Name: Identification of Footprints of RNA:Protein Complexes via RNA Immunoprecipitation in Tandem Followed by Sequencing (RIPiT-Seq) (Video) | JoVE Journal
Uploaded: 2019-07-10T14:30:00.000+00:00
Duration: 9 min 26 s
Description: Learn RIPiT-Seq to identify RNA footprints bound by RNA binding proteins in mammalian cells. This UV-crosslinking independent method enriches distinct RNA:protein complexes for studying disease-linked proteins.

ai_agent_IP

ai_agent

maintenance

instantTrialDurationMinutes

isBiopharma

enableNewMyJoveSectionDesign

educationFeatures

seoMetaApi

ai_copilot_institution_blacklist

ai_chat_institution_blacklist

freeAccessWindow

ssoRoleCapture

scheduledMaintenanceBanner

joveLabsFeatures

disable_autoplay_for_bots

extended_trial_duration

5 minutes

This work was supported by the NIH grant GM120209 (GS). The authors thank the OSUCCC Genomics Shared Resources Core for their services (CCC Support Grant NCI P30 CA16058).

<ol><li>Karousis, E. D., Nasif, S., Mühlemann, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Nonsense-mediated+mRNA+decay%3A+novel+mechanistic+insights+and+biological+impact%5BTitle%5D)+AND+%22Wiley+Interdisciplinary+Reviews%3A+RNA%22%5BJournal%5D)">Nonsense-mediated mRNA decay: novel mechanistic insights and biological impact.</a> Wiley Interdisciplinary Reviews: RNA. 7 (5), 661-682 (2016).</li>
<li>Ivanov, P. V., Gehring, N. H., Kunz, J. B., Hentze, M. W., Kulozik, A. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Interactions+between+UPF1%2C+eRFs%2C+PABP+and+the+exon+junction+complex+suggest+an+integrated+model+for+mammalian+NMD+pathways%5BTitle%5D)+AND+%22The+EMBO+Journal%22%5BJournal%5D)">Interactions between UPF1, eRFs, PABP and the exon junction complex suggest an integrated model for mammalian NMD pathways.</a> The EMBO Journal. 27 (5), 736-747 (2008).</li>
<li>Papasaikas, P., Valcárcel, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+Spliceosome%3A+The+Ultimate+RNA+Chaperone+and+Sculptor%5BTitle%5D)+AND+%22Trends+in+Biochemical+Sciences%22%5BJournal%5D)">The Spliceosome: The Ultimate RNA Chaperone and Sculptor.</a> Trends in Biochemical Sciences. 41 (1), 33-45 (2016).</li>
<li>Jensen, K. B., Darnell, R. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CLIP%3A+Crosslinking+and+ImmunoPrecipitation+of+In+Vivo+RNA+Targets+of+RNA-Binding+Proteins%5BTitle%5D)+AND+%22Methods+in+Molecular+Biology%22%5BJournal%5D)">CLIP: Crosslinking and ImmunoPrecipitation of In Vivo RNA Targets of RNA-Binding Proteins.</a> Methods in Molecular Biology. 488, Clifton, N.J. 85-98 (2008).</li>
<li>Garzia, A., Morozov, P., Sajek, M., Meyer, C., Tuschl, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((PAR-CLIP+for+Discovering+Target+Sites+of+RNA-Binding+Proteins%5BTitle%5D)+AND+%22mRNA+Decay%3A+Methods+and+Protocols%22%5BJournal%5D)">PAR-CLIP for Discovering Target Sites of RNA-Binding Proteins.</a> mRNA Decay: Methods and Protocols. 1720, 55-75 (2018).</li>
<li>Konig, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((iCLIP+-+Transcriptome-wide+Mapping+of+Protein-RNA+Interactions+with+Individual+Nucleotide+Resolution%5BTitle%5D)+AND+%22Journal+of+Visualized+Experiments%22%5BJournal%5D)">iCLIP - Transcriptome-wide Mapping of Protein-RNA Interactions with Individual Nucleotide Resolution.</a> Journal of Visualized Experiments. (50), e2638(2011).</li>
<li>Sibley, C. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Individual+Nucleotide+Resolution+UV+Cross-Linking+and+Immunoprecipitation+%28iCLIP%29+to+Determine+Protein-RNA+Interactions%5BTitle%5D)+AND+%22RNA+Detection%3A+Methods+and+Protocols%22%5BJournal%5D)">Individual Nucleotide Resolution UV Cross-Linking and Immunoprecipitation (iCLIP) to Determine Protein-RNA Interactions.</a> RNA Detection: Methods and Protocols. 1649, 427-454 (2018).</li>
<li>Wheeler, E. C., Van Nostrand, E. L., Yeo, G. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Advances+and+challenges+in+the+detection+of+transcriptome%E2%80%90wide+protein-RNA+interactions%5BTitle%5D)+AND+%22Wiley+Interdisciplinary+Reviews%3A+RNA%22%5BJournal%5D)">Advances and challenges in the detection of transcriptome‐wide protein-RNA interactions.</a> Wiley Interdisciplinary Reviews: RNA. 9 (1), (2018).</li>
<li>Singh, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+Cellular+EJC+Interactome+Reveals+Higher-Order+mRNP+Structure+and+an+EJC-SR+Protein+Nexus%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">The Cellular EJC Interactome Reveals Higher-Order mRNP Structure and an EJC-SR Protein Nexus.</a> Cell. 151, 750-764 (2012).</li>
<li>Singh, G., Ricci, E. P., Moore, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((RIPiT-Seq%3A+A+high-throughput+approach+for+footprinting+RNA%3Aprotein+complexes%5BTitle%5D)+AND+%22Methods%22%5BJournal%5D)">RIPiT-Seq: A high-throughput approach for footprinting RNA:protein complexes.</a> Methods. 65, 320-332 (2014).</li>
<li>Mabin, J. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+Exon+Junction+Complex+Undergoes+a+Compositional+Switch+that+Alters+mRNP+Structure+and+Nonsense-Mediated+mRNA+Decay+Activity%5BTitle%5D)+AND+%22Cell+Reports%22%5BJournal%5D)">The Exon Junction Complex Undergoes a Compositional Switch that Alters mRNP Structure and Nonsense-Mediated mRNA Decay Activity.</a> Cell Reports. 25 (9), 2431-2446 (2018).</li>
<li>Gehring, N. H., Lamprinaki, S., Kulozik, A. E., Hentze, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Disassembly+of+Exon+Junction+Complexes+by+PYM%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">Disassembly of Exon Junction Complexes by PYM.</a> Cell. 137 (3), 536-548 (2009).</li>
<li>Dostie, J., Dreyfuss, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Translation+Is+Required+to+Remove+Y14+from+mRNAs+in+the+Cytoplasm%5BTitle%5D)+AND+%22Current+Biology%22%5BJournal%5D)">Translation Is Required to Remove Y14 from mRNAs in the Cytoplasm.</a> Current Biology. 12 (13), 1060-1067 (2002).</li>
<li>Zünd, D., Gruber, A. R., Zavolan, M., Mühlemann, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Translation-dependent+displacement+of+UPF1+from+coding+sequences+causes+its+enrichment+in+3%27+UTRs%5BTitle%5D)+AND+%22Nature+Structural+%26+Molecular+Biology%22%5BJournal%5D)">Translation-dependent displacement of UPF1 from coding sequences causes its enrichment in 3' UTRs.</a> Nature Structural & Molecular Biology. 20 (8), 936-943 (2013).</li>
<li>Gangras, P., Dayeh, D. M., Mabin, J. W., Nakanishi, K., Singh, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cloning+and+Identification+of+Recombinant+Argonaute-Bound+Small+RNAs+Using+Next-Generation+Sequencing%5BTitle%5D)+AND+%22Argonaute+Proteins%3A+Methods+and+Protocols%22%5BJournal%5D)">Cloning and Identification of Recombinant Argonaute-Bound Small RNAs Using Next-Generation Sequencing.</a> Argonaute Proteins: Methods and Protocols. 1680, 1-28 (2018).</li>
<li>Heyer, E. E., Ozadam, H., Ricci, E. P., Cenik, C., Moore, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((An+optimized+kit-free+method+for+making+strand-specific+deep+sequencing+libraries+from+RNA+fragments%5BTitle%5D)+AND+%22Nucleic+Acids+Research%22%5BJournal%5D)">An optimized kit-free method for making strand-specific deep sequencing libraries from RNA fragments.</a> Nucleic Acids Research. 43 (1), 2(2015).</li>
<li>Cameron, V., Uhlenbeck, O. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((3%27-Phosphatase+activity+in+T4+polynucleotide+kinase%5BTitle%5D)+AND+%22Biochemistry%22%5BJournal%5D)">3'-Phosphatase activity in T4 polynucleotide kinase.</a> Biochemistry. 16 (23), 5120-5126 (1977).</li>
<li>Ricci, E. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Staufen1+senses+overall+transcript+secondary+structure+to+regulate+translation%5BTitle%5D)+AND+%22Nature+Structural+%26+Molecular+Biology%22%5BJournal%5D)">Staufen1 senses overall transcript secondary structure to regulate translation.</a> Nature Structural & Molecular Biology. 21 (1), 26-35 (2014).</li>
<li>Lackner, D. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+generic+strategy+for+CRISPR-Cas9-mediated+gene+tagging%5BTitle%5D)+AND+%22Nature+Communications%22%5BJournal%5D)">A generic strategy for CRISPR-Cas9-mediated gene tagging.</a> Nature Communications. 6, 10237(2015).</li>
<li>Metkar, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Higher-Order+Organization+Principles+of+Pre-translational+mRNPs%5BTitle%5D)+AND+%22Molecular+Cell%22%5BJournal%5D)">Higher-Order Organization Principles of Pre-translational mRNPs.</a> Molecular Cell. 72 (4), 715-726 (2018).</li>
<li>Giudice, G., Sánchez-Cabo, F., Torroja, C., Lara-Pezzi, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((ATtRACT-a+database+of+RNA-binding+proteins+and+associated+motifs%5BTitle%5D)+AND+%22Database%3A+The+Journal+of+Biological+Databases+and+Curation%22%5BJournal%5D)">ATtRACT-a database of RNA-binding proteins and associated motifs.</a> Database: The Journal of Biological Databases and Curation. 2016, (2016).</li>
<li>Paz, I., Kosti, I., Ares, M., Cline, M., Mandel-Gutfreund, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((RBPmap%3A+a+web+server+for+mapping+binding+sites+of+RNA-binding+proteins%5BTitle%5D)+AND+%22Nucleic+Acids+Research%22%5BJournal%5D)">RBPmap: a web server for mapping binding sites of RNA-binding proteins.</a> Nucleic Acids Research. 42, Web Server issue 361-367 (2014).</li>
<li>Sundararaman, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Resources+for+the+Comprehensive+Discovery+of+Functional+RNA+Elements%5BTitle%5D)+AND+%22Molecular+Cell%22%5BJournal%5D)">Resources for the Comprehensive Discovery of Functional RNA Elements.</a> Molecular Cell. 61 (6), 903-913 (2016).</li>
</ol>

The authors have nothing to disclose.

We discuss here some key considerations to successfully perform RIPiT. Foremost, individual IPs must be optimized to achieve highest possible efficiency at each step. The amount of FLAG agarose beads for the input number of cells described here has proven to be robust for a wide range of proteins we have tested. As only a small fraction of partner proteins is co-immunoprecipitated with the FLAG protein, the amount of antibody needed for efficient second IP is usually low (less than 10 &#181;g). Small-scale RIPiT (from on...

Within cells, RNA exists in complex with proteins to form RNA:protein complexes (RNPs). RNPs are assembled around RNA binding proteins (RBPs, those that directly bind RNA) but also comprise of non-RBPs (those that bind RBPs but not RNA), and are often dynamic in nature. RBPs and their cofactors function collectively within RNPs to execute regulatory functions. For example, in the nonsense-mediated mRNA decay (NMD) pathway, the UPF proteins (UPF1, UPF2, and UPF3b) recognize the prematurely terminated ribosome. Each of the UPF proteins can bind to RNA, but it is only when they assemble together that an active NMD complex begins to form. Within this complex, UPF1 is further activated by phosphorylation by a non-RBP SMG1, and such UPF1 activation eventually leads to recruitment of mRNA decay inducing factors1,2. In this example, RBPs require non-RBP cofactors for recruitment and activation of the RNP complex that triggers NMD. Yet another property of RNPs is their compositional heterogeneity. Consider the spliceosome, which exists in distinct E, A, B or C complexes. Different spliceosome complexes have overlapping and distinct proteins3. To study RNP functions, it is important to elucidate which RNAs are bound by an RBP and its associated proteins. Many methods exist to accomplish this, with each approach having its distinct advantages and disadvantages4,5,6,7.
The widely popular methods to identify RBP binding sites &#8212; crosslinking followed by immunoprecipitation (CLIP) and its various variations -&#160;rely on ultraviolet (UV) light to crosslink an RBP to RNA8. However, this is not an effective approach for non-RBPs within RNPs, which do not contact the RNA directly. Here, we describe an alternative approach that is applicable to RBPs and non-RBPs alike, to isolate and identify their RNA binding sites. This approach termed RNA immunoprecipitation in tandem (RIPiT) consists of two immunoprecipitation steps, which help achieve higher specificity as compared to a single purification (Figure 1)9,10. As the individual immunoprecipitation (IP) steps can be carried out at a lower stringency as compared to CLIP, RIPiT does not depend on availability of antibodies that can withstand presence of strong detergents during immunoprecipitation. The most unique advantage of RIPiT is the ability to target two different proteins in two purification steps; this provides a powerful way to enrich a compositionally distinct RNP complex from other similar complexes11.
Small variations to the RIPiT procedure can further enhance RNP enrichment. For instance, some RNA-protein or protein-protein interactions within RNPs are transient and it may be difficult to efficiently purify footprints of such complexes. To stabilize such interactions, RNPs can be crosslinked within cells with formaldehyde prior to cell lysis and RIPiT. For example, we have observed that a weak interaction between the exon junction complex (EJC) core factor, EIF4AIII and the EJC disassembly factor, PYM12&#160;can be stabilized with formaldehyde treatment such that more RNA footprints are enriched (data not shown). Prior to cell harvesting and RIPiT, cells can also be treated with drugs to stabilize or enrich RNPs in a particular state. For example, when studying proteins that are removed from mRNA during translation (e.g., the EJC13, UPF114), treatment with translation inhibitors such as puromycin, cycloheximide or harringtonine can lead to increased occupancy of proteins on RNAs.
The amount of RNA recovered from RIPiT is usually low (0.5-10 pmoles, i.e., 10-250 ng RNA considering an average RNA length of 75 nt). The primary reason for this is that only a small fraction of a given protein is present in complex with other proteins within RNPs (any &#34;free&#34;&#160;protein IP&#39;ed in the first step is lost during the second IP). To generate RNA-Seq libraries from this RNA, we also outline here an adaptation of previously published protocol suitable for such low RNA inputs15,16&#160;(Figure 2), which yields high-throughput sequencing ready samples in 3 days.

<table><tbody><tr><td>Anti-FLAG Affinity Gel</td><td>Sigma</td><td>A2220</td><td></td></tr><tr><td>ATP, [&amp;gamma;-32P]- 3,000 Ci/mmol 10 mCi/mL EasyTide, 250 &amp;micro;Ci</td><td>PerkinElmer</td><td>BLU502A250UC</td><td></td></tr><tr><td>BD Disposable Syringes with Luer-Lok Tips (200)</td><td>Fisher</td><td>14-823-435</td><td></td></tr><tr><td>Betaine 5M</td><td>Sigma</td><td>B0300</td><td></td></tr><tr><td>biotin-dATP</td><td>TriLink</td><td>N-5002</td><td></td></tr><tr><td>biotin-dCTP</td><td>Perkin Elmer</td><td>NEL540001EA</td><td></td></tr><tr><td>Branson Sonifier, Model SSE-1</td><td>Branson</td><td></td><td></td></tr><tr><td>CircLigase I</td><td>VWR</td><td>76081-606</td><td>ssDNA ligase I</td></tr><tr><td>DMEM, High Glucose</td><td>ThermoFisher</td><td>11995-065</td><td></td></tr><tr><td>DNA load buffer NEB</td><td>NEB</td><td></td><td></td></tr><tr><td>Dynabeads Protein A</td><td>LifeTech</td><td>10002D</td><td></td></tr><tr><td>Flp-In-T-REx 293 Cell Line</td><td>ThermoFisher</td><td>R78007</td><td></td></tr><tr><td>GeneRuler Low Range DNA Ladder</td><td>ThermoScientific</td><td>FERSM1203</td><td></td></tr><tr><td>Hygromycin B</td><td>ThermoFisher</td><td>10687010</td><td></td></tr><tr><td>Mini-PROTEAN TBE Gel 10 well</td><td>Bio-Rad</td><td>4565013</td><td></td></tr><tr><td>Mini-PROTEAN TBE-Urea Gel</td><td>Bio-Rad</td><td>4566033</td><td></td></tr><tr><td>miRCAT-33 adapter 5&amp;prime;-TGGAATTCTCGGGTGCCAAGGddC-3&amp;prime;</td><td>Any</td><td></td><td>this protocol is only compatible with the Illumina sequencing platform</td></tr><tr><td>Mirus transIT-X2 transfection reagent</td><td>Mirus</td><td>MIR 6004</td><td></td></tr><tr><td>Mth RNA ligase</td><td>NEB</td><td>E2610S</td><td></td></tr><tr><td>PE1.0 5&amp;prime;-AATGATACGGCGACCACCGAGATCTACACT&lt;br/&gt; CTTTCCCTACACGACGCTCTTCCGATC*T-3&amp;prime;</td><td>Any</td><td></td><td>this protocol is only compatible with the Illumina sequencing platform</td></tr><tr><td>PE2.0 5&amp;prime;-CAAGCAGAAGACGGCATACGAGATCGGTCTC&lt;br/&gt; GGCATTCCTGCTGAACCGCTCTTCCGATC*T-3&amp;prime;</td><td>Any</td><td></td><td>this protocol is only compatible with the Illumina sequencing platform</td></tr><tr><td>Phenol/Chloroform/Isoamyl Alcohol (25:24:1, pH 6.7, 100 mLl)</td><td>Fisher</td><td>BP1752I-100</td><td></td></tr><tr><td>Purple Gel Loading Dye (6x)</td><td>NEB</td><td>NEB #7025</td><td></td></tr><tr><td>Q5 DNA Polymerase</td><td>NEB</td><td>M0491S/L</td><td></td></tr><tr><td>RNase I, &lt;em&gt;E. coli&lt;/em&gt;, 1,000 U</td><td>Eppicenter</td><td>N6901K</td><td></td></tr><tr><td>SPIN-X column</td><td>Corning</td><td>CLS8160-24EA</td><td></td></tr><tr><td>Streptavidin beads</td><td>ThermoFisher</td><td>60210</td><td></td></tr><tr><td>Superscript III (SSIII)</td><td>ThermoScientific</td><td>18080044</td><td>reverse transcriptase enzyme</td></tr><tr><td>SybrGold</td><td>ThermoFisher</td><td>S11494</td><td>gold nucleic acid gel stain</td></tr><tr><td>T4 Polynucleotide Kinase-2500U</td><td>NEB</td><td>M0201L</td><td></td></tr><tr><td>T&lt;sub&gt;4&lt;/sub&gt;RNL2 Tr. K227Q</td><td>NEB</td><td>M0351S</td><td></td></tr><tr><td>Tetracycline</td><td>Sigma</td><td>87128</td><td></td></tr><tr><td>Thermostable 5&amp;acute; App DNA/RNA Ligase</td><td>NEB</td><td>M0319S</td><td></td></tr><tr><td>TruSeq_SE1 5&amp;prime;-pGGCACTANNNNNAGATCGGAAGA&lt;br/&gt; GCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTC&lt;br/&gt; TTCCGATCTCCTTGGCACCCGAGAATTCCA-3&amp;prime;</td><td>Any</td><td></td><td>this protocol is only compatible with the Illumina sequencing platform</td></tr><tr><td>TruSeq_SE10 5&amp;prime;-pGGTGTTCNNNNNAGATCGGAAG&lt;br/&gt; AGCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCT&lt;br/&gt; CTTCCGATCTCCTTGGCACCCGAGAATTCCA-3&amp;prime;</td><td>Any</td><td></td><td>this protocol is only compatible with the Illumina sequencing platform</td></tr><tr><td>TruSeq_SE11 5&amp;prime;-pGGTAAGTNNNNNAGATCGGAA&lt;br/&gt; GAGCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTC&lt;br/&gt; TTCCGATCTCCTTGGCACCCGAGAATTCCA-3&amp;prime;</td><td>Any</td><td></td><td>this protocol is only compatible with the Illumina sequencing platform</td></tr><tr><td>TruSeq_SE12 5&amp;prime;-pGGAGATGNNNNNAGATCGGAAGA&lt;br/&gt; GCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTC&lt;br/&gt; TTCCGATCTCCTTGGCACCCGAGAATTCCA-3&amp;prime;</td><td>Any</td><td></td><td>this protocol is only compatible with the Illumina sequencing platform</td></tr><tr><td>TruSeq_SE2 5&amp;prime;-pGGGTAGCNNNNNAGATCGGAAGAG&lt;br/&gt; CGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCT&lt;br/&gt; CTTCCGATCTCCTTGGCACCCGAGAATTCCA-3&amp;prime;</td><td>Any</td><td></td><td>this protocol is only compatible with the Illumina sequencing platform</td></tr><tr><td>TruSeq_SE35&amp;prime;-pGGTCGATNNNNNAGATCGGAAG&lt;br/&gt; AGCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCT&lt;br/&gt; CTTCCGATCTCCTTGGCACCCGAGAATTCCA-3&amp;prime;</td><td>Any</td><td></td><td>this protocol is only compatible with the Illumina sequencing platform</td></tr><tr><td>TruSeq_SE4 5&amp;prime;-pGGCCTCGNNNNNAGATCGGAAGA&lt;br/&gt; GCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTC&lt;br/&gt; TTCCGATCTCCTTGGCACCCGAGAATTCCA-3&amp;prime;</td><td>Any</td><td></td><td>this protocol is only compatible with the Illumina sequencing platform</td></tr><tr><td>TruSeq_SE5 5&amp;prime;-pGGTGACANNNNNAGATCGGAAGA&lt;br/&gt; GCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTC&lt;br/&gt; TTCCGATCTCCTTGGCACCCGAGAATTCCA-3&amp;prime;</td><td>Any</td><td></td><td>this protocol is only compatible with the Illumina sequencing platform</td></tr><tr><td>TruSeq_SE6 5&amp;prime;-pGGTAGACNNNNNAGATCGGAAGAG&lt;br/&gt; CGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTCTTC&lt;br/&gt; CGATCTCCTTGGCACCCGAGAATTCCA-3&amp;prime;</td><td>Any</td><td></td><td>this protocol is only compatible with the Illumina sequencing platform</td></tr><tr><td>TruSeq_SE7 5&amp;prime;-pGGGCCCTNNNNNAGATCGGAAG&lt;br/&gt; AGCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTCT&lt;br/&gt; TCCGATCTCCTTGGCACCCGAGAATTCCA-3&amp;prime;</td><td>Any</td><td></td><td>this protocol is only compatible with the Illumina sequencing platform</td></tr><tr><td>TruSeq_SE8 5&amp;prime;-pGGATCGGNNNNNAGATCGGAAGAG&lt;br/&gt; CGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTCTT&lt;br/&gt; CCGATCTCCTTGGCACCCGAGAATTCCA-3&amp;prime;</td><td>Any</td><td></td><td>this protocol is only compatible with the Illumina sequencing platform</td></tr><tr><td>TruSeq_SE9 5&amp;prime;-pGGACTGANNNNNAGATCGGAAGAG&lt;br/&gt; CGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTCTTC&lt;br/&gt; CGATCTCCTTGGCACCCGAGAATTCCA-3&amp;prime;</td><td>Any</td><td></td><td>this protocol is only compatible with the Illumina sequencing platform</td></tr><tr><td>Typhoon 5 Bimolecular Imager</td><td>GE Healthcare Life Science</td><td>29187191</td><td></td></tr></tbody></table>

identification of footprints of rna:protein complexes via rna immunoprecipitation in tandem followed by sequencing (ripit-seq)

Identification of Footprints of RNA:Protein Complexes via RNA Immunoprecipitation in Tandem Followed by Sequencing (RIPiT-Seq)

RNA immunoprecipitation in tandem (RIPiT) is a method for enriching RNA footprints of a pair of proteins within an RNA:protein (RNP) complex. RIPiT employs two purification steps. First, immunoprecipitation of a tagged RNP subunit is followed by mild RNase digestion and subsequent non-denaturing affinity elution. A second immunoprecipitation of another RNP subunit allows for enrichment of a defined complex. Following a denaturing elution of RNAs and proteins, the RNA footprints are converted into high-throughput DNA sequencing libraries. Unlike the more popular ultraviolet (UV) crosslinking followed by immunoprecipitation (CLIP) approach to enrich RBP binding sites, RIPiT is UV-crosslinking independent. Hence RIPiT can be applied to numerous proteins present in the RNA interactome and beyond that are essential to RNA regulation but do not directly contact the RNA or UV-crosslink poorly to RNA. The two purification steps in RIPiT provide an additional advantage of identifying binding sites where a protein of interest acts in partnership with another cofactor. The double purification strategy also serves to enhance signal by limiting background. Here, we provide a step-wise procedure to perform RIPiT and to generate high-throughput sequencing libraries from isolated RNA footprints. We also outline RIPiT&#39;s advantages and applications and discuss some of its limitations.

A successful RIPiT will result in the immunoprecipitation of both proteins of interest and other known interacting proteins, and the absence of non-interacting proteins. As seen in Figure 3A, both Magoh and EIF4AIII were detected in the RIPiT elution, but HNRNPA1 was not (lane 6). In parallel, RNA footprints that have co-purified with the RNP complexes was detected via autoradiography (Figure 3B) or bioanalyzer (<strong class="x...

Here, we present a protocol to enrich endogenous RNA binding sites or &#34;footprints&#34;&#160;of RNA:protein (RNP) complexes from mammalian cells. This approach involves two immunoprecipitations of RNP subunits and is therefore dubbed RNA immunoprecipitation in tandem (RIPiT).

RNA immunoprecipitation in tandem (RIPiT) is a method for enriching RNA footprints of a pair of proteins within an RNA:protein (RNP) complex. RIPiT ...

identification-footprints-rnaprotein-complexes-via-rna

Research

JoVE Journal

Genetics

Due to the transient nature of pre-mRNA, it can be difficult to isolate and study in vivo.  Here, we present a novel in vitro approach to investigate RNA-protein interactions using a synthetic oligo pool that tiles across selected regions of pre-mRNA.

A Rapid High-throughput Method for Mapping Ribonucleoproteins (RNPs) on Human pre-mRNA

RNA transcripts are subject to extensive posttranscriptional regulation that is mediated by a multitude of trans-acting RNA-binding proteins (RBPs). Here we present a generalizable method to identify precisely and on a transcriptome-wide scale the RNA binding sites of RBPs.

PAR-CliP - A Method to Identify Transcriptome-wide the Binding Sites of RNA Binding Proteins

The spatial arrangement of RNA-binding proteins on a transcript is a key determinant of post-transcriptional regulation. Therefore, we developed individual-nucleotide resolution UV crosslinking and immunoprecipitation (iCLIP) that allows precise genome-wide mapping of the binding sites of an RNA-binding protein.

iCLIP - Transcriptome-wide Mapping of Protein-RNA Interactions with Individual Nucleotide Resolution

A step by step protocol to isolating and identifying RNA associated complexes through RIP-Chip.

Method for the Isolation and Identification of mRNAs, microRNAs and Protein Components of Ribonucleoprotein Complexes from Cell Extracts using RIP-Chip

This manuscript describes an approach to isolate select cognate RNPs formed in eukaryotic cells via a specific oligonucleotide-directed enrichment. We demonstrate the applicability of this approach by isolating a cognate RNP bound to the retroviral 5' untranslated region that is composed of DHX9/RNA helicase A.

Isolation of Cognate RNA-protein Complexes from Cells Using Oligonucleotide-directed Elution

Translational regulation plays an important role in the control of protein abundance. Here, we describe a high-throughput method for quantitative analysis of translation in the budding yeast Saccharomyces cerevisiae.

Genome-wide Quantification of Translation in Budding Yeast by Ribosome Profiling

Toeprinting aims to measure the ability of in vitro transcribed RNA to form translation initiation complexes with ribosomes under a variety of conditions. This protocol describes a method for toeprinting mammalian RNA and can be used to study both cap-dependent and IRES-driven translation.

Toeprinting Analysis of Translation Initiation Complex Formation on Mammalian mRNAs

A tandem RNA isolation procedure (TRIP) for recovery of endogenously formed mRNA-protein complexes is described. Specifically, RNA-protein complexes are crosslinked in vivo, polyadenylated RNAs are isolated from extracts with oligo(dT) beads, and particular mRNAs are captured with modified RNA antisense oligonucleotides. Proteins bound to mRNAs are detected by immunoblot analysis.

An Oligonucleotide-based Tandem RNA Isolation Procedure to Recover Eukaryotic mRNA-Protein Complexes

Co-translational interactions play a crucial role in nascent-chain modifications, targeting, folding, and assembly pathways. Here, we describe Selective Ribosome Profiling, a method for in vivo, direct analysis of these interactions in the model eukaryote Saccharomyces cerevisiae.

Global Identification of Co-Translational Interaction Networks by Selective Ribosome Profiling

We present a modified native chromatin immunoprecipitation sequencing (ChIP-seq) methodology for the generation of sequence datasets suitable for a nucleosome density ChIP-seq analytical framework integrating micrococcal nuclease (MNase) accessibility with histone modification measurements.

Generation of Native Chromatin Immunoprecipitation Sequencing Libraries for Nucleosome Density Analysis

Learn RIPiT-Seq to identify RNA footprints bound by RNA binding proteins in mammalian cells. This UV-crosslinking independent method enriches distinct RNA:protein complexes for studying disease-linked proteins.

Identification of Footprints of RNA:Protein Complexes via RNA Immunoprecipitation in Tandem Followed by Sequencing (RIPiT-Seq)

Explore More Videos