to collect, cryopreserve, and evaluate bottlenose dolphin spermatozoa using heterologous IVF with bovine oocytes. This protocol enables assessment of sperm functionality for marine mammal reproductive research.

ai_agent_IP

ai_agent

maintenance

instantTrialDurationMinutes

isBiopharma

enableNewMyJoveSectionDesign

educationFeatures

seoMetaApi

ai_copilot_institution_blacklist

ai_chat_institution_blacklist

freeAccessWindow

ssoRoleCapture

scheduledMaintenanceBanner

joveLabsFeatures

disable_autoplay_for_bots

extended_trial_duration

5 minutes

his work was funded by the Spanish Ministry of Economy and Competitiveness (AGL2015-70140-R to D. Rizos, AGL2015-66145R to A. Gutierrez-Adan and J. F. P&#233;rez-Guti&#233;rrez) and Seneca Foundation of Murcia (Grant 20040/GERM/16 to F. Garc&#237;a-V&#225;zquez)

Ethics statement: All the experimental procedures were reviewed and approved by the Institutional Animal Care and Use Committee of the Instituto Nacional de Investigaci&#243;n y Tecnolog&#237;a Agraria y Alimentaria (INIA). All the experiments were performed in accordance to the Guide for the Care and Use of Laboratory Animals, as adopted by the Society for the Study of Reproduction, and to the Animal Welfare Act for the care of Marine Mammals.
1. Dolphin Sperm Collection and Cryopreservation
<ol>
	<li>Preparation
	<ol>
		<li>Make FERT medium (heparin- and hypotaurine-free). Prepare FERT-TALP medium supplemented with 25 mM bicarbonate, 22 mM sodium lactate, 1 mM sodium pyruvate, 6-mg/mL fatty acid-free BSA, and 10 mg/mL heparin (pH 7.4). 
		NOTE: Prepare this medium on the day of use and keep it at 38.5 &#176;C, under an atmosphere of 5% CO2, and in air with maximum humidity for at least 2 h before use.</li>
		<li>Prepare TRIS egg yolk-based buffer. Dissolve 30.28 g/L Tris, 16.75 g/L citric acid, 12.5 g/L fructose, and 0.5 g/L streptomycin in ultrapure water (pH 7.3, osmolality = 310 mOsm/kg). Add 20% egg yolk (v/v).</li>
	</ol>
	</li>
	<li>Train a proven breeding male bottlenose dolphin to lie in dorsal recumbence near the edge of the pool for voluntary semen collection. 
	NOTE: The male dolphin should be trained over 6 months by positive reinforcement, as described previously4.</li>
	<li>Perform various tactile stimulations by gently pressing on the cranial area of the genital groove of the dolphin to elicit voluntary extrusion of the penis from the genital groove.</li>
	<li>After achieving a complete erection, direct the penis tip into a sterile container to obtain the ejaculate.</li>
	<li>Maintain the sperm sample&#160;at 37 &#176;C until the analysis. Repeat steps 1.3 and 1.4 for successive ejaculate collections, using a new propylene glass each time.</li>
	<li>Immediately after collection, determine the volume using a graduated glass cylinder previously warmed to 37 &#176;C. Evaluate the color, pH, and osmolarity (using a micro-osmometer) of the ejaculate.</li>
	<li>To evaluate the concentration of spermatozoa in the ejaculate, add 10 &#181;L of the sperm suspension to a eppendorf tube containing 90 &#181;L of distilled water. Determine the sperm concentration using a sperm counting chamber. 
	NOTE: During the evaluation, keep the rest of the ejaculate at 37 &#176;C.</li>
	<li>Evaluate the motility parameters.
	<ol>
		<li>Take 10 &#181;L of the sperm sample and place it in a pre-warmed sperm chamber.</li>
		<li>Evaluate the motility using a computer-assisted sperm analysis system, previously validated for the bottlenose dolphin, to objectively assess the sperm motility2. 
		NOTE: If necessary, dilute the sperm sample with FERT medium (heparin- and hypotaurine-free) for the adequate visualization of the sperm motility. During the evaluation, maintain the sample at 37 &#176;C on a heated microscope stage.</li>
	</ol>
	</li>
	<li>Take 20 &#181;L of sperm sample and evaluate the viability and sperm morphology as previously described5.</li>
	<li>Transfer the sperm sample to a centrifuge tube. Centrifuge the sperm sample at 250 x g for 5 min. After determine the sperm concentration using a counting chamber, adjust the sperm concentration to 400 x 106 spermatozoa/mL. 
	NOTE: If necessary, dilute the pellet from the concentrated ejaculates with isolated seminal plasma from an excess volume of the same ejaculate by centrifugation (250 x g, 10 min).
	<ol>
		<li>Over the course of 5 min, slowly dilute the sperm sample 1:1 (v/v) with a TRIS egg yolk-based buffer containing 1.5% glycerol. Place the tube containing the sperm suspension at 5 &#176;C for 1 h 30 min.</li>
		<li>Perform a second dilution of the sperm suspension with a TRIS egg yolk-based buffer containing glycerol to obtain a 3% final glycerol concentration and a final concentration of 200 x 106 sperm/mL. Maintain the sperm suspension at 5 &#176;C for 10 min.</li>
	</ol>
	</li>
	<li>Load the sperm suspension into 0.25 mL straws. Heat-seal the straws. Place the straws in a rack 4.5 cm above liquid nitrogen for 10 min. Plunge the straws into the liquid nitrogen and store until evaluation.</li>
</ol>
2. Heterologous In Vitro Fertilization Using Zona Intact Bovine Oocytes
<ol>
	<li>Preparation
	<ol>
		<li>Prepare the staining solution and the mounting medium.
		<ol>
			<li>Prepare Hoechst stock solution by dissolving 1 mg of Hoechst in 1 mL of distilled water. Make 30 &#181;L aliquots and keep them in the dark at -20 &#176;C until use. Prepare staining solution by adding 25 &#181;L of Hoechst stock solution to 5 mL of phosphate-buffered saline (PBS) supplemented with 1 g/L PVA. Mix well and keep in the dark at 4 &#176;C until use.</li>
			<li>Prepare mounting medium by mixing 6.25 mL of PBS with 6.25 mL of glycerol and 6.25 &#181;L of Hoechst stock solution. Mix well and keep in the dark at 4 &#176;C until use.</li>
		</ol>
		</li>
		<li>Prepare the medium for oocyte collection and in vitro fertilization.
		<ol>
			<li>Prepare saline solution by adding 0.5 mL of gentamycin to 0.9% NaCl distilled water.</li>
			<li>Prepare the stock maturation medium by adding 10 ng/mL epidermal growth factor (EGF) and 10% fetal calf serum (FCS) to 10 mL of TCM-199. Maintain both media at 38.5 &#176;C, under an atmosphere of 5% CO2, and in air with maximum humidity for at least 2 h before use.</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Collect the ovaries at the slaughterhouse in saline solution at 33-35 &#176;C and transport them to the laboratory within 4 h from collection.</li>
	<li>Once in the laboratory, wash the ovaries three times to remove the debris and blood using saline solution previously warmed to 37 &#176;C. Maintain the ovaries in saline solution at 37 &#176;C during the process.</li>
	<li>Aspirate 2 to 8 mm follicles with an 18G needle and a 10-mL syringe. Collect the aspirated follicular fluid in 50 mL tubes.</li>
	<li>Allow the follicular fluid containing the oocytes to stand for approximately 15 min at 37 &#176;C, until the cells sediment. Remove the supernatant of the tube with a Pasteur pipette and re-suspend the pellet in PBS.</li>
	<li>Recover the cumulus-oocyte complexes (COCs) in 90 mm dishes under a stereomicroscope.</li>
	<li>Wash the COCs three times in PBS and once in maturation medium.</li>
	<li>Transfer morphologically normal COCs to 4-well dishes, each well containing 500 mL of maturation medium, in groups of 50 COCs per well. 
	NOTE: Here, three wells &#8211; one well for heterologous IVF, one control well for homologous IVF, and one well containing only matured COCs as a parthenogenetic control &#8211; were used.</li>
	<li>Incubate the COCs for 24 h at 38.5 &#176;C, under an atmosphere of 5% CO2 and in air with maximum humidity.</li>
	<li>Prepare the medium and the density gradient.
	<ol>
		<li>To prepare fertilization medium (FERT), supplement FERT-TALP medium with 25 mM bicarbonate, 22 mM sodium lactate, 1 mM sodium pyruvate, 6 mg/mL fatty acid-free BSA, and 10 mg/mL heparin. Maintain at 38.5 &#176;C, under an atmosphere of 5% CO2, and in air with maximum humidity for at least 2 h before use.</li>
		<li>Prepare the density gradient by adding 1 mL of density gradient medium to a 15-mL tube and 3 mL of washing solution to a 15-mL tube. Maintain them at 38.5 &#176;C for at least 1 h.</li>
	</ol>
	</li>
	<li>Wash the in vitro matured oocytes twice in FERT medium.</li>
	<li>Transfer the oocytes to 4-well dishes, each well containing 50 COCs in 250 mL of FERT. Maintain the 4-well dishes at 38.5 &#176;C, under an atmosphere of 5% CO2, and in air with maximum humidity while preparing the sperm for fertilization.</li>
	<li>Thaw a frozen straw containing dolphin spermatozoa in a water bath at 37 &#176;C for 50 s. 
	NOTE: Bovine semen for homologous IVF must be processed in parallel, following the standard protocol for homologous bovine IVF.</li>
	<li>Take 10 &#181;L of the sperm sample and place it in a pre-warmed sperm counting chamber. Evaluate the motility using a computer-assisted sperm analysis system, previously validated for the species, to objectively assess the sperm motility. During this time, maintain the sperm sample at 38.5 &#176;C.</li>
	<li>Add the sperm sample to the density gradient tube (step 2.10.2). Centrifuge for 10 min at 250 x g.</li>
	<li>Carefully remove the supernatant using a Pasteur pipette. Add 3 mL of the washing solution to the tube containing the pellet. Re-suspend the pellet by gently mixing.</li>
	<li>Centrifuge for 5 min at 250 x g. Remove the supernatant with a Pasteur pipette to a sperm volume of 300 &#181;L.</li>
	<li>Add 5 &#181;L of the sperm suspension to a microcentrifuge containing 95 &#181;L of distilled water. Maintain the sperm suspension at 38.5 &#176;C. Fill the cell counting chamber with 10 &#181;L of the 1:20 sperm dilution and measure the concentration. Calculate the amount of FERT medium that must be added to 100 &#181;L of the sperm to obtain 2 x 106 spermatozoa/mL.</li>
	<li>Add the calculated FERT and sperm volume to a 15-mL tube and gently mix using a Pasteur pipette.</li>
	<li>Add 250 &#181;L of the sperm-FERT suspension to each well of the 4-well dish containing the FERT medium with the matured oocytes to obtain a final concentration of 1 x 106 spermatozoa/mL.</li>
	<li>Co-incubate the gametes for 18 h at 38.5 &#176;C, under an atmosphere of 5% CO2, and in air with maximum humidity.</li>
	<li>Prepare the culture medium based on the synthetic oviductal fluid supplemented with 5% FCS. Prepare 25 &#181;L of synthetic oviductal fluid culture droplets in 35-mm dishes covered with 3 mL of mineral oil. Maintain at 38.5 &#176;C, under an atmosphere of 5% CO2, and in air with maximum humidity for at least 2 h before use.</li>
	<li>At 2.5 h post co-incubation, remove 20 oocytes from the dish; maintain the remaining oocytes in the incubator under the same conditions.
	<ol>
		<li>Remove the loosely attached&#160;spermatozoa by vigorously pipetting half of the oocytes through a narrow-bore Pasteur pipette 10 times.</li>
		<li>Fix the 20 oocytes in 50 &#181;L of 0.5% glutaraldehyde for 30 min. Wash the oocytes in PBS for 5 min. Transfer the oocytes to 50-&#181;L of Hoechst staining solution for 15 min and wash the oocytes in PBS for 5 min.</li>
		<li>Transfer the oocytes individually to 2 &#181;L droplets of mounting medium at a rate of 10 oocytes per slide. Gently cover with a coverslip and seal with nail polish.</li>
		<li>Count the number of spermatozoa attached to the bovine oocytes using a phase-contrast microscope equipped with epifluorescent optics and a 361 nm excitation filter at 40x magnification.</li>
	</ol>
	</li>
	<li>After 12 h of co-incubation, remove 10 presumptive zygotes from the 4-well dishes; maintain the remaining presumptive zygotes in the incubator under the same conditions.
	<ol>
		<li>Transfer the 10 presumptive zygotes to a 15-mL centrifuge tube containing 2 mL of PBS and vortex gently for 2 min to remove the cumulus cells. Wash twice in PBS, fix, and stain, as previously described (step 2.23.2.)</li>
	</ol>
	</li>
	<li>After 18, 20, 22, and 24 h of co-incubation, remove 10 presumptive zygotes from the 4-well dishes and vortex, fix, and stain them as previously described (step 2.23.2). Maintain the rest of presumptive zygotes in the incubator under the same conditions.
	<ol>
		<li>Evaluate pronuclear formation and polyspermy under a phase-contrast/epifluorescent microscope in both the homologous and heterologous IVF groups by staining with Hoechst.</li>
		<li>Evaluate pronuclear formation in 10 randomly chosen presumptive hybrid zygotes per sample. Confirm pronuclear formation under a confocal laser scanning microscope at 488-nm argon laser excitation and 515 to 530 nm detection.</li>
		<li>Optically section presumptive zygotes sequentially (2 mm) and collect images using an imaging software. Visualize using a 3D analysis software package.</li>
		<li>After 24 h of co-incubation, wash 50 presumptive zygotes four times in PBS and twice in culture medium.</li>
	</ol>
	</li>
	<li>Transfer them in groups of 25 to microdroplets of culture medium previously prepared and equilibrated.</li>
	<li>Maintain at 38.5 &#176;C under an atmosphere of 5% O2/5% CO2 and in air with maximum humidity.</li>
	<li>After 26 and 28 h of co-incubation, remove 10 presumptive zygotes from the dishes and vortex, fix, and stain them, as previously described (step 2.23.2).</li>
	<li>After 48 h of culture, observe the cleavage under a stereomicroscope.</li>
	<li>Remove the zona pellucida (ZP) by transferring the embryos to a 5 mg/mL protease solution.</li>
	<li>Individually wash each embryo three times in PBS. Snap-freeze them in liquid nitrogen in 0.2 mL microcentrifuge tubes. Store them at -80 &#176;C until analysis.</li>
</ol>
3. PCR
<ol>
	<li>Materials and Reagents 
	NOTE: The reagents, materials, and equipment used to perform the PCR protocol are detailed in the Table of Materials and include a PCR tube rack and a set of micropipettes (P2, P20, P200, P1000), 1.5 mL microcentrifuge tubes, PCR tubes and caps, a thermal cycler, a UV illuminator, agarose gel, and buffer (Tris Borate EDTA (TBE)).
	<ol>
		<li>Gently thaw all reagents on ice. Maintain them in ice throughout the experiment. Use deoxynucleotides (dNTPs; dATP, dCTP, dTTP and dGTP), target primers on the reference gene coding for the dolphin 18 S ribosomal protein (DQ404537.1); R1: TTGGACACACCCACGGTGCGG and F2: CAGAAGGACGTGAAGGATGGA), DNA polymerase, 5X buffer for the DNA polymerase, DNA template, sterile water, and magnesium chloride (MgCl2 at a final concentration of 5.0 mM).</li>
		<li>Agarose gel and sample preparation.
		<ol>
			<li>Prepare dolphin and bovine sperm DNA samples.
			<ol>
				<li>Thaw a frozen straw of each species in a water bath at 37 &#176;C for 50 s. Add 3 mL of washing solution. Centrifuge at 250 x g for 10 min. Remove the supernatant. Add 30 &#181;L of STES lysis buffer (50 mM Tris-HCl, pH 8; 20 mM NaCl; and 1 mM 0.1% SDS), 2 &#181;L of proteinase K (20 mg/mL), and 5 &#181;L of dithiothreitol (DTT); final concentration: 150 mM. Maintain overnight at 55 &#176;C. Add 200 &#181;L of ultrapure water. Centrifuge at 250 x g for 5 min. Keep the supernatant. Measure the DNA concentration using a spectrophotometer.</li>
			</ol>
			</li>
			<li>Perform serial dilutions of DNA from dolphin spermatozoa (i.e., 40, 4, and 0.4 ng/mL) with ultrapure water to check that the PCR conditions are capable of detecting a small amount of dolphin DNA.</li>
			<li>Perform serial dilutions of bovine sperm DNA (i.e., 4,000, 400, 40, and 4 ng/mL) with ultrapure water to check that the PCR conditions are capable of detecting a small amount of bovine DNA.</li>
			<li>Prepare the dolphin and bovine embryos. Thaw the embryos on ice. Add 8 &#181;L of 100 &#181;g/mL proteinase K and maintain overnight at 55 &#176;C. To stop the reaction, place the samples at 96 &#176;C for 5 min.</li>
			<li>Prepare 2% agarose gel TBE buffer and add 20 &#181;L of nucleic acid stain using standard techniques.</li>
		</ol>
		</li>
		<li>PCR preparation.
		<ol>
			<li>Label PCR tube(s): dolphin serial dilutions (40, 4, and 0.4 ng/mL), bovine serial dilutions (4,000, 400, 40, and 4 ng/mL), homologous bovine two-cell embryo, two-cell presumptive heterologous embryos, and negative control.</li>
			<li>Prepare a master mixture in a sterile 1.5-mL microcentrifuge tube to a final volume of 25 &#181;L per reaction.
			<ol>
				<li>Add 5 &#181;L of 5X DNA polymerase flexi buffer, 0.5 &#181;L of dNTPs (10 mM) 1.5 &#181;L of MgCl2 (25 mM), 0.5 &#181;L of forward and reverse primer (10 &#181;M), 1.5 &#181;L of DNA template (sperm) or 8 &#181;L of DNA template (two-cell embryos), 0.07 &#181;L of Taq polymerase, and sterile distilled water up to a 25 &#181;L final volume. Mix well.</li>
			</ol>
			</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Amplification Protocol
	<ol>
		<li>Place the tubes in the thermal cycler. Select the following program: 94 &#176;C for 3 min; 40 cycles of 94 &#176;C for 15 s, 59 &#176;C for 25 s, 72 &#176;C for 20 s; and 72 &#176;C for 5 min. Start the program.</li>
		<li>Store the tubes at 4 &#176;C. Add 2.5 &#181;L of loading buffer to each PCR product at 4 &#176;C and load 15 &#181;L of the mixture into the wells of the 2% agarose gel. Use a DNA ladder marker for the accurate size estimation of PCR fragments.</li>
		<li>Perform electrophoresis for 15 min to allow DNA migration. Visualized bands using a UV illuminator.</li>
	</ol>
	</li>
</ol>

<ol><li>Montano, G. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Evaluation+of+motility%2C+membrane+status+and+DNA+integrity+of+frozen-thawed+bottlenose+dolphin+%28Tursiops+truncatus%29+spermatozoa+after+sex-sorting+and+recryopreservation%5BTitle%5D)+AND+%22Reproduction%22%5BJournal%5D)">Evaluation of motility, membrane status and DNA integrity of frozen-thawed bottlenose dolphin (Tursiops truncatus) spermatozoa after sex-sorting and recryopreservation.</a> Reproduction. 143 (6), 799-813 (2012).</li>
<li>Sánchez-calabuig, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Validation+of+a+field+based+chromatin+dispersion+assay+to+assess+sperm+DNA+fragmentation+in+the+bottlenose+dolphin+%28Tursiops+truncatus%29%5BTitle%5D)+AND+%22Reprod+Domest+Anim%22%5BJournal%5D)">Validation of a field based chromatin dispersion assay to assess sperm DNA fragmentation in the bottlenose dolphin (Tursiops truncatus).</a> Reprod Domest Anim. 49 (5), 761-768 (2014).</li>
<li>Sánchez-calabuig, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Heterologous+murine+and+bovine+IVF+using+bottlenose+dolphin+%28Tursiops+truncatus%29+spermatozoa%5BTitle%5D)+AND+%22Theriogenology%22%5BJournal%5D)">Heterologous murine and bovine IVF using bottlenose dolphin (Tursiops truncatus) spermatozoa.</a> Theriogenology. 84 (6), 983-994 (2015).</li>
<li>Keller, K. V. <a target="_blank" href="https://books.google.com/books/about/Training_Atlantic_Bottlenose_Dolphins_Tu.html?id=RKstOAAACAAJ">Training of the Atlantic bottlenose dolphins (Tursiops truncatus) for artificial insemination.</a> IAAAM. 14 (22), 22-24 (1986).</li>
<li>Robeck, T. R., O'brien, J. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Effect+of+cryopreservation+methods+and+precryopreservation+storage+on+bottlenose+dolphin+%28Tursiops+truncatus%29+spermatozoa%5BTitle%5D)+AND+%22Biol+Reprod%22%5BJournal%5D)">Effect of cryopreservation methods and precryopreservation storage on bottlenose dolphin (Tursiops truncatus) spermatozoa.</a> Biol Reprod. 70 (5), 1340-1348 (2004).</li>
<li>Coy, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Hardening+of+the+zona+pellucida+of+unfertilized+eggs+can+reduce+polyspermic+fertilization+in+the+pig+and+cow%5BTitle%5D)+AND+%22Reproduction%22%5BJournal%5D)">Hardening of the zona pellucida of unfertilized eggs can reduce polyspermic fertilization in the pig and cow.</a> Reproduction. 135 (1), 19-27 (2008).</li>
<li>Seager, S., W, G., Moore, L., Platz, C., Kirby, V. Semen collection (electroejaculation), evaluation and freezing in the Atlantic bottlenose dolphin (Tursiops truncatus). Proceedings of the American Association of Zoo Veterinarians. 136, (1981).</li>
<li>Schroeder, J. P. Breeding Bottlenose Dolphins in captivity. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=author%3aSchroeder%2C+JP+%22The+Bottlenose+dolphin%22">The Bottlenose dolphin</a>. Leatherwood, S., Reeves, R. R. , Academic Press. San Diego. 447-460 (1990).</li>
<li>Sánchez-Calabuig, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Effect+of+cryopreservation+on+the+sperm+DNA+fragmentation+dynamics+of+the+bottlenose+dolphin+%28Tursiops+truncatus%29%5BTitle%5D)+AND+%22Reprod+Domest+Anim%22%5BJournal%5D)">Effect of cryopreservation on the sperm DNA fragmentation dynamics of the bottlenose dolphin (Tursiops truncatus).</a> Reprod Domest Anim. 50 (2), 227-235 (2015).</li>
<li>Robeck, T. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Estrous+cycle+characterisation+and+artificial+insemination+using+frozen-thawed+spermatozoa+in+the+bottlenose+dolphin+%28Tursiops+truncatus%29%5BTitle%5D)+AND+%22Reproduction%22%5BJournal%5D)">Estrous cycle characterisation and artificial insemination using frozen-thawed spermatozoa in the bottlenose dolphin (Tursiops truncatus).</a> Reproduction. 129 (5), 659-674 (2005).</li>
<li>Robeck, T. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Development+and+evaluation+of+deep+intra-uterine+artificial+insemination+using+cryopreserved+sexed+spermatozoa+in+bottlenose+dolphins+%28Tursiops+truncatus%29%5BTitle%5D)+AND+%22Anim+Reprod+Sci%22%5BJournal%5D)">Development and evaluation of deep intra-uterine artificial insemination using cryopreserved sexed spermatozoa in bottlenose dolphins (Tursiops truncatus).</a> Anim Reprod Sci. 139 (1-4), 168-181 (2013).</li>
<li>Schroeder, J. P. Breeding Bottlenose Dolphins in captivity. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=author%3aSchroeder%2C+JP+%22The+Bottlenose+dolphin%22">The Bottlenose dolphin</a>. Leatherwood, S., Reeves, R. R. , Academic Press. San Diego. 447-460 (1990).</li>
<li>Madeddu, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Effect+of+cooling+rate+on+the+survival+of+cryopreserved+rooster+sperm%3A+Comparison+of+different+distances+in+the+vapor+above+the+surface+of+the+liquid+nitrogen%5BTitle%5D)+AND+%22Anim+Reprod+Sci%22%5BJournal%5D)">Effect of cooling rate on the survival of cryopreserved rooster sperm: Comparison of different distances in the vapor above the surface of the liquid nitrogen.</a> Anim Reprod Sci. , (2016).</li>
</ol>

The authors have nothing to disclose.

For many different mammalian species, there are diverse advantages to using frozen-thawed sperm. These include the ability to transfer valuable genetic material, the potential for worldwide distribution, the low risk of contamination, and the capability to preserve male gametes for decades. The use of cryopreserved sperm is essential for the bottlenose dolphin, because this species is protected under Appendix II of CITES, which limits the transport and exchange of animals between different aquatic parks. Dolphins transpo...

Assisted reproductive technologies are poorly developed in wild animals, including marine mammals. The lack of sensitive methods to assess sperm fertilizing success contributes to the slow development of reproductive technologies in species such as dolphin. It was not until recently that the basic seminal parameters of the bottlenose dolphin (Tursiops truncatus) were reported1,2. However, variables such as motility and morphology, although widely used, give limited information on reproductive efficiency. The best indicator of sperm quality is the evaluation of the fertilizing potential.
Recently, our group used a method to assess dolphin sperm fertilizing potential by assessing male pronuclear formation and/or hybrid embryo formation after heterologous IVF using zona intact bovine oocytes3. The use of dolphin-bovine heterologous IVF has important advantages over homologous IVF, as it overcomes the difficulty of obtaining dolphin oocytes and facilitates the use of well-tested in vitro bovine oocyte maturation systems. In order to avoid species specificity, heterologous fertilization is generally performed in the absence of ZP. Although it allows for the evaluation of the ability of the acrosome-reacted spermatozoa to fuse with the vitelline membrane, it impairs the evaluation of other features related to fertilization. The procedure described uses zona intact oocytes and permits the evaluation of the following parameters: sperm zona binding and attachment, penetration, polyspermy, pronuclear formation, and hybrid embryo cleavage.
Here, we present several protocols for sperm collection, basic sperm analysis, spermatozoa freezing as well as the&#160; evaluation of&#160;the &#160;dolphin sperm functionality by assessing male pronuclear and/or hybrid embryo formation after heterologous IVF using zona intact bovine oocytes.

<table><tbody><tr><td>FERT-TALP medium</td><td>Merck</td><td></td><td></td></tr><tr><td>TCM-199</td><td>Sigma</td><td>M-4530</td><td></td></tr><tr><td>Hoechst 33342</td><td>Sigma</td><td>B-2261</td><td></td></tr><tr><td>4-well dishes</td><td>Nunc</td><td>176740</td><td></td></tr><tr><td>Density gradient BoviPure</td><td>Nidacon International</td><td>BP-100</td><td></td></tr><tr><td>Washing solution Boviwash</td><td>Nidacon International</td><td>BW-100</td><td></td></tr><tr><td>Magnesium chloride</td><td>Promega</td><td>A35 1H</td><td></td></tr><tr><td>Sterile water</td><td>Mili Q sintesis A10 Millipore</td><td>A35 1H</td><td></td></tr><tr><td>Buffer Tris Borate EDTA</td><td>Sigma</td><td>T4415</td><td></td></tr><tr><td>MB agarose</td><td>Biotools</td><td>20.012</td><td></td></tr><tr><td>5X GoTaq flexi buffer</td><td>Mili Q sintesis A10 Millipore</td><td>M 890 A</td><td></td></tr><tr><td>MB agarose</td><td>Biotools</td><td>20.012</td><td></td></tr><tr><td>Taq polymerase</td><td>Promega</td><td></td><td></td></tr><tr><td>SafeView</td><td>NBS Biologicals Ltd.</td><td>M 890 A</td><td></td></tr><tr><td>Makler counting chamber</td><td>Sefi Medical</td><td></td><td></td></tr><tr><td>Thoma chamber</td><td>Hecht-Assistant</td><td></td><td></td></tr><tr><td>pHmeter MicropH 2000</td><td>Crison Instruments</td><td></td><td></td></tr><tr><td>Osmometer Advanced micro osmometer 3300</td><td>Norwood</td><td></td><td></td></tr><tr><td>Computer assisted sperm analysis system</td><td>Projectes y Serveis R+D</td><td></td><td></td></tr><tr><td>Stereomicroscope MZ 95</td><td>Leica</td><td></td><td></td></tr><tr><td>Epifluorescent optics Eclipse Te300</td><td>Nikon</td><td></td><td></td></tr><tr><td>Confocal assistant 4.02 software</td><td>Bio-Rad</td><td>3D analysis software</td><td></td></tr><tr><td>Confocal laser scanning microscopy</td><td>Bio-Rad</td><td></td><td></td></tr><tr><td>Micropippetes (P2. P20, P200, P1000)</td><td>Gilson</td><td></td><td></td></tr><tr><td>Microcentrifuge tubes</td><td>VWR</td><td></td><td></td></tr><tr><td>UV iluminator</td><td>Bio-Rad</td><td></td><td></td></tr><tr><td>PCR Thermal cycler Primus 96 Plus</td><td>MWG AG Biotech</td><td></td><td></td></tr></tbody></table>

bottlenose dolphin (tursiops truncatus) spermatozoa: collection, cryopreservation, and heterologous in vitro fertilization

Bottlenose Dolphin (Tursiops truncatus) Spermatozoa: Collection, Cryopreservation, and Heterologous In Vitro Fertilization

The use of cryopreserved dolphin spermatozoa facilitates the exchange of genetic material between aquatic parks and makes spermatozoa accessible to laboratories for studies to further our understanding of marine mammal reproduction. Heterologous IVF, a replacement for homologous IVF, could provide a means to test the sperm fertility potential; to study gamete physiology and early embryo development; and to avoid the use of valuable dolphin oocytes, which are difficult to obtain. Here, we present protocols that have been successfully used to collect and cryopreserve dolphin spermatozoa. The collection of semen is performed by manual stimulation on trained dolphins. Cryopreservation is accomplished using a TRIS egg-yolk based extender with glycerol. In addition, we present a protocol that describes heterologous IVF using dolphin spermatozoa and bovine oocytes and that verifies the hybrid nature of the resulting embryo using PCR. Heterologous fertilization raises questions on fertilization and can be used as a tool to study gamete physiology and early embryo development. In addition, the success of heterologous IVF demonstrates the potential of this technique to test dolphin sperm fertilizing capacity, which is worth further examination.

All the results, tables, and figures (1 and 2) presented here were reproduced with permission3.
Dolphin spermatozoa have high motility after freezing and thawing
The frozen-thawed dolphin ejaculates showed percentages (% ± SD) of 84.5 ± 5.3 total motile and 69.1 ± 5.1 progressive motile spermatozoa. In motility terms, these numbers are representati...

Here, we present protocols that have been successfully used for dolphin spermatozoa collection, cryopreservation, and heterologous IVF performance using bovine oocytes.

The use of cryopreserved dolphin spermatozoa facilitates the exchange of genetic material between aquatic parks and makes spermatozoa accessible to ...

The overall goal of this technique in to assess the cryo preserved dolphin sperm functionality by the heterologous in vitro fertilization using cryo preserved dolphin spermatozoa and zona intact bovine oocytes. In this video, we will show how to collect, evaluate, and cryo preserve dolphin spermatozoa. Then we will assess sperm interaction and penetration up to zona pellucida.Male pronuclear formation and hybrid embryo cleavage. One critical issue in the development of assisted reproductive technologies is the evaluation of sperm function which is best indicated by its ability to fertilize. Homologous IVF techniques are commonly used for the evaluation of sperm function but obtaining dolphin oocyte is very difficult.The main advantage of heterologous in vitro fertilization is its simplicity. Bovine oocytes are readily obtainable and can be processed in vitro by well tested protocols. We would also demonstrate how to cryopreserve dolphin spermatozoa using liquid nitrogen vapors.A simple technique that does not require highly specialized freezing equipment. For this procedure, the male dolphin should be previously trained for six months using positive reinforcement. Let the animal lie in dorsal recumbency near the edge of the pool.There perform various tactile stimulations by gently pressing on the cranial area of the genital groove to elicit voluntary extrusion of the penis. After achieving a complete erection, direct the penis tip to a sterile container. Maintain the ejaculate at 37 degree Celsius until the analysis.As needed repeat the tactile stimulation for successive ejaculate collections using a new polypropylene glass each time. Immediately after the collection evaluate the ejaculates keeping them at 37 degree Celsius throughout. Determine the volume, color, pH, and osmolarity of the ejaculates.Then from a 10 microliter aliquot, determine the spermatozoa concentration in a counting chamber. Place the ejaculate on to one slide on a heated microscope stage at 37 degree Celsius. Using a computer assisted analysis system evaluate the sperm's motility.If necessary, dilute the sperm with fert medium for easier viewing. Next using a 20 microliter aliquot of ejaculate evaluate the sperm's viability and morphology by conventional staining with Eosin Nigrosin and Spermac. For cryopreservation, first transfer the sperm sample to a centrifuge tube.Then pellet the sperm at 250 G for five minutes. Now over the course of five minutes slowly make a 1:1 dilution of the sperm sample with trace egg yolk based buffer containing 1.5%glycerol. Then chill the sample at 5%Celsius for 1.5 hours.An hour later repeat the 1:1 dilution with the same buffer and then maintain the sperm suspension at five degree Celsius for 10 minutes. Next load the suspension into 0.25 milliliter straws and heat seal the straws. Load the straws into a rack and suspend the rack 4.5 centimeters above liquid nitrogen for 10 minutes.Then plunge the straws into the liquid nitrogen for long-term storage. For this protocol, use bovine ovaries kept warm saline collected within the last three hours. Begin by washing the ovaries three times with saline.Always keeping them at 37 degree Celsius. Next aspirate all the two millimeter to eight millimeter follicles using an 18 gauge needle and syringe. Transfer to a 50 milliliter tube and let oocytes settle for 15 minutes.Then remove the supernatant and re suspend the follicles in PBS. Recover the COCs under a stereo microscope in 90 millimeter dishes. Select grade one and two oocytes which have homogenous cytoplasm and are surrounded by at least three cumulous cell layers.Transfer these oocytes to PBS in a 35 millimeter dish. Next wash the COCs three times in PBS and once in maturation medium. Then load the COCs into four well dishes at 50 COCs and 500 milliliters of maturation medium per well then incubate the COCs for 24 hours.Once the oocytes have expanding cumulous cells they are mature. Then wash them twice in fert medium and transfer them to four well dishes in groups of 50 with 250 milliliters of fert medium per well. Now return the COCs to their incubator and prepare the sperm for fertilization.Fill a frozen straw containing dolphin spermatozoa and a straw containing bovine spermatozoa in a water bath at 37 degree Celsius for 50 seconds. Then evaluate their motility subjectively using a phase contrast microscope. Next transfer the sperm sample to a density gradient tube and centrifuge it for 10 minutes at 250 G.Carefully remove the supernatant.And add back three milliliters of the washing solution. Then re suspend the sperm with gentle mixing. Now centrifuge the tube again and remove most of the supernatant leaving the sperm in 300 microliters.Now count the sperm and adjust the concentration to two million per milliliter diluted with fert medium. Add 250 microliters of the suspension to each well of oocytes to have a final sperm concentration of one million per milliliter. Under a stereo microscope observe the expanded matured oocytes surrounded by either the motile bovine or dolphin spermatozoa which are smaller than bovine spermatozoa.Coincubate the gametes for 18 hours. To evaluate the sperm interaction with the zona pellucida, remove 20 oocytes from the dish at 2.5 hours post coincubation. Remove the loosely attached spermatozoa by vigorously pipetting through a narrow bore Pasteur pipette.Next fix and stain the oocytes with hooks to 3342. Transfer the stained oocytes individually into two microliter droplets of mounting medium and count the number of spermatozoa attached to the oocytes using a phase contrast microscope. Starting at 18 hours of coincubation transfer the 10 presumptive zygotes to a 15 milliliter centrifuge tube containing two milliliters of PBS and vortex gently for three minutes to remove the cumulous cells.Wash twice in PBS fix and stain as previously described. Additionally at 18 hours of co incubation collect 50 zygotes for culturing. Vortex them in PBS for three minutes and then wash them twice in PBS.After washing select zygotes with homogenous cytoplasm for culturing. Transfer them in groups of 25 into 25 microliter droplets of synthetic oviductal fluid supplemented with 5%fetal calf serum. Then culture the presumptive zygotes for 48 hours and evaluate their cleavage rate using a stereo microscope.Later further evaluate their genetic makeup by PCR according to the text protocol. The spermatozoa of frozen thawed dolphin ejaculates were about 85%motile and 70%progressively motile. These numbers are representative of high quality cryo preserved spermatozoa.Dolphin spermatozoa were attached to bovine zona pellucida after 2.5 hours of coincubation at a higher percentage than bovine spermatozoa. The dolphin spermatozoa were able to penetrate the zona intact bovine oocytes leading to pronuclear formation and cleavage. In the heterologous in vitro fertilization group no polyspermy was observed.Pronuclear formation reached the highest percentage at 24 hours. Pronuclear formation was quicker in the homologous group. The cleavage rate at 48 hours was lower in heterologous fertilizations than in homologous fertilizations.PCR confirmed the presence of dolphin genetic material in the hybrid embryos. Primers to the dolphin 18 s ribosome gene resulting in 190 base pair product were tested. Lanes one to 30 are dolphin bovine hybrids.Controls were dolphin DNA in the S lanes. And two cell bovine embryos in the C lanes. The protocol presented for autologous in vitro fertilization has shown that bottlenose dolphin are able to fertilize intact bovine oocytes resulting in hybrid embryos.Further development and optimization of this technique will facilitate the evaluation of dolphin sperm functionality. Cryopreservation of dolphin spermatozoa using liquid nitrogen vapors is an inexpensive rapid and simple method that yields good profound motility parameters and allows for successful heterologous in vitro fertilization. The observation that dolphin sperm are capable of fertilizing bovine oocytes opens a new space for research on the reproduction of the dolphin and other marine animals.Also raises questions about the mechanisms of fertilization that remains largely unanswered.

bottlenose-dolphin-tursiops-truncatus-spermatozoa-collection

Research

JoVE Journal

Developmental Biology

In this video-article we present a step-by-step demonstration on how to collect and cryopreserve hamster oocytes with high post-thaw survival rates. The same procedure can also be applied to successfully freeze and thaw mouse embryos at different stages of preimplantation development.

Collection and Cryopreservation of Hamster Oocytes and Mouse Embryos

This is a high-throughput sperm cryopreservation protocol for zebrafish. Sperm cryopreserved using this protocol has an average of 25% fertility in subsequent vitro fertilization and is stable over many years.

A High-Throughput Method For Zebrafish Sperm Cryopreservation and In Vitro Fertilization

An ethylene glycol-based vitrification method for mouse embryos is described. It is advantageous to other methods in its simplicity and low embryonic toxicity, and therefore can be broadly applicable to many strains of mice, including inbred and gene-modified mice.

Cryopreservation of Mouse Embryos by Ethylene Glycol-Based Vitrification

Here we demonstrate the newly developed I•Cryo kit for mouse sperm cryopreservation.  Two-cell stage embryo development with frozen-thawed sperm was improved consistently in 5 mouse strains with the use of this kit.  Over a 1.5 year period, 49 genetically modified mouse lines were archived by sperm cryopreservation with the I•Cryo kit and later successfully recovered by IVF.

Mouse Sperm Cryopreservation and Recovery using the I&middot;Cryo Kit

The zebrafish is a powerful model system for developmental biology and human disease research due to their genetic similarity with higher vertebrates. This protocol describes a methodology to create haploid zebrafish embryos that can be utilized for forward screen strategies to identify recessive mutations in genes essential for early embryogenesis.

Production of Haploid Zebrafish Embryos by In Vitro Fertilization

A modified protocol for ploidy manipulation uses a heat shock to induce a one-cycle stall in cytokinesis in the early embryo. This protocol is demonstrated in the zebrafish but may be applicable to other species.

Ploidy Manipulation of Zebrafish Embryos with Heat Shock 2 Treatment

The main purpose of this study was to adapt the needle immersed vitrification (NIV) procedure to cryopreserve whole zebrafish testes. Additionally, the repeatability of the method in five different zebrafish strains was tested.

Cryopreservation of Zebrafish Spermatogonia by Whole Testes Needle Immersed Ultra-Rapid Cooling

The present protocol describes a procedure of fish sperm assessment using computer-assisted sperm analysis and cooling devices. The software gives a rapid, accurate and quantitative analysis of fish sperm quality based on spermatozoa motility, which can be a useful tool in aquaculture to improve reproduction success.

Fish Sperm Assessment Using Software and Cooling Devices

Protocols for European eel maturation and sperm cryopreservation have been improved over the last years. This article describes the best protocol available using human chorionic gonadotropin (hCG) for inducing maturation and methanol as cryoprotectant.

Handling and Treatment of Male European Eels (Anguilla anguilla) for Hormonal Maturation and Sperm Cryopreservation

This protocol describes a semi-automated pathway to improve the efficiency and capacity of processing and cryopreservation of sperm from threatened coral species, aiming to secure genetic diversity and support reef restoration efforts.

A Semi-Automated Workflow for the Cryopreservation of Coral Sperm to Support Biobanking and Aquaculture

This protocol presents a simple microaspiration technique to isolate viable somatic cells (SCs) from cryopreserved equine semen. Unlike traditional approaches, this technique avoids long in vitro cultures and overcomes sperm contamination, enabling immediate use in somatic cell cloning.

A Simple Microaspiration Technique for Isolating Somatic Cells from Cryopreserved Equine Semen as Nuclear Donors for Cloning

Learn to collect, cryopreserve, and evaluate bottlenose dolphin spermatozoa using heterologous IVF with bovine oocytes. This protocol enables assessment of sperm functionality for marine mammal reproductive research.

Bottlenose Dolphin (Tursiops truncatus) Spermatozoa: Collection, Cryopreservation, and Heterologous In Vitro Fertilization

Explore More Videos