राइबोसोमल डीएनए के आधार पर आरएनए नमूनों में डीएनए संदूषण का आकलन

Genetics
 

Summary

यहां, हम आरएनए नमूनों में जीनोमिक डीएनए (gDNA) संदूषण के बारे में पता लगाने के लिए एक प्रोटोकॉल प्रस्तुत करते हैं । प्रस्तुत विधि राइबोसोमल डीएनए (rDNA) जीन के आंतरिक लिखित स्पेसर क्षेत्र (इसके) के लिए विशिष्ट प्राइमरों का इस्तेमाल करता है । विधि सबसे eukaryotes और prokaryotes में डीएनए संदूषण का विश्वसनीय और संवेदनशील पता लगाने के लिए अनुकूल है ।

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Hashemipetroudi, S. H., Nematzadeh, G., Ahmadian, G., Yamchi, A., Kuhlmann, M. Assessment of DNA Contamination in RNA Samples Based on Ribosomal DNA. J. Vis. Exp. (131), e55451, doi:10.3791/55451 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

एक विधि बड़े पैमाने पर जीन अभिव्यक्ति परिवर्तन और प्रतिलिपि बहुतायत के ठहराव के लिए इस्तेमाल किया रिवर्स-प्रतिलेखन मात्रात्मक वास्तविक समय पीसीआर (RT-qPCR) है । यह सटीक, संवेदनशील, विश्वसनीय और प्रतिलिपि परिणाम प्रदान करता है । कई कारकों की संवेदनशीलता और RT-qPCR की विशिष्टता को प्रभावित कर सकते हैं । अवशिष्ट जीनोमिक डीएनए (gDNA) संदूषण आरएनए नमूने उनमें से एक है । जीन अभिव्यक्ति विश्लेषण में, गैर विशिष्ट gDNA संदूषण के कारण प्रवर्धन प्रतिलिपि स्तर की बहुतायत का अनुमान लगाना होगा और RT-qPCR परिणामों को प्रभावित कर सकते हैं । आम तौर पर, gDNA qRT-पीसीआर intergenic क्षेत्रों या ब्याज की जीन के एक intron के लिए एनीलिंग प्राइमर जोड़े का उपयोग करके पता चला है । दुर्भाग्य से, intron/एक्सॉन एनोटेशन अभी तक हड्डीवाला, बैक्टीरिया, protist, कवक, संयंत्र, और invertebrate metazoan प्रजातियों से सभी जीनों के लिए नहीं जाना जाता है ।

यहां हम राइबोसोमल डीएनए (rDNA) आधारित प्राइमरों का उपयोग करके आरएनए नमूनों में gDNA संदूषण का पता लगाने के लिए एक प्रोटोकॉल प्रस्तुत करते हैं । विधि rDNA की अनूठी विशेषताओं पर आधारित है: उनके multigene प्रकृति, अत्यधिक संरक्षित दृश्यों, और जीनोम में उच्च आवृत्ति । इसके अलावा एक मामले के अध्ययन के रूप में, प्राइमरों का एक अनूठा सेट Poaceae परिवार में राइबोसोमल डीएनए (rDNA) के संरक्षण क्षेत्र के आधार पर डिजाइन किए गए थे । इन प्राइमरी जोड़े की सार्वभौमिकता पिघल वक्र विश्लेषण और agarose जेल ट्रो द्वारा परीक्षण किया गया था । हालांकि हमारे विधि बताते है कैसे rDNA आधारित प्राइमरों Poaceae परिवार में gDNA संदूषण परख के लिए लागू किया जा सकता है, यह आसानी से अंय prokaryote और यूकेरियोट प्रजातियों के लिए इस्तेमाल किया जा सकता है

Introduction

दिलचस्प जीन सेट या सिग्नलिंग नेटवर्क के transcriptional विनियमन की खोज के लिए जटिल आणविक जैविक घटनाओं में शामिल तंत्र को समझने के लिए आवश्यक है1. वर्तमान में, qPCR विश्लेषण जीन अभिव्यक्ति अध्ययन है कि या तो डीएनए (जीनोम) या आरएनए (transcriptome) जो अनुमति methylome और transcriptome विश्लेषण, क्रमशः लक्ष्य कर सकते है के लिए सबसे व्यापक रूप से इस्तेमाल किया दृष्टिकोण है । रिवर्स प्रतिलेखन (आरटी) qPCR द्वारा पीछा व्यापक रूप से transcriptome विश्लेषण के लिए प्रयोग किया जाता है कि उपाय जैविक अनुसंधान के विभिंन क्षेत्रों में जीन अभिव्यक्ति का स्तर2। पारंपरिक उत्तरी संकरण के रूप में अन्य तरीकों की तुलना में, सीटू संकरण, ribonuclease संरक्षण परख (RPA), और अर्द्ध आरटी पीसीआर, सटीकता, सुविधा, गति, और व्यापक गतिशील रेंज के माध्यम से ऊतक विशिष्ट डिटेक्शन qPCR आधारित परख अत्यधिक उल्लेखनीय है3,4। वहां कई महत्वपूर्ण कारकों है कि दूत आरएनए (mRNA) के एक विश्वसनीय ठहराव के लिए विचार किया जाना है, की गुणवत्ता और आरएनए शुरू सामग्री की मात्रा भी शामिल है । इसके अलावा, गैर विशिष्ट प्रवर्धन, आरटी की दक्षता-qPCR, और पीसीआर दक्षता के लिए5,6पर विचार किया जाना है ।

gDNA की उपस्थिति के कारण आरएनए निष्कर्षण के दौरान एक अंतर्निहित समस्या है, भाग में, डीएनए और आरएनए7के समान भौतिक और रासायनिक गुणों के लिए. gDNA और पूरक डीएनए (सीडीएनए) mRNA नमूनों से व्युत्पंन की अनुक्रम पहचान के कारण, गैर विशिष्ट प्रवर्धन हो सकता है, जो RT-qPCR परिणामों की सटीकता को प्रभावित करेगा । शेष gDNA जीन अभिव्यक्ति विश्लेषण में लक्ष्य mRNA की बहुतायत का अधिक से अधिक आकलन करने के लिए नेतृत्व करेंगे8

मूलतः, गैर विशिष्ट amplicon ज्यादातर प्राइमर से उठता है-डिमर गठन या विशिष्ट पृष्ठभूमि gDNA के कारण प्रवर्धन, दोनों जिनमें से उचित नियंत्रण नमूनों का उपयोग करके मूल्यांकन किया जा सकता है । इस तरह के नमूनों कोई टेम्पलेट नियंत्रण (एनटीसी) और कोई रिवर्स transcriptase नियंत्रण (NRT), क्रमशः कर रहे हैं । नमूनों में gDNA संदूषण के स्तर के बाद से अध्ययन किया जा रहा अलग है और gDNA की ओर संवेदनशीलता विश्लेषण के बीच बहुत भिंन है जीन, NRT नियंत्रण प्रत्येक नमूने के लिए आवश्यक/ हालांकि यह काफी लागत और RT-qPCR अध्ययन में श्रम बढ़ जाती है, इन नियंत्रणों को7,9आवश्यक हैं ।

वैकल्पिक gDNA संदूषण से निपटने के तरीकों intergenic क्षेत्रों या ब्याज की जीन के एक intron के लिए प्राइमर जोड़े एनीलिंग के उपयोग में शामिल10, और प्राइमरों के उपयोग कि या तो एक बड़ी intron पार्श्व या एक एक्सॉन-एक्सॉन जंक्शन, यानी अवधि एनीलिंग साइटें परिपक्व mRNA अनुक्रम1,4में अनुपस्थित हैं । हालांकि, intron/एक्सॉन एनोटेशन कई हड्डीवाला, बैक्टीरिया, protist, कवक, संयंत्र, और invertebrate metazoan प्रजातियों में से सभी जीनों के लिए अभी तक जाना जाता है । इसके अतिरिक्त कई युकेरियोटिक जीवों को दोहराव की घटनाओं से pseudogenes प्राप्त होती है । इसके अलावा, introns भर में प्राइमर डिजाइन गैर gDNA के प्रवर्धन की गारंटी नहीं है । DNase के लिए जीनोमिक क्षेत्रों के क्रोमेटिन पहुंच के रूप में मैं बदलता है, यह अलग से विभिंन गुणसूत्रों को लक्षित जोड़े10डिजाइन की सिफारिश की है ।

युकेरियोटिक जीवों के जीनोम ribosomes गठन के लिए आवश्यक राइबोसोमल उपइकाईयों एंकोडिंग rDNA जीन की एक हजार प्रतियां तक शामिल कर सकते हैं । इन rDNA जीन अक्सर एकल या मिलकर दोहराने arrays11में आयोजित कर रहे हैं । Polycistronic rRNAs (चित्रा 1) सहित बड़ी उपइकाई (LSU) और छोटे उपइकाई (SSU) आरएनए पोलीमरेज़ मैं (आरएनए पोल मैं) द्वारा लिखित हैं । परिणामस्वरूप पूर्व rRNAs आगे दो आंतरिक लिखित स्पेसर क्षेत्रों ITS1 और ITS2 को नष्ट करने के द्वारा संसाधित कर रहे हैं । अंतिम उत्पादों के रूप में, तीन परिपक्व rRNAs, 17-18S rRNA (SSU), 5.8 एस, और 25-28S rRNA (LSU)12उत्पंन कर रहे हैं । rDNA जीन अत्यधिक संरक्षित दृश्यों के साथ एक multigene परिवार के विशिष्ट प्रतिनिधि हैं । वे जीनोम में एक उच्च आवृत्ति के साथ होते है और संभावित रूप से एक से अधिक गुणसूत्र स्थान13पर मौजूद हैं । rRNA के प्रसंस्करण और प्रतिलिखित स्पेसर्स के क्षरण nucleolus में एक तेजी से प्रक्रिया है । दोहराव के उच्च डिग्री के कारण, कम कॉपी intron दृश्यों और ब्याह के अग्रदूतों की तुलना में जीनोमिक कॉपी संख्या और डिटेक्टिव अनप्रोसेस्ड आरएनए के अणुओं का अनुपात कम होता है । इन सुविधाओं rDNA जीन अच्छी तरह से सबसे eukaryotes और prokaryotes3में gDNA संदूषण के विश्वसनीय और अति संवेदनशील का पता लगाने के लिए अनुकूल बनाने के लिए ।

यहाँ आरएनए नमूनों में gDNA संदूषण का पता लगाने के लिए एक उपन्यास प्रक्रिया बताई गई है. rDNA संरक्षित अनुक्रम के आधार पर यूनिवर्सल प्राइमरों का एक सेट कई Poaceae प्रजातियों में gDNA परख के लिए प्रस्तुत किया है । विशिष्टता और प्रस्तावित प्राइमरों की सार्वभौमिकता पिघल वक्र विश्लेषण द्वारा परीक्षण किया गया एक टेंपलेट के रूप में डीएनए का उपयोग कर । हमारे प्रोटोकॉल केवल Poaceae के लिए लागू नहीं है, लेकिन यह भी आसानी से अंय युकेरियोटिक और prokaryotic प्रजातियों के लिए अनुकूलित किया जा सकता है ।

Protocol

नोट: किसी भी ऊतक इस्तेमाल किया जा सकता है ।

1. न्यूक्लिक एसिड निष्कर्षण

  1. एक २.० मिलीलीटर ट्यूब में ऊतक के नमूनों की १०० मिलीग्राम रखो, दो 5 मिमी स्टेनलेस स्टील के मोती जोड़ने और homogenize (homogenization अवधि और आवृत्ति ऊतक प्रकार के आधार पर) के लिए 30 एस के लिए 25-30 हर्ट्ज पर ऊतक आरएनए और डीएनए.
  2. निर्माता के निर्देशों के अनुसार कुल आरएनए को अलग करें ।
  3. निर्माता के निर्देशों के अनुसार कुल डीएनए को अलग करें ।
  4. २६० और २८० एनएम पर अवशोषक को मापने के द्वारा आरएनए नमूनों की शुद्धता और मात्रा पर नियंत्रण ।
  5. २६० और २८० एनएम पर अवशोषण को मापने के द्वारा डीएनए नमूनों की शुद्धता और मात्रा को नियंत्रित करें ।
    नोट: जबकि न्यूक्लिक एसिड २६० एनएम (A260) के एक तरंग दैर्ध्य के साथ प्रकाश को अवशोषित, तरंग दैर्ध्य २८० (A280) पर प्रकाश के अवशोषण नमूने में प्रोटीन और phenols मौजूद की मात्रा यों तो इस्तेमाल किया जा सकता है । इसलिए, A260/A280 एनएम का अनुपात एक नमूना से निकाले डीएनए और आरएनए की शुद्धता का मूल्यांकन करने के लिए इस्तेमाल किया जा सकता है । A260/१.८ ≥ की सीमा में 280 मूल्यों और > 2.0 आम तौर पर डीएनए और आरएनए के लिए "शुद्ध", क्रमशः माना जाता है । लोअर A260/280 मान प्रोटीन या कार्बनिक रसायनों द्वारा संक्रमण का संकेत हो सकता है ।
  6. ०.७% agarose जेल ट्रो चलाकर डीएनए की गुणवत्ता का परीक्षण करे । जेल तैयार और 1x TRIS-बोरिक EDTA-बफर (TBE में चलाने के लिए: ८९ मिमी TRIS, ८९ मिमी बोरिक एसिड, और 2 मिमी EDTA) में १०० वी के लिए 30 min. उच्च गुणवत्ता gDNA कम आणविक भार (LMW) अणुओं की सीमा में कोई धब्बों के साथ एक तेज, उच्च आणविक वजन (HMW) बैंड के रूप में प्रकट होता है.
  7. एक guanidine thiocyanate (गोरखा) agarose जेल ट्रो या केशिका ट्रो चिप द्वारा denaturing शर्तों के तहत मात्रा, पवित्रता, और अखंडता के लिए पृथक आरएनए की जाँच करें निर्माता के निर्देशों के अनुसार.
    1. ६० डिग्री सेल्सियस के लिए आगर ठंडा करने के बाद एक मानक 1x TBE 1% agarose जेल के लिए 5 मिमी गोरखा प्रशिक्षण को जोड़कर गोरखा जेल तैयार करें ।
      नोट: गोरखा प्रशिक्षण केंद्र विषाक्त है, इसलिए यह एक धुएं डाकू में बांटना, और उचित व्यक्तिगत सुरक्षात्मक उपकरण पहनते हैं ।
    2. आरएनए denaturing लोड हो रहा है बफर तैयार: ९५% formamide, 10 मिमी EDTA पीएच ८.०, ०.१% bromophenol नीला, ०.१% xylene cyanole, और 10 µ l ethidium ब्रोमाइड.
      नोट: Formamide और ethidium ब्रोमाइड विषाक्त कर रहे हैं, और एक धुएं डाकू में तिरस्कृत किया जाना चाहिए ।
    3. आरएनए में कुल आरएनए के 1-5 µ g लोड करें denaturing लोड हो रहा है बफर, ७० डिग्री सेल्सियस पर 5 मिनट के लिए मिश्रण गर्मी, यह एक जेल पर लोड करने से पहले बर्फ पर जगह है, और फिर ४५ मिनट के लिए १०० वी पर गोरखा प्रशिक्षण केंद्र पर अलग आरएनए. लोड डीएनए या आरएनए के साथ एक मानक के रूप में आरएनए नमूना ।
    4. ethidium ब्रोमाइड के साथ जैल दाग और पराबैंगनी प्रकाश के तहत छवि पर कब्जा प्रणालियों का उपयोग कर बैंड कल्पना । eukaryotes में, अक्षुण्ण कुल आरएनए denaturing स्थितियों में चलाने के लिए एक 2:1 तीव्रता के अनुपात के साथ कम से कम दो तेज और स्पष्ट rRNA बैंड (28S और 18S) दिखाएगा ।
  8. DNase के साथ उपचार द्वारा gDNA के निशान निकालें (DNase मैं RNase-free) । 10 µ l में एक RNase-फ्री ट्यूब जोड़ें कुल मात्रा: ०.१-1 कुल आरएनए के µ जी, DNase I की एक इकाई, और µ2के साथ 10x प्रतिक्रिया बफर के 1 MgCl एल. ३७ डिग्री सेल्सियस पर 30 मिनट के लिए मिश्रण की मशीन । 10 मिनट के लिए ६५ ° c पर ५० mM EDTA और मशीन के 1 µ एल जोड़कर प्रतिक्रिया समाप्त ।
  9. gDNA अर्क से आरएनए के निशान निकालें DNase मुक्त RNase का उपयोग कर, निर्माता के प्रोटोकॉल के अनुसार । -८० डिग्री सेल्सियस पर 1 एच. स्टोर आरएनए और डीएनए अर्क के लिए ३७ डिग्री सेल्सियस पर कुल डीएनए और मशीन के लिए RNase 10 मिलीग्राम/एमएल के 5 µ एल जोड़ें ।

2. gDNA परख के लिए rDNA क्षेत्र से प्राइमर डिजाइन

नोट: rDNA पूर्ण-लंबाई अनुक्रम में दो क्षेत्र (ITS1 और ITS2) होते हैं, जो endonucleolytic क्लीवेज की एक श्रृंखला द्वारा परिपक्व rRNA अणु में निकाले जाते हैं और फिर नीचा (figure 1).

  1. ब्याज की प्रजातियों के लिए NCBI (http://www.ncbi.nlm.nih.gov) से rDNA न्यूक्लियोटाइड अनुक्रम पुनः प्राप्त करें । डेटाबेस खोज के लिए सबसे अच्छा खोजशब्द "आंतरिक लिखित स्पेसर है."
  2. आंतरिक लिखित स्पेसर क्षेत्रों (चरमपंथ), SSU, और LSU संरक्षित क्षेत्रों को खोजने के लिए एक BLASTn खोज में लक्ष्य न्यूक्लियोटाइड अनुक्रम इनपुट.
  3. चुनें प्राइमरों कि या तो एक चरमपंथ अनुक्रम पार्श्व या कि चरमपंथ दृश्यों कि परिपक्व rRNA में मौजूद नहीं है बढ़ाना ।
    1. डिजाइनिंग प्राइमरों ITS1 या ITS2 दृश्यों के पार्श्व: ClustalW द्वारा विभिंन प्रजातियों से संरक्षित क्षेत्रों संरेखित करें । डिजाइन प्राइमर taxa विशिष्ट/AlleleID सॉफ्टवेयर के साथ पार प्रजातियों के विश्लेषण के बाद अपने पार्श्व क्षेत्र के लिए विशिष्ट । SSU-5.8 एस और 5.8 एस-LSU amplicons बढ़ाना दो प्राइमरी जोड़े क्रमशः ITS1 और ITS2 के पार्श्व क्षेत्रों के आधार पर डिजाइन किया जा सकता है । क्योंकि ये amplicons अपने क्षेत्र में फैले हुए हैं, amplicon की लम्बाई gDNA से amplicons में कम से ३०० बीपी के लिए बढ़ाई जाएगी । यह वृद्धि संवेदनशीलता को कम करती है ।
      1. पार्श्व ITS1: SSU और 5.8 s rRNA अनुक्रम का चयन करें । Poaceae के लिए चयनित प्राइमर हैं: SSU, एस एफ: CGTAACAAGGTTTCCGTAGGTG, आर: GGTTCACGGGATTCTGCAAT । यह प्राइमर जोड़ी (एस एफ: फॉरवर्ड और आर: रिवर्स) SSU के आंशिक क्षेत्र, ITS1 की पूर्ण लंबाई, और 5.8 एस rDNA के आंशिक क्षेत्र प्रवर्धक ।
      2. पार्श्व ITS2:5.8 s और LSU अनुक्रम का चयन करें । Poaceae के लिए चयनित प्राइमर हैं: एफ: ATTGCAGAATCCCGTGAACC LSU आम सहमति अनुक्रम, LR: TGCTTAAAYTCAGCGGGTAGYC । यह प्राइमरी जोड़ी 5.8 एस के आंशिक क्षेत्र को परिवर्धित, ITS2 की पूर्ण लंबाई, और LSU के आंशिक क्षेत्र (चित्रा 1) ।
        नोट: चरमपंथ पार्श्व क्षेत्र पर आधारित प्राइमरी डिजाइन के मामले में, SSU के अत्यधिक संरक्षित क्षेत्रों, 5.8 एस, और LSU की पहचान की गई । फॉरवर्ड और रिवर्स प्राइमरों के 5.8 एस rRNA फूल पौधों में एक संरक्षित आकृति के आधार पर डिजाइन किए गए थे14। आगे और रिवर्स प्राइमरों Poaceae, क्रमशः SSU और LSU संरक्षण क्षेत्रों के आधार पर डिजाइन किए गए थे । प्रत्येक प्रजाति के लिए SSU और LSU प्राइमरों का विचलन तालिका 1में दिया गया है ।
    2. एक चरमपंथ अनुक्रम बढ़ाना प्राइमर: इस प्रोटोकॉल में, डिजाइन ITS1 प्राइमरों Aeluropus इसके अनुक्रम (NCBI टैक्सी नंबर: ११०८७३) के आधार पर । प्राइमरों के लिए, का प्रयोग करें: फॉरवर्ड: GGTATGGCGTCAAGGAACACT, रिवर्स: ATAGCATCGCTGCAAGAGGT । silico मेंप्राइमरी पेयर्स द्वारा जेनरेट की गई amplicons के मुताबिक, साइज ६० से लेकर २०० बीपी तक रेंज होना चाहिए । यह भी qPCR विश्लेषण के लिए अनुशंसित आकार है ।
  4. इन सिफारिशों पर विचार करते हुए प्राइमर उठाओ: जीसी सामग्री: ४०-६०%, प्राइमरी लंबाई: 18-23 आधार, पीसीआर उत्पाद लंबाई: ६०-१६० बीपी (विशेष रूप से इसके प्राइमर के लिए), पिघलने तापमान (Tm): ६० ° c, दोनों प्राइमरों के लिए अंतिम Tm से अधिक 5 डिग्री सेल्सियस अलग नहीं है, और प्राइमर नेताओं स्वयं या साथी प्राइमरों के पूरक नहीं हैं.
  5. प्राइमरी विशिष्टता और कॉपी नंबर की जांच करें । प्राइमरी ब्लास्ट प्रोग्राम (https://www.ncbi.nlm.nih.gov/tools/primer-blast/) द्वारा चयनित प्राइमरी अनुक्रम के इन-silico विश्लेषण करते हैं ।
    1. प्राइमरी-ब्लास्ट सबमिशन पेज खोलें । फॉर्म के प्राइमरी पैरामीटर सेक्शन में दोनों प्राइमरी सीक्वेंस दर्ज करें । प्राइमरी जोड़ी विशिष्टता जांच पैरामीटर अनुभाग में, एक जीव का नाम (या जीव समूह के नाम) दर्ज करें और जीनोम डाटाबेस का चयन करें । ये सेटिंग्स लक्ष्य अनुक्रम और प्राइमर मानकों के बारे में उत्पाद की लंबाई, गुणसूत्र पर स्थिति, और कॉपी नंबर सहित विशिष्टता जानकारी देते हैं ।

3. डीएनए टेम्पलेट्स के साथ rDNA-आधारित प्राइमरों के सत्यापन के लिए qPCR कदम प्रदर्शन

नोट: डिजाइन प्राइमरों की कार्यक्षमता एक टेम्पलेट के रूप में gDNA का उपयोग कर qPCR प्रदर्शन द्वारा मान्य किया जाना चाहिए. कई समानांतर प्रतिक्रियाओं को करने और pipetting त्रुटियों को कम करने के लिए, एक मास्टर मिश्रण की तैयारी की सिफारिश की है. एक मास्टर मिश्रण के लिए, प्रतिक्रिया मिश्रण प्लस ~ 10% की कुल संख्या के बराबर एक मात्रा तैयार करते हैं ।

  1. एक पीसीआर-रिएक्शन ट्यूब में डीएनए टेम्पलेट को छोड़कर सभी प्रतिक्रिया घटकों को मिलाकर एक मास्टर मिश्रण तैयार करें । मास्टर मिश्रण तैयार करने के लिए एक प्रतिक्रिया से जरूरत के अनुसार स्केल: 5 µ एल SYBR ग्रीन (SYBR) मास्टर मिश्रण (2x), ०.३ µ एल प्राइमर (०.३ µ एम फॉरवर्ड और रिवर्स प्राइमर के प्रत्येक), और µ मुक्त पानी के साथ 10 RNase एल करने के लिए अंतिम मात्रा को समायोजित. विश्लेषण के लिए टेंपलेट gDNA के 1 µ l में लगभग ≤ २०० एनजी का प्रयोग करें ।
    नोट: गल, इकट्ठा, और सभी एजेंट, घटक रखने के लिए, और प्रतिक्रिया बर्फ पर घोला जा सकता है ।
  2. Aliquot एक ऑप्टिकल ९६-अच्छी तरह से थाली में मास्टर मिश्रण है । पिपेट 1 µ एल gDNA की एक अच्छी तरह से, और फिर यह ऑप्टिकल प्लेट सील फिल्म के साथ कवर । स्पिन और साइकिल चालक में जगह है ।
  3. निंनलिखित शर्तों के तहत एक वास्तविक समय थर्मल साइकिल चालक पर qPCR परख भागो: ९५ ° c पर 10 मिनट 15 एस के लिए ९५ ° c के ४० चक्र के बाद और ६० ° c 1 min. के लिए ६० ° c एनीलिंग/विस्तार कदम पर डेटा अधिग्रहण करते हैं ।
  4. प्रवर्धन प्रक्रिया के बाद, ५५ डिग्री सेल्सियस से ९५ डिग्री सेल्सियस तक सतत प्रतिदीप्ति माप के साथ एक पिघलने वक्र विश्लेषण करने के लिए सभी पीसीआर प्रतिक्रियाओं विषय । आम तौर पर, एक डेटा बिंदु एकत्र प्रत्येक चक्र द्वारा तापमान की एक stepwise वृद्धि के द्वारा ०.५ डिग्री सेल्सियस प्रति चक्र.
    नोट: प्रत्येक प्राइमरी जोड़ी मास्टर मिक्स के लिए कम से कम 2 गैर टेम्पलेट नियंत्रण (एनटीसी) शामिल करें । न्यूनतम तीन प्रतिकृतियों में सभी परख करते हैं ।
  5. पिघल वक्र विश्लेषण के माध्यम से प्राइमर विशिष्टता की पुष्टि करें । एकल थ्रेशोल्ड चक्र और घटाया वक्र फ़िट विधि के साथ घटता विश्लेषण ।
    नोट: एक तीव्र व्यक्तिगत चोटी की उपस्थिति एक समान व्यक्तिगत amplicon इंगित करता है । प्राइमरी डिमर उत्पाद कम तापमान पर व्यक्तिगत चोटियों के रूप में दिखाई दे सकते हैं ।
  6. agarose जेल ट्रो द्वारा प्रत्येक amplicon के आकार को मान्य.
    1. १०० मिलीलीटर TBE बफर (TBE: ८९ मिमी Tris, ८९ मिमी बोरिक एसिड, और 2 मिमी EDTA) के साथ 3 जी agarose मिश्रण से एक 3% agarose जेल तैयार करें ।
    2. डीएनए और 6x लोडिंग बफर के 1-2 µ l के साथ पीसीआर उत्पाद के 5-10 µ एल मिक्स । 3% agarose जेल पर एक डीएनए सीढ़ी के साथ पीसीआर उत्पाद लोड । १०० V में ४५ मिनट के लिए 1x TRIS-बोरिक EDTA-बफ़र में एक electrophoretic जुदाई करते हैं ।
    3. ethidium ब्रोमाइड या किसी भी अन्य intercalating एजेंट के साथ जैल दाग और पराबैंगनी प्रकाश के तहत छवि पर कब्जा सिस्टम का उपयोग कर बैंड कल्पना ।
      नोट: डीएनए intercalating एजेंटों (जैसे, ethidium ब्रोमाइड) cancerogenic है और देखभाल के साथ संभाला जाना चाहिए और अलग से तिरस्कृत । एक अद्वितीय तेज बैंड की उपस्थिति (आकार के संबंध में और बिना प्राइमर-डिमर या कृत्रिम पृष्ठभूमि प्रवर्धन) amplicon की विशिष्टता की पुष्टि करता है ।

4. आरएनए टेम्पलेट्स के साथ gDNA संदूषण परख प्रक्रिया

नोट: DNase के साथ उपचार के बाद , शुद्ध आरएनए नमूना rDNA-विशिष्ट प्राइमरों द्वारा परीक्षण किया जाता है । इन क्षेत्रों प्रवर्धन के लिए उपयोग किया जाता है जब चरमपंथ की तरह intron सुविधा के प्रसंस्करण के कारण, कोई प्रवर्धन संकेत डीएनए मुक्त आरएनए नमूनों में पता लगाया जाना चाहिए. इस के आधार पर, यदि qPCR में एक प्रवर्धन संकेत का पता चला है या agarose जेल में एक बैंड की उंमीद आकार के साथ मनाया ( silico विश्लेषण में द्वारा अनुमानित), यह gDNA संदूषण के कारण होना चाहिए । इस खंड में किया गया चरण, खंड 3 के समान हैं, सिवाय इसके कि सीडीएनए सभी नमूनों का gDNA के बजाय टेंपलेट के रूप में उपयोग किया जाता है ।

  1. एक पीसीआर-रिएक्शन ट्यूब में आरएनए टेम्पलेट को छोड़कर सभी प्रतिक्रिया घटकों को मिलाकर एक मास्टर मिश्रण तैयार करें । एक प्रतिक्रिया के लिए मास्टर मिक्स संयोजन: 5 µ एल SYBR मास्टर मिक्स (2x), ०.३ µ एल प्राइमर (०.३ µ एम फॉरवर्ड और रिवर्स प्राइमर मिश्रण के प्रत्येक), और µ मुक्त पानी के साथ 10 RNase एल को अंतिम मात्रा समायोजित करें । विश्लेषण के लिए 1 µ एल मात्रा में लगभग ५०० एनजी टेम्पलेट आरएनए का उपयोग करें ।
  2. Aliquot एक ऑप्टिकल ९६-अच्छी तरह से थाली में मास्टर मिश्रण है । पिपेट 1 µ एल आरएनए के लिए एक अच्छी तरह से, और फिर यह ऑप्टिकल प्लेट सील फिल्म द्वारा कवर । केंद्रापसारक और साइकिल चालक में जगह है ।
    नोट: प्रत्येक परख के लिए कम से कम दो एनटीसी नियंत्रण और दो सकारात्मक gDNA नियंत्रण शामिल करें । तीन तकनीकी प्रतिकृतियों में सभी परख करते हैं ।
  3. निंनलिखित शर्तों के तहत एक वास्तविक समय थर्मल साइकिल चालक पर qPCR परख भागो: ९५ ° c पर 10 मिनट 15 एस के लिए ९५ ° c के ४० चक्र के बाद और ६० ° c 1 min. के लिए ६० ° c एनीलिंग/विस्तार कदम पर डेटा अधिग्रहण करते हैं ।
  4. प्रवर्धन प्रक्रिया के बाद, ५५ डिग्री सेल्सियस से ९५ डिग्री सेल्सियस तक सतत प्रतिदीप्ति माप के साथ एक पिघलने वक्र विश्लेषण करने के लिए सभी पीसीआर प्रतिक्रियाओं विषय । आमतौर पर, एक डेटा बिंदु एकत्र प्रत्येक चक्र द्वारा तापमान की एक stepwise वृद्धि के द्वारा ०.५ डिग्री सेल्सियस प्रति चक्र.
  5. 3% agarose जेल ट्रो पर चलाकर सभी पीसीआर उत्पादों की जांच करें ।
    नोट: किसी भी बैंड या चोटी की एनटीसी प्रतिक्रिया में उपस्थिति शायद प्राइमर-डिमर गठन है कि आम तौर पर पिघलने वक्र में कम तापमान पर देखा जाता है से संबंधित है, जबकि आरएनए के नमूनों में किसी भी बैंड या चोटी की उपस्थिति gDNA संदूषण का परिणाम है । यह पहले rDNA आधारित प्राइमरों द्वारा सभी आरएनए के नमूनों का परीक्षण करने के लिए सिफारिश की है, और फिर गैर डीएनए दूषित नमूनों सीडीएनए संश्लेषण, जीन अभिव्यक्ति विश्लेषण के रूप में बहाव अनुप्रयोगों के लिए उपयोग किया जाता है, आदि

5. आरटी-सीडीएनए संश्लेषण और qPCR विश्लेषण के लिए पीसीआर कदम

  1. गल DNase-इलाज आरएनए और कमरे के तापमान पर सीडीएनए संश्लेषण रिएजेंट. गल जाने के बाद, स्पिन को रिएजेंट डाउन कर दीजिये । आरएनए के 1 µ जी जोड़ें और एक nuclease-फ्री ट्यूब में Oligo (डीटी) 18 प्राइमरी के 1 µ एल । RNase-मुक्त पानी के साथ 12 µ l की कुल मात्रा को समायोजित करें, धीरे से मिश्रण, और फिर बर्फ पर स्टोर.
  2. आरएनए के माध्यमिक संरचनाओं पिघल 5 मिनट के लिए ६५ ° c पर प्रतिक्रिया की मशीन द्वारा खाके । नीचे स्पिन और बर्फ पर शीशी शांत ।
  3. प्रतिक्रिया मास्टर मिश्रण (प्रत्येक प्रतिक्रिया के लिए अंतिम मात्रा 20 µ एल) निम्नानुसार तैयार करें: 1 µ l of रिवर्स transcriptase (२०० u/µ l), 4 µ l of reaction buffer (5x), 1 µ l की RNase अवरोध करनेवाला (20 u/µ l), और 2 µ l के dNTP मिश्रण (10 mM). धीरे से मिक्स करें और बर्फ पर शीशी को ठंडा कर लें । आरएनए युक्त तैयार ट्यूब में 19 µ एल जोड़ें ।
  4. ४२ डिग्री सेल्सियस पर ६० मिनट के लिए प्रतिक्रिया की मशीन, और फिर रिवर्स transcriptase गतिविधि समाप्त करने के लिए 5 मिनट के लिए ७० ° c पर मशीन । बर्फ पर आरटी प्रतिक्रियाओं प्लेस और नियमित qPCR प्रक्रिया द्वारा जीन अभिव्यक्ति विश्लेषण करने के लिए आगे बढ़ना (के रूप में खंड 3 और 4 में बताया गया है) ।

Representative Results

हम rDNA आधारित प्राइमरों के उपयोग के लिए पत्तियों के ऊतकों के आरएनए नमूनों में gDNA संदूषण के अभाव को मान्य करने का प्रस्ताव करते हैं. qPCR विश्लेषण और gDNA संदूषण परख का फ़्लोचार्ट चित्रा 2में दिखाया गया है । प्रस्तुत प्रोटोकॉल में, दो पूरक रणनीतियों rDNA आधारित प्राइमर डिजाइन के लिए इस्तेमाल किया गया: 1) प्रजातियों विशेष प्राइमरों चरमपंथ दृश्यों और 2 से चयनित किया गया) यूनिवर्सल प्राइमरों चरमपंथ पार्श्व क्षेत्र से चुने गए थे । सबूत की अवधारणा के लिए, हम Aeluropus littoralis, और यूनिवर्सल Poaceae प्रजातियों के आधार पर प्राइमरी के लिए विशिष्ट प्राइमरों डिजाइन, के रूप में प्रोटोकॉल में दिया । 5.8 एस आगे और रिवर्स प्राइमर एक संरक्षित 14 आधार जोड़ी (बीपी) आकृति है कि फूल पौधों, bryophytes, और शैवाल और कवक14के कई आदेश के बीच समानता से पता चलता है के आधार पर चयन किया गया । डिजाइन प्राइमरों की विशेषताएं तालिका 2में दी गई हैं । SSU की सार्वभौमिकता, 5.8 एस, और LSU प्राइमर BLASTn द्वारा जांच की गई, और प्राइमर समरूपता परिणाम एक आकृति लोगो के रूप में चित्रा 3 में प्रस्तुत कर रहे हैं । समरूपता विश्लेषण में शामिल प्रजातियों की सूची के साथ-साथ प्रत्येक प्रजाति के लिए अलग प्राइमरों को तालिका 1 में दिया गया है. प्राइमर विशिष्टता प्राइमर द्वारा जांच-ब्लास्ट था । प्रजातियों के लिए जहां पूरे जीनोम अनुक्रम उपलब्ध है, rDNA जीन के गुणसूत्र स्थान का अनुमान था । उदाहरण के लिए, धान्य sativa और Arabidopsis थालियाना में, rDNA जीन दो अलग गुणसूत्रों पर स्थित हैं, और तीन अलग गुणसूत्रों पर ज़िया mays में ।

rDNA के qPCR मांयता आधारित प्राइमरों ITS1 और ITS2 की वक्र विश्लेषण के साथ प्रदर्शन किया था पार्श्व amplicons एक टेंपलेट के रूप में डीएनए का उपयोग कर । के रूप में चित्रा 4 और चित्रा 5में प्रस्तुत किया, प्राइमर विशिष्टता सहित अलग Poaceae प्रजातियों में कोई किताब-डिमर गठन के साथ एक भी तेज चोटी के अवलोकन द्वारा पुष्टि की थी Triticum aestivum, Hordeum अश्लीलता, धान्य sativa, और इन द dicots मेडिकागोsativa, सैटाईवस कुंकुम, निकोटियाना tabacum, Trifolium alexandrinum, Vicia faba, और Arabidopsis थालियाना। electrophoretic आकार जुदाई द्वारा प्रवर्धन उत्पादों के आगे परीक्षण एक अद्वितीय बैंड दिखाया । उम्मीद के रूप में, विभिन्न प्रजातियों के नमूनों से प्राप्त बैंड आकार में विविध (चित्रा 6A और घमण्ड). दिलचस्प है, सार्वभौमिक प्राइमरों के उपयोग विशेष रूप से तीन Poaceae प्रजातियों के लिए डिजाइन अंय Poaceae प्रजातियों के लिए ही उपयोगी नहीं हैं, लेकिन यह भी ए. थालियाना के रूप में अंय प्रजातियों के पौधे के लिए, और एक endophytic कवक के लिए अर्थात् । Piriformospora इंडिका.

डिजाइन विशिष्ट प्राइमर (ITS1) की वैधता भी qPCR द्वारा टेंपलेट के रूप में gDNA का उपयोग कर . littoralis में पुष्टि की गई थी । कोई प्राइमर-डिमर गठन के साथ एक भी चोटी मनाया गया । हैरत की बात है, ए littoralis ITS1 प्राइमर (विशिष्ट प्राइमर के रूप में) न केवल ए. littoralis में एक एकल तेज बैंड उत्पंन, लेकिन यह भी निकोटियाना tabacum और Trifolium alexandrinum के अलावा परीक्षण अंय सभी प्रजातियों के लिए, जिसमें दो बैंड (फिगर 6C) का उत्पादन किया । gDNA संदूषण परख सभी आरएनए नमूनों में या तो अपने या उसके पार्श्व प्राइमर द्वारा प्रदर्शन किया गया था । gDNA संदूषण परख में प्रवर्धन प्लेट का एक योजनाबद्ध प्रतिनिधित्व, और परिणामों की व्याख्या चित्रा 7में प्रस्तुत किया जाता है ।

Figure 1
चित्रा 1: युकेरियोटिक rDNA अनुक्रम संगठन के सामांय पैटर्न ।
युकेरियोटिक rDNA सेगमेंट में 17-18S (रेड), 5.8 एस (नीला), और 25-28S rRNA (पिंक) हैं । आंतरिक लिखित स्पेसर (इसके) ब्लैक लाइंस के रूप में संकेत कर रहे हैं । 5 ´ और 3 ´ डीएनए अणु के उन्मुखीकरण का संकेत देते हैं । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 2
चित्रा 2: एक RT-qPCR और gDNA संदूषण परख के लिए कार्यप्रवाह. कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 3
चित्रा 3: ए. SSU, बी. 5.8 एस और सी. LSU प्राइमरी समरूपता का रूपांकन लोगो । SSU, 5.8 एस, और LSU प्राइमरों के लिए, रूपांकन लोगो २,००० ग्रीन प्लांट रिकॉर्ड्स (NCBI टैक्सी नंबर: ३३०९०) के आधार पर BLASTn द्वारा निर्माण किया गया था एक कट बंद ई-मूल्य ≤ 10-10के साथ । A-Adenine, T-Thymine, G-Guanine, C-Cytosine. कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 4
चित्रा 4: विभिन्न प्रजातियों में ITS1-पार्श्व amplicon के पिघल वक्र विश्लेषण ।
इस amplicon, SSU और 5.8 s-R प्राइमरों से परिलक्षित, 17-18S एंकोडिंग क्षेत्र से अनुक्रम का हिस्सा है, ITS1 और आंशिक अनुक्रम के पूरे अनुक्रम 5.8 s । दर्शाए गए हैं amplicons जनित (गुलाबी) और एनटीसी (लाल) से Triticum aestivum, Hordeum अश्लीलता, धान्य sativa, मेडिकागो truncatula, सैटाईवस कुंकुम, निकोटियाना tabacum, के पिघलने के curves Trifolium alexandrinum, Vicia faba, Arabidopsis थालियाना, आणि Piriformospora इंडिका. समतल बोल्ड पंक्ति आधार रेखा थ्रेशोल्ड इंगित करता है । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 5
चित्रा 5: विभिन्न प्रजातियों में ITS2-पार्श्व amplicon के पिघल वक्र विश्लेषण ।
यह amplicon 5.8 s-F और LSU प्राइमरों के उपयोग द्वारा उत्पन्न होता है । वर्णित amplicon में ५.८ S के भाग का अनुक्रम होता है, ITS2 के पूरे अनुक्रम, और 25-28S का आंशिक अनुक्रम होता है । दखाया गया है amplicons (हरा) और एनटीसी (red) से उत्पन्न पिघले हुए curves Triticum aestivum, Hordeum अश्लीलता, धान्य sativa, मेडिकागो truncatula, सैटाईवस कुंकुम, निकोटियाना tabacum, Trifolium alexandrinum, Vicia faba, Arabidopsis थालियानाPiriformospora इंडिकाकृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 6
चित्रा 6: rDNA-आधारित पीसीआर उत्पाद का Agarose जेल विश्लेषण ।
ITS1-पार्श्वों की amplicon (क), ITS2-पार्श्वों (ख), और ITS1 (ग) ३% agarose जेल पर चलाए गए. कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 7
चित्रा 7: Intron-चरमपंथ की तरह सुविधाओं gDNA संदूषण का पता लगा सकते हैं जो प्राइमरों डिजाइन करने के लिए माना जा सकता है.
qPCR विश्लेषण में अपेक्षित आकार के साथ किसी भी चोटी या बैंड आरएनए नमूना में gDNA संदूषण संकेत मिलता है । Unk: अज्ञात नमूना, पॉस: धनात्मक नियंत्रण, एनटीसी: गैर-टेम्पलेट नियंत्रण । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

प्राइमरी जीनस टैक्सी आईडी प्रजातियों अलग प्राइमरी
ssu Arabidopsis ३७०१ kamchatica, थालियाना और lyrata -
Vicia ३९०४ villosa, अमेरिकी, unijuga, amoenane, amurensis, craccamal, छद्म orobus, multicaulis, बिही, ramuliflora और faba
Trifolium ३८९८ alexandrinum, montanum, resupinatum और re पेन -
निकोटियाना ४०८५ tabacum, benthamiana, otophora, picilla, bigelovii, palmeri, tomentosiformis, tomentosa, digluta, kawakamii, clevelandii, nesophila, solanifolia, गिलोय, debneyi, arentsii, thyrsiflora, wigandioides, undulata, glutinosa, noctiflora, petunioides, चकवड़, miersii, pauciflora, क्षीणन, acuminata, linearis, अलता, sylvestris, rustica और suaveolens -
सैटाईवस ३६५५ अंगुरिया, melo और कुंकुम CGTAACAAGGTTTCCGTAGGKG
Aeluropus ११०८७३ - कोई प्राइमरी नहीं मिला
मेडिकागो ३८७७ sativa, lupulina, pamphylica, lunata, rostrate, plicata और truncatula -
धान्य ४५९७ sativa, glumipatula, rufipogon barthii glaberrima कबरा, longistaminata, meridionalis, निवारा, meridionalis longistaminata -
Triticum ४५६४ aestivum, urartu और monococcum -
hordeum ४५१२ अश्लीलता, bulbosum, marinum, brevisubulatum और bogdanii -
lsu Arabidopsis ३७०१ petraea, थालियाना और lyrata TGCTTAAACTCAGCGGGTAATC
Vicia ३९०४ sylvatica, tetrasperma, sativa, बालों से भरपूर, sepium, parviflora, cracca, lathyroides, orobus, orobus, bithynica और faba TGCTTAAATTCAGCGGGTAGCC
Trifolium ३८९८ ढोंगी, nigrescens, resupinatum, occidentale, subterraneum, strictum, ochroleucon, glomeratum, squamosum, ornithopodioides और re पेन TGCTTAAATTCAGCGGGTAGCC
निकोटियाना ४०८५ tabacum, benthamiana, otophora, picilla, bigelovii, palmeri, tomentosiformis, tomentosa, digluta, kawakamii, clevelandii, nesophila, solanifolia, गिलोय, debneyi, arentsii, thyrsiflora, wigandioides, undulata, glutinosa, noctiflora, petunioides, चकवड़, miersii, pauciflora, क्षीणन, acuminata, linearis, अलता, sylvestris और suaveolens TGCTTAAACTCAGCGGGTAGTC
सैटाईवस ३६५५ melo, ritchiei और javanica TGCTTAAACTCAGCGGGTAGTC
Aeluropus ११०८७३ lagopoide, पुंगेंस और littoralis TGCTTAAATTCAGCGGGTAATC
मेडिकागो ३८७७ ruthenica, sativa, lupulina, अरेबिक, polymorpha और minima TGCTTAAATTCAGCGGGTAGCC
pamphylica, lunata, rostrate और plicata TGCTTAAACTCAGCGGGTAGTC
धान्य ४५९७ sativa, glumipatula, rufipogon, barthiial, glaberrima, australiensis, officinalis, australiensis, ridleyi, malampuzhaensis, alta, निवारा, rufipogon, meridionalis longistaminata TGCTTAAACTCAGCGGGTAGTC
Triticum ४५६४ aestivum, spelta, turgidum, dicoccoides, petropavlovskyi, urartu और monococcum TGCTTAAACTCAGCGGGTAGTC
hordeum ४५१२ अभद्र, bulbosum, murinum, secalinum, brevisubulatum और bogdanii TGCTTAAACTCAGCGGGTAGTC
एक पतित प्राइमर न्यूक्लियोटाइड नामकरण के लिए आईयूपीएसी प्रणाली के रूप में परिभाषित किया गया है

तालिका 1: rDNA-आधारित प्राइमरों उठा के लिए माना जाता प्रजातियों की सूची ।
LSU बंधन साइट की तुलना में SSU बंधन साइट दिया जीनस पर उच्च अनुक्रम समरूपता दिखाया ।

Amplicon तिची प्रवर्धन क्षेत्र अनुक्रम प्राइमरी का नाम Amplicon
३३२-४०५ bp SSU के आंशिक अनुक्रम, ITS1 के पूरे अनुक्रम और आंशिक अनुक्रम के 5.8 s CGTAACAAGGTTTCCGTAGGTG ssu ITS1-पार्श्वों
GGTTCACGGGATTCTGCAAT 5.8 एस-आर
३१८-३६१ bp आंशिक अनुक्रम के 5.8 s, ITS2 और LSU के आंशिक अनुक्रम के पूरे अनुक्रम ATTGCAGAATCCCGTGAACC 5.8 एस-एफ ITS2-पार्श्वों
TGCTTAAAYTCAGCGGGTAGYC lsu
१००-२०० bp ITS1 GGTATGGCGTCAAGGAACACT ITS1-च ITS1
ATAGCATCGCTGCAAGAGGT ITS1-R

तालिका 2: प्राइमरी जुगाड़ ।

Discussion

मात्रात्मक द्वारा जीन अभिव्यक्ति विश्लेषण पीसीआर हाल के वर्षों में व्यापक रूप से लागू किया गया है । इस तेजी से, लागत प्रभावी, और स्वचालित विधि का मुख्य लाभ इसका सटीक और सटीक परिणाम है । हालांकि, इन फायदों से इष्टतम लाभ प्राप्त करने qPCR प्रयोग के लिए इस्तेमाल किया मापदंडों के सेटअप की स्पष्ट समझ की आवश्यकता है । qPCR जीन अभिव्यक्ति विश्लेषण में एक विश्वसनीय परिणाम प्राप्त करने के लिए, यह आरएनए नमूना3,15में प्राइमरी-डिमर या gDNA संदूषण से उत्पन्न होने वाले विशिष्ट प्रवर्धन से बचने के लिए आवश्यक है. यह आशा की जाती है कि आरएनए प्रतिलिपि स्तरों को gDNA प्रदूषित8के तहत आंका जाएगा । यहां, एक rDNA जीन की अनूठी विशेषताओं आरएनए नमूनों में एक gDNA संदूषण परख के लिए माना जाता था ।

इस प्रोटोकॉल में उपयोग किए गए rDNA के मूल गुण: राइबोसोमल जीन दो चरमपंथ, अर्थात् ITS1 और ITS2, और तीन rRNA एंकोडिंग जीन, 17-18S, 5.8 एस, और 25-28S उपइकाई12से मिलकर बनता है । दो अपने क्षेत्रों राइबोसोमल उपइकाइयों के कोडिंग अनुक्रम का हिस्सा नहीं हैं । एक endonuclease, helicase, और exonuclease गतिविधि: वे कम से कम तीन एंजाइमी गतिविधियों से हटा रहे है करने के लिए अग्रदूत साबित परिपक्व rRNA के लिए प्रक्रिया । के रूप में राइबोसोमल आरएनए एक polycistronic प्रतिलिपि के रूप में लिखित है, एक प्राथमिक चरमपंथ युक्त उत्पाद निश्चित रूप से मौजूद है । प्रसंस्करण बहुत तेजी से होता है और nucleolus में जगह लेता है, और qPCR विधि का पता लगाने की सीमा के नीचे है कि इसकी पहचान करने वाले अग्रदूत साबित अणुओं की मात्रा । इसलिए, जब ITS1 या ITS2 अपनी पार्श्व प्राइमरों से परिलक्षित कर रहे हैं, कोई प्रवर्धन आरएनए नमूनों में पता लगाया जा सकता है जब तक gDNA संदूषण मौजूद नहीं है । युकेरियोटिक जीवों के जीनोम में rDNA जीन की संख्या को एक हजार प्रतियों तक शामिल करने का अनुमान था, जो गुणसूत्रों पर एकल या मिलकर सरणियों की व्यवस्था कर रहे हैं11. इस प्रोटोकॉल में, हम एक वैकल्पिक रास्ते का प्रस्ताव, NRT के बजाय, gDNA संदूषण का पता लगाने के लिए, जो प्रत्येक प्रतिक्रिया में प्रयोग किया जाता है/

मौजूदा पद्धतियों के संबंध में लाभ और सीमाएं: NRT आम तौर पर तैयार आरएनए नमूना साफ है या gDNA द्वारा दूषित है कि क्या परीक्षण करने के लिए प्रयोग किया जाता है. चूंकि gDNA प्रदूषित अलग आरएनए नमूनों के बीच समान रूप से वितरित नहीं किया जाता है, और gDNA के प्रति प्रतिक्रिया संवेदनशीलता काफी विश्लेषण जीन द्वारा प्रभावित है, NRT नियंत्रण प्रत्येक नमूने के लिए आवश्यक हैं/ यह काफी लागत और परिश्रम जब कई नमूनों को एक साथ3,9हैंडलिंग जोड़ देगा । अंय वैकल्पिक साहित्य में प्रलेखित तरीकों gDNA का पता लगाने के लिए intron विशिष्ट प्राइमरों के उपयोग, या डिजाइनिंग प्राइमरों कि या तो एक intron पार्श्व या एक एक्सॉन-एक्सॉन जंक्शन अवधि शामिल हैं । इन तरीकों की सीमाएं intron अनुक्रम जानकारी की अनुपलब्धता से स्टेम, intron/एक्सॉन संरचना की अपूर्ण एनोटेशन, और जीन या ब्याज की pseudogenes में introns के अभाव में1,4,10 . विकास के कारण, rDNA जीन multigene और उच्च संरक्षित जीन परिवारों के रूप में मौजूद हैं । वे जीनोम में अत्यधिक प्रचुर मात्रा में और विभिंन गुणसूत्रों पर मौजूद है13। अंय कोडिंग या nonconding जीन की तुलना में, rDNA जीन gDNA संदूषण का पता लगाने के लिए सबसे अच्छा फिट दिखाते हैं । तुलनात्मक transcriptomic विश्लेषणों में, rRNA औजार द्वारा qPCR डेटा का सामान्यीकरण कुछ मुद्दों के लिए अनुशंसित नहीं है, जैसे सीडीएनए तैयारी में अंतर (polyA भड़काना बनाम यादृच्छिक hexamer भड़काना), rRNA और mRNA के बीच बहुतायत में बड़े अंतर , और जो भ्रामक परिणाम10,16उत्पंन कर सकते है विभिंन उत्पत्ति । हालांकि, हम सिर्फ समस्याओं का उल्लेख किया है gDNA संदूषण परख के लिए एक लाभ कर रहे हैं । उदाहरण के लिए, जीनोम में उच्च लक्ष्यीकरण साइट बहुतायत के संबंध में, और विभिन्न गुणसूत्रों पर स्थानीयकरण, rDNA आधारित प्राइमरों काफी मौजूदा तरीकों की तुलना में gDNA का पता लगाने संवेदनशीलता में सुधार.

rDNA के Versality-दूसरे जीव के आधार पर: rDNA जीन एक अच्छी तरह से अध्ययन जीन परिवार ज्यादातर जीवों में पहचान कर रहे हैं । प्रस्तावित rDNA-आधारित विधि gDNA संदूषण परख के लिए एक सरल, अति संवेदनशील, और आर्थिक प्रणाली का प्रतिनिधित्व करती है जो अंय युकेरियोटिक और prokaryotic जीवों (प्रोटोकॉल 2-5) के लिए आसानी से अनुकूलित हो सकती है । एक मामले का अध्ययन के रूप में, हम यहां कुछ Poceae प्रजातियों में इस पद्धति की उपयोगिता का प्रदर्शन किया है (चित्रा 4 और चित्रा 5) । प्रयुक्त प्राइमरों अंय Poceae प्रजातियों में rDNA उपइकाईयों के अत्यधिक संरक्षित संरचना के कारण प्रजातियों के लिए स्थानांतरण की एक उच्च दर दिखाते हैं । यह समस्या और भी महत्वपूर्ण हो जाता है जब पर्याप्त जीनोमिक अनुक्रम जानकारी प्राइमर डिजाइन के लिए उपलब्ध नहीं है । इस प्रकार, एक प्रजातियों के लिए डिजाइन अपनी पार्श्व प्राइमर एक संबंधित प्रजातियों में इस्तेमाल किया जा सकता है । इसके अलावा, 5.8 s-F/आर प्राइमरों एक संरक्षित आकृति है कि सबसे फूल पौधों में उच्च समानता से पता चलता है के आधार पर उठाया गया14। हालांकि उच्च प्रवाह अनुक्रमण तकनीक स्थाई रूप से ज्ञात जीनोम की संख्या में वृद्धि, अधिकांश जीवों की एक्सॉन-intron एनोटेशन पूरा नहीं है, और इसलिए यह अक्सर एक एक्सॉन-एक्सॉन सीमा अवधि के लिए प्राइमरों डिजाइन करने के लिए संभव नहीं है । हमारे विधि बताते है कैसे rDNA आधारित प्राइमरों prokaryotes और eukaryotes के qPCR विश्लेषण में एक परख/प्राइमरी संयोजन में महंगी NRT नियंत्रण को नष्ट करने के लक्ष्य के साथ gDNA संदूषण परख के लिए लागू किया जा सकता है ।

Disclosures

लेखकों की कोई होड़ वित्तीय हितों की नहीं है ।

Acknowledgments

इस शोध को जेनेटिक एंड एग्रीकल्चरल बायोटेक्नोलॉजी इंस्टीट्यूट ऑफ Tabarestan (गाबित), साड़ी कृषि विज्ञान एवं प्राकृतिक संसाधन विश्वविद्यालय (सन्व) ने समर्थन दिया । जूनियर रिसर्च ग्रुप अजैव तनाव जीनोमिक्स को IZN (अनुशासनिक सेंटर फॉर क्रॉप प्लांट रिसर्च, हाले (Saale), जर्मनी द्वारा वित्तपोषित किया गया था । हम पांडुलिपि के महत्वपूर्ण पढ़ने के लिए Rhonda मेयेर धंयवाद ।

Materials

Name Company Catalog Number Comments
Maxima SYBR Green / ROX qPCR Master Mix (2X) Thermo Scientific K0221
TissueLyser II QIAGEN 85300
RevertAid H Minus First Strand cDNA Synthesis Kit Thermo Scientific K1631
GeneRuler 100 bp Plus DNA Ladder Thermo Scientific SM0321
96 well WHT/CLR Bio-Rad HSP9601
Microseal B film Bio-Rad MJ-0558
Low tube strip CLR Bio-Rad TLS0801
Flat cap strips Bio-Rad TCS0803
NanoDrop 2000 Peqlab ND-2000
RNaseZAP Ambion 9780
Centrifuge Eppendorf 5810 R
Agilent RNA 6000 Nano Kit Agilent Technologies 5067-1511
2100 Electrophoresis Bioanalyzer Agilent Technologies G2939AA
RNase A, DNase and Protease-free Thermo Scientific EN0531
DNase I, RNase-free Thermo Scientific EN0523
TRIZOL Reagent Ambion 15596026
CFX96 Touch Real-Time PCR Detection System BIO RAD 1855195
PCR tube, 0.2 mL, RNase-free Stratagene Z376426
Guanidine thiocyanate for molecular biology Sigma-Aldrich G9277
Agarose - Nucleic Acid Electrophoresis Sigma-Aldrich A9414
Boric Acid for molecular biology AppliChem A2940
bromophenol blue AppliChem A2331
ethidium bromide AppliChem A1151
Gel documentation system BIO RAD Gel Doc 2000

DOWNLOAD MATERIALS LIST

References

  1. Bustin, S. A., Nolan, T. Pitfalls of quantitative real-time reverse-transcription polymerase chain reaction. J Biomol Tech. 15, (3), 155-166 (2004).
  2. Gutierrez, L., Mauriat, M., Pelloux, J., Bellini, C., Van Wuytswinkel, O. Towards a systematic validation of references in real-time RT-PCR. Plant Cell. 20, (7), 1734-1735 (2008).
  3. Hashemi, S. H., Nematzadeh, G., Ahmadian, G., Yamchi, A., Kuhlmann, M. Identification and validation of Aeluropus littoralis reference genes for Quantitative Real-Time PCR Normalization. J Biol Res (Thessalon). 23, (1), 18 (2016).
  4. Bustin, S. A. Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. J. Mol. Endocrinol. 25, (2), 169-193 (2000).
  5. Andersen, C. L., Jensen, J. L., Orntoft, T. F. Normalization of real-time quantitative reverse transcription-PCR data: a model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res. 64, (15), 5245-5250 (2004).
  6. Bustin, S. A., et al. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin Chem. 55, (4), 611-622 (2009).
  7. Laurell, H., et al. Correction of RT-qPCR data for genomic DNA-derived signals with ValidPrime. Nucleic Acids Res. 40, (7), e51 (2012).
  8. Galiveti, C. R., Rozhdestvensky, T. S., Brosius, J., Lehrach, H., Konthur, Z. Application of housekeeping npcRNAs for quantitative expression analysis of human transcriptome by real-time PCR. RNA. 16, (2), 450-461 (2010).
  9. Laurell, H., et al. Correction of RT-qPCR data for genomic DNA-derived signals with ValidPrime. Nucleic Acids Res. 40, e51 (2012).
  10. Caldana, C., Scheible, W. R., Mueller-Roeber, B., Ruzicic, S. A quantitative RT-PCR platform for high-throughput expression profiling of 2500 rice transcription factors. Plant Methods. 3, (1), 7 (2007).
  11. Lawrence, R. J., Pikaard, C. S. Perspectives Chromatin Turn Ons and Turn Offs of Ribosomal RNA Genes. Cell Cycle. 3, (7), 880 (2004).
  12. Boisvert, F. M., van Koningsbruggen, S., Navascues, J., Lamond, A. I. The multifunctional nucleolus. Nat Rev Mol Cell Biol. 8, (7), 574-585 (2007).
  13. Alvarez, I., Wendel, J. F. Ribosomal ITS sequences and plant phylogenetic inference. Mol Phylogenet Evol. 29, (3), 417-434 (2003).
  14. Jobes, D. V., Thien, L. B. A conserved motif in the 5.8 S ribosomal RNA (rRNA) gene is a useful diagnostic marker for plant internal transcribed spacer (ITS) sequences. Plant Mol Biol Report. 15, (4), 326-334 (1997).
  15. Padhi, B. K., Singh, M., Huang, N., Pelletier, G. A PCR-based approach to assess genomic DNA contamination in RNA: Application to rat RNA samples. Anal Biochem. 494, 49-51 (2016).
  16. Dheda, K., et al. Validation of housekeeping genes for normalizing RNA expression in real-time PCR. Biotechniques. 37, (1), 112-114 (2004).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics