Оценка загрязнения ДНК в образцах РНК, основанный на рибосомной ДНК

Genetics
 

Summary

Здесь мы представляем собой протокол для отслеживания геномной ДНК (геномная ДНК) загрязнение образцов РНК. Представленный метод использует праймеры специфических для региона внутренней трансляции распорку (СТС) генов рибосомной ДНК (рДНК). Этот метод подходит для надежного и чувствительных обнаружения загрязнения ДНК в большинстве эукариот и прокариот.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Hashemipetroudi, S. H., Nematzadeh, G., Ahmadian, G., Yamchi, A., Kuhlmann, M. Assessment of DNA Contamination in RNA Samples Based on Ribosomal DNA. J. Vis. Exp. (131), e55451, doi:10.3791/55451 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Один метод, широко используется для количественной оценки изменения выражения гена и Стенограмма распространённость — реверс транскрипция Количественная ПЦР в реальном времени (RT-ПЦР). Он обеспечивает точную, чувствительных, надежных и воспроизводимых результатов. Чувствительность и специфичность RT-ПЦР могут влиять несколько факторов. Остаточные геномной ДНК (геномная ДНК) загрязнение образцов РНК является одним из них. В анализ выражения гена усиление неспецифической из-за загрязнения геномная ДНК будет переоценить обилие Стенограмма уровней и может повлиять на результаты RT-ПЦР. Как правило, обнаруживается геномная ДНК qRT-PCR используя праймер пары отжига intergenic регионов или Интрон гена интереса. К сожалению Интрон/экзона аннотации пока не известны для всех генов от позвоночных животных, бактерий, протистов, грибов, растений и многоклеточные видов беспозвоночных.

Здесь мы представляем протокол для обнаружения загрязнения геномная ДНК на RNA образцов с помощью рибосомной ДНК (рДНК)-на основе грунтовки. Метод основан на уникальные особенности рДНК: их градиентный характер, весьма сохранение последовательности и высокой частоты в геноме. Также, как исследование уникальный набор грунтовки были разработаны на основе в регионе сохраняется рибосомной ДНК (рДНК) к семейству Poaceae. Универсальность этих пар грунт был проверен электрофорез геля агарозы и анализ кривой расплава. Хотя наш метод объясняет как рДНК based праймеры могут быть применены для анализа загрязнения геномная ДНК к семейству Poaceae, он может использоваться легко для других видов прокариот и эукариоты

Introduction

Изучение регуляцию интересные наборы генов или сигнализации сетей необходимо понимать сложные молекулярные механизмы, участвующие в биологических события1. В настоящее время ПЦР анализ является наиболее широко используется подход для ген выражение исследования, которые можно ориентировать ДНК (геном) или РНК (транскриптом) которые позволяют methylome и транскриптом анализа, соответственно. Обратная транскрипция (RT) следуют ПЦР широко используется для анализа транскриптом, что измерить уровни выражения гена в различных областях биологических исследований2. По сравнению с другие методы, такие как традиционной Северной гибридизации, ткани конкретных обнаружения через в situ гибридизация, рибонуклеаза защиты анализов (РПА) и полу RT-PCR, точность, удобство, скорость и широкий динамический диапазон на основе ПЦР анализов являются весьма замечательных3,4. Есть несколько важных факторов, которые должны быть рассмотрены для надежной количественной матричная РНК (мРНК), включая качество и количество исходного материала РНК. Кроме того усиление неспецифической, эффективность RT-ПЦР и ПЦР эффективность должны рассматриваться5,6.

Присутствие геномная ДНК является присущи проблемы во время извлечения РНК, частично, обусловлено аналогичные физические и химические свойства ДНК и РНК-7. Из-за последовательности личность геномная ДНК и комплементарной ДНК — (cDNA кДНК) производные от образцов mRNA может произойти усиление неспецифической, который будет влиять на точность результатов RT-ПЦР. Оставшиеся геномная ДНК приведет к завышению численности целевой мРНК гена выражение анализ8.

В основном неспецифичный ампликон главным образом вытекает из образование димера праймера или усиление неспецифической фон результате геномная ДНК, оба из которых может оцениваться с помощью надлежащих контрольных образцов. Такие примеры являются не шаблон управления (НПС) и не обратной транскриптазы (NRT), соответственно. Поскольку уровни загрязнения геномная ДНК в образцах, изучаются разные и чувствительность к геномная ДНК сильно отличается между анализ генов, NRT элементы управления являются обязательными для каждой выборки/пробирного пары. Хотя это существенно увеличивает стоимость и труда в РТ ПЦР профилирования исследования, эти элементы управления являются требуется7,9.

Альтернативные методы, занимающихся геномная ДНК загрязнения включают в себя использование праймера пар отжига intergenic регионов или Интрон гена интереса10, и использования грунтовки, которые обрамляют большие Интрон или охватывают Экзон экзона Джанкшен, т.е. отжиг сайтов отсутствуют в зрелой мРНК последовательности1,4. Однако еще не известны Интрон/экзона аннотации для всех генов от многих позвоночных животных, бактерий, протистов, грибов, растений и многоклеточные видов беспозвоночных. Кроме того многие эукариотических организмов имеют pseudogenes, производные от дублирования мероприятий. Кроме того конструкция праймера через интронов не гарантирует не усиление геномная ДНК. Как хроматина доступность геномной регионов DNase я меняется, рекомендуется для разработки различных грунтовка пар ориентации разные хромосомы10.

Геномы эукариот организмов может охватывать до тысячи копий рДНК генов, кодирующих рибосомальной подразделения, необходимых для формирования рибосом. Эти рДНК генов часто организуются в одно- или тандеме повторить массивы11. Полицистронная теорией (рис. 1), включая большие субъединицы (LSU) и небольшой субъединицы (SSU) транскрибируются РНК полимеразой я (РНК Поль я). Результате pre теорией обрабатываются дальнейшего устранения двух внутренних транскрибируется распорку регионах ITS1 и ITS2. Как готовой продукции, три Зрелые теорией, 17-18S рРНК (SSU), 5.8S и 25-28S рРНК (ЛГУ), созданного12. рДНК генов являются типичными представителями градиентный семьи с высоко сохранение последовательности. Они происходят с высокой частотой в геноме и потенциально присутствуют в более чем одной хромосомных расположение13. Обработку рРНК и деградации транскрибируется распорки является быстрый процесс в ядрышко. Благодаря высокой степени повторяемости соотношение геномной копии номер и обнаружению необработанных premolecules РНК является ниже по сравнению с низким копия Интрон последовательности и unspliced прекурсоров. Эти особенности делают рДНК генов, хорошо подходит для надежной и высокочувствительный обнаружения загрязнения геномная ДНК в большинстве прокариот и эукариот3.

Здесь описан Роман процедуры для обнаружения загрязнения геномная ДНК в образцах РНК. Для анализов геномная ДНК в нескольких видов Poaceae представлен набор универсальных грунты, основанный на последовательности рДНК сохраняется. Специфика и универсальность предлагаемая грунты были протестированы расплава анализа кривой с помощью ДНК как шаблон. Наш протокол применяется не только для злаках, но также легко могут быть адаптированы к другими прокариотами и эукариотами видов.

Protocol

Примечание: Может использоваться любой ткани.

1. Нуклеиновые кислоты добыча

  1. Положите 100 мг образцов ткани в 2.0 мл трубку, добавить два бисера 5 мм из нержавеющей стали и гомогенизации ткани на 25-30 Гц для 30 s (гомогенизации продолжительность и частоту в зависимости от типа ткани) РНК и ДНК.
  2. Изолируйте всего РНК согласно инструкциям производителя.
  3. Изолируйте всего ДНК согласно инструкциям производителя.
  4. Контроль чистоты и количество образцов РНК путем измерения оптической плотности на 260 и 280 Нм.
  5. Контроль чистоты и количество образцов ДНК путем измерения оптической плотности на 260 и 280 Нм.
    Примечание: В то время как нуклеиновые кислоты поглощают свет с длиной волны 260 Нм (A260), поглощения света на длине волны 280 (A280) может использоваться для количественного определения количество белков и фенолов присутствует в образце. Таким образом соотношение Нм A260/A280 может использоваться для оценки чистоты ДНК и РНК, извлеченные из образца. A260/280 значения в диапазоне от ≥1.8 и > 2.0 обычно считаются «чистого» для ДНК и РНК, соответственно. Нижняя A260/280 значения могут указывать на загрязнение протеина или органических химических веществ.
  6. Проверите качество ДНК, запустив электрофорез геля агарозы 0,7%. Подготовка геля и запустить в 1 x трис борная ЭДТА буфера (КЭ: 89 мм трис, борная кислота 89 мм и 2 мм ЭДТА) на 100 V 30 мин высокого качества геномная ДНК появляется как резкий, высокий молекулярным весом (HMW) полосы с не мазков в диапазоне от низкой молекулярной массой (LMW) молекул.
  7. Проверка изоляции РНК для количества, чистоты и целостности при денатурации условий, электрофорез геля агарозы тиоцианат (GTC) гуанидина или капиллярного электрофореза чип, согласно инструкциям производителя.
    1. Подготовить GTC гель, добавив 5 мм GTC для стандартной 1 гель агарозы 1% x TBE после охлаждения агар до 60 ° C.
      Примечание: GTC является токсичным, поэтому обойтись в зонта и носить надлежащие средства личной защиты.
    2. Подготовить РНК денатурации загрузки буфера: 95% формамида, 10 мм ЭДТА pH 8.0, 0,1% бромфеноловый синий, 0.1% ксилола cyanole и 10 мкл бромид ethidium.
      Примечание: Бромид ethidium и формамид являются токсичными и следует отказаться в зонта.
    3. Загрузка 1-5 мкг всего РНК в РНК денатурации загрузки буфера, тепло смеси на 5 мин при 70 ° C, поместите его на льду перед его загрузкой на гель, а затем отделить РНК на GTC гель на 100 V для маркера молекулярный вес нагрузки ДНК или РНК 45 мин в качестве стандарта наряду с в образце РНК.
    4. Пятно гели бромидом ethidium и визуализировать полосы, с помощью системы захвата изображений под ультрафиолетовым светом. У эукариот нетронутыми всего РНК в денатурации условия покажет по крайней мере два четким и ясным рРНК полос (28S и 18S) с соотношением 2:1 интенсивности.
  8. Удаление следов геномная ДНК путем обращения с DNase (DNase я РНКазы бесплатно). Добавить бесплатно РНКазы трубки в 10 мкл общий объем: 0,1 - 1 мкг всего РНК, одна единица DNase I и 1 мкл реакции 10 x буфер с MgCl2. Инкубировать смесь для 30 минут при 37 ° C. Прекратить реакции, добавив 1 мкл 50 мм ЭДТА и инкубации при 65 ° C для 10 мин.
  9. Удаление следов РНК из экстрактов геномная ДНК с помощью DNase бесплатно РНКазы A, по словам производителя протокол. 5 мкл РНКазы 10 мг/мл до всего ДНК и Инкубируйте на 37 ° C в течение 1 ч. магазин РНК и ДНК выдержки при температуре-80 ° C.

2. грунтовка дизайн от рДНК региона для геномная ДНК Assay

Примечание: РДНК полнометражного последовательность содержит два региона (ITS1 и ITS2), которые будут удалены в зрелой молекулы рРНК серия endonucleolytic расколы и затем деградировали (рис. 1).

  1. Извлечение последовательности нуклеотидов рДНК из NCBI (http://www.ncbi.nlm.nih.gov) для видов, представляющих интерес. Лучший ключевое слово для поиска в базе данных является «внутренней трансляции распорку.»
  2. Ввод нуклеотидной последовательности целевых объектов в BLASTn Поиск для поиск внутреннего транскрибируется распорку регионов (ITSs), СБУ и ЛГУ сохраняется регионов.
  3. Выберите грунтовки, что либо фланка ITSs последовательности или что усилить ITSs последовательности, которые не присутствуют в зрелых рРНК.
    1. Проектирование грунты, фланкируя последовательности ITS1 или ITS2: выравнивание сохранившихся регионов от различных видов ClustalW. Дизайн грунты, специфичных для его фланкируя региона после анализа конкретных/кросс видов таксонов с программным обеспечением AlleleID. Два грунтовка пары усилительных сы-5.8S и 5.8S-ампликонами LSU могут быть разработаны на основе на фланкируя регионах ITS1 и ITS2, соответственно. Потому что эти ампликонов охватывающих через ее региона, длина ампликон будет увеличена по меньшей мере 300 bp в ампликонов от геномная ДНК. Это увеличение снижает чувствительность.
      1. Фланкируя ITS1: Выберите СБУ и 5.8S рРНК последовательности. Выбранный Праймеры для Poaceae являются: СГУ, SF: CGTAACAAGGTTTCCGTAGGTG, R: GGTTCACGGGATTCTGCAAT. Эта грунтовка пара (SF: вперед и реверс R:) усиливает частичную область СБУ, полнометражные ITS1 и регионе частичное 5.8S рДНК.
      2. Фланкируя ITS2: Выберите 5.8S и последовательности LSU. Выбранный Праймеры для Poaceae являются: F: ATTGCAGAATCCCGTGAACC ЛГУ последовательность консенсуса, LR: TGCTTAAAYTCAGCGGGTAGYC. Эта грунтовка пара усиливает частичную область 5.8S, полнометражные ITS2, и частичное региона ЛГУ (рис. 1).
        Примечание: В случае грунт дизайн, основанный на ITSs фланговые региона, весьма сохраняемой области СБУ, 5.8S и ЛГУ были определены. Прямого и обратного грунты из 5.8S рРНК были разработаны на основании сохраняемой мотив в цветущих растений14. Были разработаны на основе прямого и обратного праймеры СБУ и ЛГУ сохраняется регионов в злаках, соответственно. Расхождения между СБУ и ЛГУ Праймеры для каждого вида приводится в таблице 1.
    2. Грунты, усиливая ITSs последовательности: В этом протоколе, Дизайн ITS1 грунтовки на основе Прибрежница его последовательности (NCBI номер taxid: 110873). Для грунтовки, используйте: вперед: GGTATGGCGTCAAGGAACACT, реверс: ATAGCATCGCTGCAAGAGGT. Согласно ампликонами, порожденных грунтовка пар в silico, размер должен варьироваться от 60 до 200 bp. Это также рекомендуемый размер для ПЦР анализа.
  4. Выбрать праймеры при рассмотрении этих рекомендаций: GC содержание: 40-60%, грунтовка Длина: 18-23 базы, длина продукта ПЦР: bp 60-160 (специально для ее грунтовки), плавления температура (Tm): 60 ° C, окончательный ТМ для обоих праймеры не отличается более чем на 5 ° C и прим ERS не дополняют друг друга для себя или партнера грунтовки.
  5. Проверьте номер специфичности и копировать грунт. Анализ в silico выбранный грунт последовательности грунт Доменная программы (https://www.ncbi.nlm.nih.gov/tools/primer-blast/).
    1. Откройте страницу представления грунт-взрыв. Введите обе последовательности грунт в разделе Параметры грунтовка формы. В специфике пары праймера, проверка параметров раздела введите организм имя (или название группы организма) и выберите генома базы данных. Эти параметры дают специфика информацию о целевых последовательности и грунтовка параметров, включая Длина изделия, позиция на хромосоме и скопируйте номер.

3. Выполняйте ПЦР шаг для проверки рДНК based праймеры с ДНК шаблоны

Примечание: Функциональность разработана грунтовки должны проверяться путем проведения ПЦР, используя геномная ДНК в качестве шаблона. Чтобы выполнить несколько параллельных реакций и уменьшить дозирования ошибки, рекомендуется подготовка мастер смесь. Для основной смеси Подготовьте объем эквивалентен общее количество смеси реакции плюс ~ 10%.

  1. Подготовка мастер смеси, смешивая все реакции компонентов за исключением шаблона дна в трубке ПЦР реакции. Высококлассные как от одной реакции необходимо подготовить Master mix: 5 мкл SYBR зеленый (SYBR) Мастер-микс (2 x), 0,3 мкл грунтовка (0,3 мкм каждого прямого и обратного грунт) и окончательного громкость до 10 мкл с РНКазы свободной воды. Используйте примерно ≤200 нг в 1 мкл шаблон геномная ДНК для анализа.
    Примечание: Размораживание, собрать и сохранить все реактивы, компоненты и реакция смеси на льду.
  2. Алиготе Мастер микс в оптических 96-луночных пластины. Пипетка 1 мкл геномная ДНК для каждой скважины, а затем накрыть оптические пластины, пленки для запайки. Спина и место в cycler.
  3. Запуск анализа ПЦР на реальном времени тепловой циклователь на следующих условиях: 10 мин при 95 ° C, после чего 40 циклов 95 ° c для 15 s-60 ° C в течение 1 мин сбора данных выполнять на 60 ° C отжиг/расширение шаг.
  4. После усиления процедуры с учетом всех реакций PCR для плавления анализа кривой с непрерывной флуоресценции измерения от 55 ° C до 95 ° C. Как правило собирают одна точка данных каждого цикла поэтапное увеличение температуры на 0,5 ° C за цикл.
    Примечание: Включить по крайней мере 2 non шаблона управления (NTC) для каждой пары грунтовка Мастер микс. Выполните все анализы по крайней мере три репликаций.
  5. Подтвердите специфика грунт через анализ кривой расплава. Анализ кривых с циклом одинарных пороговых значений и вычитается кривой метод.
    Примечание: Появление острый пик индивидуальных указывает равномерное отдельных ампликон. Продукты димера праймера может отображаться как отдельные вершины при более низких температурах.
  6. Проверьте размер каждого ампликон электрофорезом геля агарозы.
    1. Подготовка 3% агарозном геле, смешивая агарозы 3 g с 100 мл буфера КЭ (КЭ: 89 мм трис, борная кислота 89 мм и 2 мм ЭДТА).
    2. Смешайте 5-10 мкл продукта PCR с ДНК и 1-2 мкл 6 x загрузки буфера. Загрузить продукт PCR наряду с ДНК лестница на 3% агарозном геле. Выполните электрофоретического разделения в 1 x трис борная ЭДТА буфер на 100 V по 45 мин.
    3. Пятно гели с бромид ethidium или любые другие интеркалирующего агента и визуализировать полосы, с помощью системы захвата изображений под ультрафиолетовым светом.
      Примечание: ДНК интеркалирующего агентов (например, бромид ethidium) являются канцерогенные и должны быть обработаны с осторожностью и отдельно обойтись. Появление уникальной резкое группы (в отношении размера и без грунтовки димера или искусственных фон амплификации) подтверждает специфика amplicon.

4. геномная ДНК загрязнение Assay процедуры с РНК шаблоны

Примечание: После лечения с DNase, очищенный РНК образец тестируется рДНК специфические праймеры. Благодаря обработке Интрон как особенность ITSs когда эти регионы используются для усиления, нет усиления сигнала должен быть обнаружены в РНК, ДНК бесплатные образцы. Исходя из этого, если обнаруживается усиление сигнала в ПЦР или группы в агарозном геле с ожидаемого размера (по оценкам в silico анализа), отметил, что это должно быть из-за загрязнения геномная ДНК. Шаги, выполняемые в данном разделе, похожи на секции 3, за исключением того, что cDNA всех образцов используется в качестве шаблона вместо геномная ДНК.

  1. Подготовка мастер смеси путем смешивания всех компонентов реакции, за исключением РНК шаблон в трубке ПЦР реакции. Мастер-сочетание смесь для одной реакции: 5 мкл SYBR Мастер микс (2 x), 0,3 мкл грунтовка (0,3 мкм каждой смеси прямого и обратного грунт) и окончательного громкость до 10 мкл с РНКазы свободной воды. Используйте около 500 нг шаблон РНК в 1 мкл тома для анализа.
  2. Алиготе мастер смесь в оптических 96-луночных пластины. Пипетка 1 мкл РНК для каждой скважины и затем накройте его, оптические пластины, пленки для запайки. Центрифуги и место в cycler.
    Примечание: Включают по крайней мере два элемента управления NTC и два положительных геномная ДНК элементов управления для каждого анализа. Выполните все анализы в трех технических репликаций.
  3. Запуск анализа ПЦР на реальном времени тепловой циклователь на следующих условиях: 10 мин при 95 ° C, после чего 40 циклов 95 ° c для 15 s-60 ° C в течение 1 мин сбора данных выполнять на 60 ° C отжиг/расширение шаг.
  4. После усиления процедуры с учетом всех реакций PCR для плавления анализа кривой с непрерывной флуоресценции измерения от 55 ° C до 95 ° C. Обычно собирайте по одной точке данных каждого цикла поэтапное увеличение температуры на 0,5 ° C за цикл.
  5. Проверьте, что все продукты PCR, запустив на 3% агарозном электрофорез геля.
    Примечание: Внешний вид любой группы или пик в реакции NTC вероятно, связано с грунт димера формирования, которые обычно наблюдаются при низких температурах в кривую плавления, в то время как присутствие какой-либо группы или пик в образцах РНК является результатом загрязнения геномная ДНК. Рекомендуется сначала проверить все образцы РНК, рДНК based праймеры, и затем-ДНК загрязненной образцами используются для вниз по течению приложений, таких как синтез cDNA, анализ выражения гена, и т.д.

5. ПЦР-шаг для синтез cDNA и ПЦР анализ

  1. Оттепель DNase-лечение РНК и Реагенты синтеза cDNA при комнатной температуре. После оттаивания, спина вниз реагентов. Добавить 1 мкг РНК и 1 мкл Oligo (dT) 18 грунт в свободной от нуклеиназы трубку. Настроить общий объем 12 мкл с РНКазы свободной воды, осторожно перемешать и затем хранить на льду.
  2. Растопить вторичной структуры РНК шаблона путем инкубации реакции при 65 ° C для 5 минут спин вниз и прохладный флакона на льду.
  3. Подготовьте смесь мастер реакции (окончательный объем 20 мкл для каждой реакции) следующим: 1 мкл обратной транскриптазы (200 U/мкл), 4 мкл буфера реакции (5 x), 1 мкл АБС битор РНКазы (20 U/мкл) и 2 мкл dNTP смесь (10 мм). Осторожно перемешать и охладить флакона на льду. 19 мкл в подготовленных трубка, содержащая РНК.
  4. Инкубировать реакции для 60 мин при 42 ° C, а затем Инкубируйте на 70 ° C за 5 мин, прекратить деятельность обратной транскриптазы. Место реакции RT на льду и провести анализ выражения гена процедурой обычной ПЦР (как описано в разделе 3 и 4).

Representative Results

Мы предлагаем использование рДНК based праймеры для проверки отсутствия загрязнения геномная ДНК РНК образцов ткани листа. Блок-схема анализа ПЦР анализа и геномная ДНК загрязнение показано на рисунке 2. В протоколе представлены две взаимодополняющие стратегии были использованы для рДНК based праймер дизайн: 1) вегетационных грунтовки были отобраны из ITSs последовательности и 2) Универсальная грунтовка были отобраны из ITSs фланговые регионов. Для доказательства в концепция мы разработали для Прибрежница littoralis, грунты и универсальные грунты, основанные на злаках видов, как это указано в протоколе. 5.8S вперед и назад грунтовки были отобраны на основании сохраняемой мотив 14 пар (bp), который показывает сходство между цветковых растений, мохообразных и несколько заказов, водоросли и грибки14. Особенности разработан грунты, приведены в таблице 2. Универсальность СГУ, 5.8S и ЛГУ грунт были проверены BLASTn, и грунтовка гомологии результаты представлены на рисунке 3 как мотив логотипа. Список видов, включенных в анализ гомологии, а также различные грунтовки для каждого вида приведены в Таблица 1. Специфика грунт был проверка грунт-взрыв. Для видов, где доступен весь геном последовательность оценивалась хромосомных расположение рДНК генов. К примеру в Oryza sativa и Arabidopsis thaliana, рДНК генов расположены на двух разных хромосомах и в Zea mays на трех разных хромосомах.

ПЦР проверки рДНК based праймеры была выполнена с плавления анализ кривой ITS1 и ITS2-фланг ампликонами, используя ДНК в качестве шаблона. Как представлено в Рисунок 4 и Рисунок 5, грунтовка специфика экспериментально подтвердили наблюдения один острый пик с образованием без праймер димеров в различных видов злаках, включая Triticum aestivum, Hordeum vulgare, Oryza sativaи в двудольных Medicago sativa, Cucumis sativus, Nicotiana tabacum, Клевер александрийский, горошек Фабаи Резуховидка Таля. Дальнейшие испытания продуктов амплификации размер электрофоретического разделения показал уникальной группы. Как и ожидалось, полосы, производный от образцов различных видов, разнообразны по размеру (рис. 6A и 6B). Интересно, что использование универсального грунты, специально предназначенные для этих трех видов Poaceae полезны не только для других видов злаках, но также для других видов растений, таких как A. thaliana и эндофитные гриб виз. Piriformospora indica.

Действительность разработаны конкретные грунт (ITS1) также была подтверждена ПЦР в A. littoralis используя геномная ДНК в качестве шаблона. Было отмечено, один пик с образованием без грунтовки димер. Удивительно A. littoralis ITS1 грунт (как конкретные грунт) генерируется однодиапазонный резко не только в A. littoralis, но и для всех других видов испытания за исключением Nicotiana tabacum и клевер Александрийский, который подготовил две полосы (рис. 6 c). Assay загрязнение геномная ДНК была выполнена его или ее окаймляющие грунты во всех пробах РНК. Схематическое представление амплификации пластины в assay загрязнение геномная ДНК и интерпретация результатов представлена на рисунке 7.

Figure 1
Рисунок 1: Общий шаблон эукариотических рДНК последовательность Организации.
Эукариотические рДНК сегмент содержит 17-18 (красный), 5.8S (синий) и 25-28S рРНК (розовый). Внутренней трансляции распорки (СТС) указаны как черные линии. 5´and 3´ указывают на ориентацию молекулы ДНК. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 2
Рисунок 2: рабочий процесс для RT-ПЦР и геномная ДНК загрязнение assay. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 3
Рисунок 3: мотив логотипа A. СГУ, б. 5.8S и C. LSU грунтовка гомологии. Для СБУ, 5.8S, и ЛГУ грунтовки, мотив логотип был построен BLASTn, основанный на 2000 записей зеленых растений (NCBI taxid номер: 33090) с ≤10 отсечения в e значение-10. A-аденин, T-тимина, G-гуанина, C-цитозин. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 4
Рисунок 4: Расплава кривой анализ ITS1-фланговые ампликон в разных видов.
Этот ампликонами, усиливается СБУ и 5.8S-R грунтовки, содержит часть последовательности кодирования региона 17-18, всю последовательность ITS1 и частичная последовательность 5.8S. Показаны являются плавления кривых ампликонов генерируется (розовый) и NTC (красный) от Triticum aestivum, Hordeum vulgare, Oryza sativa, Люцерна truncatula, Cucumis sativus, Nicotiana tabacum, Клевер александрийский, горошек Фаба, Arabidopsis thaliana и Piriformospora indica. Плоские жирная линия указывает порог базовой линии. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 5
Рисунок 5: Расплава кривой анализ ITS2-фланговые ампликон в разных видов.
Этот ампликон генерируется с помощью 5.8S-F и ЛГУ грунтовки. Описанные ампликон содержит последовательности частью 5,8 S, всю последовательность ITS2 и частичная последовательность 25-28S. Показаны являются плавления кривых ампликонов (зеленый) и NTC (красный) генерируется из Triticum aestivum, Hordeum vulgare, Oryza sativa, Люцерна truncatula, Cucumis sativus, Nicotiana tabacum, Клевер александрийский, горошек Фаба, Arabidopsis thaliana и Piriformospora indica. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 6
Рисунок 6: Анализ геля агарозы рДНК ПЦР-продукта.
Ампликон ITS1-бочки (A), ITS2-бочки (B) и ITS1 (C) были запущены на 3% агарозном геле. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 7
Рисунок 7: Можно считать Intron подобные функции ITSs дизайн грунты, которые может обнаружить заражение геномная ДНК.
Любой пик или группа с ожидаемый размер ПЦР анализа указывают на загрязнение геномная ДНК в образце РНК. UNK: неизвестный образец, pos: положительный контроль, NTC: non шаблона элемента управления. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Грунтовка Род Taxid ID Виды Расходящихся грунтовка
СЫ Арабидопсис 3701 kamchatica, thaliana и lyrata -
Горошек 3904 ямс, Американа, unijuga, amoenane, Амурский, craccamal, псевдо orobus, multicaulis, айва японская, ramuliflora и Фаба
Клевер 3898 Александрийский, горный, resupinatum и ползучий -
Табак 4085 Обыкновенный , benthamiana, otophora, picilla, Бигелоу, Палмера, tomentosiformis, tomentosa, digluta, Каваками, мускатный, nesophila, solanifolia, cordifolia, debneyi, arentsii, кистецветный, wigandioides, скат, железистый, noctiflora, petunioides, obtusifolia, miersii, малоцветковый, смягчить, кондиломы, linearis, Алата, обыкновенная, rustica и лекарственная -
Огурец (род) 3655 anguria, Мело и sativus CGTAACAAGGTTTCCGTAGGKG
Прибрежница 110873 - Праймер не найдены
Люцерна 3877 Sativa, хмелевидная, pamphylica, rostrate, складчатая lunata и truncatula -
Oryza 4597 Sativa, glumipatula, rufipogon barthii glaberrima пунктата, longistaminata, веткам, nivara, веткам и longistaminata -
Triticum 4564 aestivum, Урарту и monococcum -
Ячмень 4512 vulgare, клубневидный, marinum, brevisubulatum и bogdanii -
LSU Арабидопсис 3701 скальный, thaliana и lyrata TGCTTAAACTCAGCGGGTAATC
Горошек 3904 лесной, tetrasperma, sativa, гирсуитизмом, sepium, мелкоцветковая, мышиный, lathyroides, orobus, orobus, bithynica и Фаба TGCTTAAATTCAGCGGGTAGCC
Клевер 3898 притворства, nigrescens, resupinatum, Западной Швейцарии, subterraneum, strictum, ochroleucon, glomeratum, squamosum, ornithopodioides и ползучий TGCTTAAATTCAGCGGGTAGCC
Табак 4085 Обыкновенный , benthamiana, otophora, picilla, Бигелоу, Палмера, tomentosiformis, tomentosa, digluta, Каваками, мускатный, nesophila, solanifolia, cordifolia, debneyi, arentsii, кистецветный, wigandioides, скат, железистый, noctiflora, petunioides, obtusifolia, miersii, малоцветковый, смягчить, кондиломы, linearis, Алата, обыкновенная и лекарственная TGCTTAAACTCAGCGGGTAGTC
Огурец (род) 3655 Мело, ritchiei и цивета TGCTTAAACTCAGCGGGTAGTC
Прибрежница 110873 lagopoide, колючая и littoralis TGCTTAAATTCAGCGGGTAATC
Люцерна 3877 закрытий, sativa, хмелевидная, Арабика, polymorpha и минимумы TGCTTAAATTCAGCGGGTAGCC
pamphylica, lunata, rostrate и складчатая TGCTTAAACTCAGCGGGTAGTC
Oryza 4597 Sativa, glumipatula, rufipogon, barthiial, glaberrima, australiensis, лекарственная, australiensis, ridleyi, malampuzhaensis, альта, nivara, rufipogon, веткам и longistaminata TGCTTAAACTCAGCGGGTAGTC
Triticum 4564 aestivum, так, turgidum, dicoccoides, petropavlovskyi, Урарту и monococcum TGCTTAAACTCAGCGGGTAGTC
Ячмень 4512 vulgare, клубневидный, murinum, secalinum, brevisubulatum и bogdanii TGCTTAAACTCAGCGGGTAGTC
Вырожденный грунт определяется как система ИЮПАК для номенклатуры нуклеотидов

Таблица 1: Перечень видов считается для комплектации рДНК based праймеры.
СЫ привязки сайта по сравнению с LSU привязки сайта показали выше последовательностью Гомологичность дано роду.

Ампликон длина Амплификация район Последовательность Грунтовка имя Ампликон
332 - 405 bp Частичная последовательность СБУ, всю последовательность ITS1 и частичная последовательность 5.8S CGTAACAAGGTTTCCGTAGGTG СЫ ITS1-бочки
GGTTCACGGGATTCTGCAAT 5.8S-R
318 - 361 bp Частичная последовательность 5.8S, всю последовательность ITS2 и частичная последовательность ЛГУ ATTGCAGAATCCCGTGAACC 5.8S-F ITS2-бочки
TGCTTAAAYTCAGCGGGTAGYC LSU
100 - 200 bp ITS1 GGTATGGCGTCAAGGAACACT ITS1-F ITS1
ATAGCATCGCTGCAAGAGGT ITS1-R

Таблица 2: Грунтовка последовательностей.

Discussion

Анализ выражения гена путем количественного PCR широко применяется в последние годы. Основное преимущество этого быстрого, экономически эффективных и автоматизированных метода является его точное и точный результат. Однако получение оптимальных выгод от этих преимуществ требует четкого понимания установки параметров, используемых для ПЦР эксперимента. Чтобы получать надежный результат ПЦР анализ выражения гена, необходимо избежать неспецифических амплификации, который возникает от димера праймера или геномная ДНК загрязнение в РНК образца3,15. Ожидается, что уровни Стенограмма РНК будет переоценить под геномная ДНК загрязнение8. Здесь уникальные особенности ген рДНК считался для assay загрязнение геномная ДНК в образцах РНК.

Основные свойства рДНК, используемые в настоящем протоколе: Рибосомных генов состоят из двух ITSs, а именно ITS1 и ITS2 и три кодировки генов рРНК, 17-18, 5.8S и 25-28S Субблок12. В двух регионах ее не являются частью кодирующая последовательность рибосомальной подразделения. Они удаляются по крайней мере три ферментативную деятельность для обработки предвестником Зрелые рРНК: активности эндонуклеазы, helicase и exonuclease. Как рибосомная РНК транскрибируется как полицистронная стенограмма, основной продукт, содержащий ITSs конечно присутствует. Обработка очень быстро и занимает место в ядрышко, и обнаружению прекурсоров молекулы, содержащие ее сумма ниже предела обнаружения метода ПЦР. Поэтому когда ITS1 или ITS2 усиливается ее фланговые грунты, не усиление может быть обнаружен в образцов РНК, если загрязнение геномная ДНК присутствует. Включить до тысячи экземпляров, которые расположены в одном или тандем массивах на хромосомы11был численность рДНК генов в геноме эукариотических организмов. В этом протоколе мы предлагаем альтернативный способ, вместо NRT, для выявления загрязнения геномная ДНК, которая используется в калибровочных реакции.

Преимущества и ограничения в отношении существующих методов: НЗТ обычно используется для проверки, является ли подготовлен образец РНК чистой или загрязненной, геномная ДНК. Поскольку загрязнение геномная ДНК не распределены равномерно между различными образцами РНК, и чувствительность реакции геномная ДНК значительно затронуты гены проанализированы, NRT элементы необходимы для каждого образца/пробирного пара7,15. Это будет существенно добавить стоимость и труда при обработке многие образцы одновременно3,9. Другие альтернативные методы, описанные в литературе включают в себя использование Интрон конкретных Праймеры для обнаружения геномная ДНК, или проектирование грунты, которые обрамляют Интрон или охватывают Экзон экзона Джанкшен. Недостатки этих методов проистекают из отсутствия Интрон последовательности информации, неполной аннотации Интрон/экзона структуры и отсутствие интроны в генах или pseudogenes интерес1,4,10 . Из-за эволюции рДНК генов существуют как мультигенных и высоко сохранены гена семей. Они являются очень обильные в геноме и присутствует на различных хромосомы13. По сравнению с другими кодирования или nonconding генов, рДНК генов показывают наиболее пригодный для обнаружения загрязнения геномная ДНК. В анализе сравнительной транскриптомики, нормализации данных ПЦР рРНК толщиномером не рекомендуется для некоторых вопросов, таких, как различия в cDNA подготовка (поля грунтование против случайного hexamer грунтовки), большие различия между рРНК и мРНК в изобилии , и различные биогенеза, который может генерировать заблуждение результаты10,16. Однако проблемы, которые мы только что упомянули являются преимуществом для assay загрязнение геномная ДНК. Например в отношении выше таргетинга сайта изобилия в геноме и локализации на разные хромосомы, рДНК based праймеры значительно повысить чувствительность обнаружения геномная ДНК по сравнению с существующими методами.

Общности рДНК, основанных на другой организм: рДНК генов являются хорошо изученных генов семейства, определены в большинстве организмов. Предлагаемый метод, основанный на рДНК представляет простой, чувствительный и экономической системы для анализов загрязнение геномная ДНК, которые могут быть легко адаптированы к другими прокариотами и эукариотами организмов (протокол 2 - 5). Как пример мы продемонстрировали здесь полезность этого метода в некоторых видов Poceae (рис. 4 и 5). Используемые праймеры показывают высокий уровень переносимости на другие виды Poceae благодаря высоко сохраняется структура подразделений рДНК среди видов. Эта проблема становится еще более важной, когда достаточно геномные последовательности информации не доступен для конструкции праймера. Таким образом окаймляющие ее грунты, предназначенные для одного вида могут использоваться в смежных видов. Кроме того, 5.8S-F/R грунтовки были собраны на основании сохраняемой мотив, который показывает высокое сходство в большинстве цветковых растений14. Хотя методы секвенирования высокой пропускной способности постоянно увеличивать количество известных геномов, Экзон Интрон Аннотация большинство организмов не завершена, и поэтому это часто не позволяет разрабатывать грунты занимаемых Экзон экзона границы. Наш метод объясняет как рДНК based праймеры могут быть применены для геномная ДНК загрязнение пробирного анализа ПЦР прокариот и эукариот с целью устранения дорогим NRT контроля в каждой комбинации пробирного/грунтовка.

Disclosures

Авторы имеют без финансовых интересов.

Acknowledgments

Это исследование было поддержано генетические и сельскохозяйственной биотехнологии Института Tabarestan (ГАБИТА), Сари сельскохозяйственных наук и природных ресурсов университета (SANRU). Юниоров исследовательской группы абиотического стресса геномики финансировался IZN (междисциплинарный центр для исследования культур растений, Галле (Заале), Германия. Мы благодарим Ронда Meyer для критических чтении рукописи.

Materials

Name Company Catalog Number Comments
Maxima SYBR Green / ROX qPCR Master Mix (2X) Thermo Scientific K0221
TissueLyser II QIAGEN 85300
RevertAid H Minus First Strand cDNA Synthesis Kit Thermo Scientific K1631
GeneRuler 100 bp Plus DNA Ladder Thermo Scientific SM0321
96 well WHT/CLR Bio-Rad HSP9601
Microseal B film Bio-Rad MJ-0558
Low tube strip CLR Bio-Rad TLS0801
Flat cap strips Bio-Rad TCS0803
NanoDrop 2000 Peqlab ND-2000
RNaseZAP Ambion 9780
Centrifuge Eppendorf 5810 R
Agilent RNA 6000 Nano Kit Agilent Technologies 5067-1511
2100 Electrophoresis Bioanalyzer Agilent Technologies G2939AA
RNase A, DNase and Protease-free Thermo Scientific EN0531
DNase I, RNase-free Thermo Scientific EN0523
TRIZOL Reagent Ambion 15596026
CFX96 Touch Real-Time PCR Detection System BIO RAD 1855195
PCR tube, 0.2 mL, RNase-free Stratagene Z376426
Guanidine thiocyanate for molecular biology Sigma-Aldrich G9277
Agarose - Nucleic Acid Electrophoresis Sigma-Aldrich A9414
Boric Acid for molecular biology AppliChem A2940
bromophenol blue AppliChem A2331
ethidium bromide AppliChem A1151
Gel documentation system BIO RAD Gel Doc 2000

DOWNLOAD MATERIALS LIST

References

  1. Bustin, S. A., Nolan, T. Pitfalls of quantitative real-time reverse-transcription polymerase chain reaction. J Biomol Tech. 15, (3), 155-166 (2004).
  2. Gutierrez, L., Mauriat, M., Pelloux, J., Bellini, C., Van Wuytswinkel, O. Towards a systematic validation of references in real-time RT-PCR. Plant Cell. 20, (7), 1734-1735 (2008).
  3. Hashemi, S. H., Nematzadeh, G., Ahmadian, G., Yamchi, A., Kuhlmann, M. Identification and validation of Aeluropus littoralis reference genes for Quantitative Real-Time PCR Normalization. J Biol Res (Thessalon). 23, (1), 18 (2016).
  4. Bustin, S. A. Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. J. Mol. Endocrinol. 25, (2), 169-193 (2000).
  5. Andersen, C. L., Jensen, J. L., Orntoft, T. F. Normalization of real-time quantitative reverse transcription-PCR data: a model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res. 64, (15), 5245-5250 (2004).
  6. Bustin, S. A., et al. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin Chem. 55, (4), 611-622 (2009).
  7. Laurell, H., et al. Correction of RT-qPCR data for genomic DNA-derived signals with ValidPrime. Nucleic Acids Res. 40, (7), e51 (2012).
  8. Galiveti, C. R., Rozhdestvensky, T. S., Brosius, J., Lehrach, H., Konthur, Z. Application of housekeeping npcRNAs for quantitative expression analysis of human transcriptome by real-time PCR. RNA. 16, (2), 450-461 (2010).
  9. Laurell, H., et al. Correction of RT-qPCR data for genomic DNA-derived signals with ValidPrime. Nucleic Acids Res. 40, e51 (2012).
  10. Caldana, C., Scheible, W. R., Mueller-Roeber, B., Ruzicic, S. A quantitative RT-PCR platform for high-throughput expression profiling of 2500 rice transcription factors. Plant Methods. 3, (1), 7 (2007).
  11. Lawrence, R. J., Pikaard, C. S. Perspectives Chromatin Turn Ons and Turn Offs of Ribosomal RNA Genes. Cell Cycle. 3, (7), 880 (2004).
  12. Boisvert, F. M., van Koningsbruggen, S., Navascues, J., Lamond, A. I. The multifunctional nucleolus. Nat Rev Mol Cell Biol. 8, (7), 574-585 (2007).
  13. Alvarez, I., Wendel, J. F. Ribosomal ITS sequences and plant phylogenetic inference. Mol Phylogenet Evol. 29, (3), 417-434 (2003).
  14. Jobes, D. V., Thien, L. B. A conserved motif in the 5.8 S ribosomal RNA (rRNA) gene is a useful diagnostic marker for plant internal transcribed spacer (ITS) sequences. Plant Mol Biol Report. 15, (4), 326-334 (1997).
  15. Padhi, B. K., Singh, M., Huang, N., Pelletier, G. A PCR-based approach to assess genomic DNA contamination in RNA: Application to rat RNA samples. Anal Biochem. 494, 49-51 (2016).
  16. Dheda, K., et al. Validation of housekeeping genes for normalizing RNA expression in real-time PCR. Biotechniques. 37, (1), 112-114 (2004).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics