Beoordeling van DNA besmetting in RNA Samples gebaseerd op Ribosomal DNA

Genetics
 

Summary

Hier presenteren we een protocol voor het traceren van genomic DNA (gDNA) verontreiniging in RNA monsters. De onderhavige methode maakt gebruik van primers specifiek voor de interne getranscribeerde spacer regio (ITS) van ribosomal DNA (rDNA) genen. De methode is geschikt voor betrouwbare en gevoelige detectie van DNA besmetting in meeste prokaryoten en de eukaryoten.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Hashemipetroudi, S. H., Nematzadeh, G., Ahmadian, G., Yamchi, A., Kuhlmann, M. Assessment of DNA Contamination in RNA Samples Based on Ribosomal DNA. J. Vis. Exp. (131), e55451, doi:10.3791/55451 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Een methode voor de kwantificering van gen expressie veranderingen en transcript abundanties op grote schaal gebruikt is omgekeerde-transcriptie kwantitatieve PCR in real time (RT-qPCR). Het biedt nauwkeurige, gevoelige, betrouwbare en reproduceerbare resultaten. Verschillende factoren kunnen van invloed zijn op de gevoeligheid en de specificiteit van de RT-qPCR. Residuele genomic DNA (gDNA) besmetten van RNA monsters is een van hen. In gen expressie analyse, niet-specifieke versterking als gevolg van verontreiniging van de gDNA zal het overschatten van de overvloed van transcript niveaus en kan invloed hebben op de resultaten van de RT-qPCR. In het algemeen gDNA wordt gedetecteerd door qRT-PCR gebruikt primer paren gloeien intergenic regio's of een intron van het gen van belang. Helaas, intron/exon aantekeningen zijn nog niet bekend voor alle genen van gewervelde, bacteriën, protisten, schimmels, planten en ongewervelde metazoan soorten.

Hier presenteren we een protocol voor de detectie van gDNA besmetting in RNA samples met behulp van ribosomal DNA (rDNA)-op basis van inleidingen. De methode is gebaseerd op de unieke kenmerken van rDNA: hun multigene natuur, zeer geconserveerde sequenties en hoge frequentie in het genoom. Ook als een case-studie, een unieke reeks inleidingen werden ontworpen op basis van de geconserveerde regio van ribosomal DNA (rDNA) de grassenfamilie (Poaceae). De universaliteit van deze primerparen werd getest door smelt kromme analyse en agarose gelelektroforese. Hoewel onze methode wordt uitgelegd hoe rDNA gebaseerde inleidingen kunnen worden toegepast voor de gDNA besmetting assay de grassenfamilie (Poaceae), het gemakkelijk kan worden gebruikt om andere soorten prokaryote en eukaryote

Introduction

Het verkennen van transcriptionele regulering van interessante gene sets of signalering van netwerken is essentieel om te begrijpen van het complexe moleculaire mechanismen die betrokken zijn bij biologische gebeurtenissen1. Analyse van de qPCR is momenteel de meest gebruikte aanpak voor gen expressie studies die kunnen gericht zijn op DNA (het genoom) of RNA (transcriptome) die het mogelijk maken van methylome en transcriptome analyse, respectievelijk. Omgekeerde transcriptie (RT) gevolgd door qPCR wordt veel gebruikt voor analyse van de transcriptome dat gen expressie meten in verschillende gebieden van biologisch onderzoek2. Ten opzichte van andere methoden zoals de traditionele Noord hybridisatie, weefsel specifieke detectie via in situ hybridisatie, ribonuclease bescherming assays (RPA) en semi-RT-PCR, de nauwkeurigheid, gemak, snelheid en breed dynamisch bereik van qPCR gebaseerde tests zijn hoogst merkwaardige3,4. Er zijn meerdere belangrijke factoren die worden beschouwd voor een betrouwbare kwantificering van boodschapper-RNA (mRNA) moeten, met inbegrip van de kwaliteit en kwantiteit van RNA grondstof. Bovendien moeten de niet-specifieke versterking, de efficiëntie van de RT-qPCR en efficiëntie van de PCR beschouwd5,6.

De aanwezigheid van gDNA wil een inherent probleem tijdens de RNA extractie, gedeeltelijk vanwege de vergelijkbare fysische en chemische eigenschappen van DNA en RNA7. Vanwege de identiteit van de reeks van gDNA en cDNA (cDNA) afgeleid van de mRNA monsters, kan niet-specifieke versterking optreden, die de nauwkeurigheid van de resultaten van de RT-qPCR zal beïnvloeden. De resterende gDNA leidt tot overschatting van de overvloed aan mRNA in gen expressie analyse8richten.

Kortom, de niet-specifieke amplicon meestal ontstaat uit de primer-dimeer vorming of aspecifieke achtergrond versterking als gevolg van gDNA, die beide kunnen worden beoordeeld met behulp van passende controlemonsters. Deze monsters zijn geen sjabloon controle (NTC) en oncontroleerbaar reverse-transcriptase (NRT), respectievelijk. Aangezien de niveaus van gDNA besmetting in de monsters die worden onderzocht verschillend zijn en de gevoeligheid naar gDNA sterk tussen de genen geanalyseerd verschilt, zijn de NRT-besturingselementen vereist voor elk monster/assay-paar. Hoewel dit aanzienlijk kosten en arbeid in de RT-qPCR profiling studies verhoogt, zijn deze controles vereiste7,9.

Alternatieve methoden behandelen gDNA verontreiniging omvatten het gebruik van primerparen gloeien intergenic regio's of een intron van het gen van belang10, en het gebruik van inleidingen die beslaan een exon-exon junction, d.w.z. hetzij een grote intron flank de onthardende sites zijn afwezig in de volwassen mRNA volgnummer1,4. Intron/exon aantekeningen voor alle genen van vele gewerveld dier, bacteriën, protist, schimmels, planten en ongewervelde metazoan soorten zijn echter nog bekend. Bovendien hebben vele eukaryotische organismen pseudogenes afgeleid van duplicatie gebeurtenissen. Primer ontwerp over introns garandeert verder niet niet-amplificatie van gDNA. Als de chromatine toegankelijkheid van genomic regio's DNase ik varieert, is het aangeraden om te ontwerpen verschillende primerparen targeting verschillende chromosomen10.

Het genoom van eukaryote organismen kunnen omvatten tot duizend exemplaren van rDNA genen coderend voor ribosomal subeenheden nodig voor de vorming van de ribosomen. Deze rDNA-genen zijn vaak ingedeeld in enkele of tandem repeat arrays11. Polycistronic rRNAs (Figuur 1) met inbegrip van de grote subeenheid (LSU) en kleine subeenheid (SSU) worden getranscribeerd door RNA-polymerase I (RNA pol ik). De resulterende pre-rRNAs zijn verder verwerkt door het elimineren van de twee interne getranscribeerde spacer-regio's ITS1 en ITS2. Als eindproducten, drie oudere rRNAs, 17-18S rRNA (SSU), 5.8S en 25-28 rRNA (LSU) zijn gegenereerde12. rDNA genen zijn typische vertegenwoordigers van een multigene familie met zeer geconserveerde sequenties. Ze optreden met een hoge frequentie in het genoom en zijn potentieel aanwezig op meer dan één chromosomale locatie13. De verwerking van het rRNA en de aantasting van de getranscribeerde spacers is een snel proces in de nucleolus. Vanwege de hoge mate van herhaling, is de verhouding van genomic exemplaaraantal en aantoonbaar onbewerkt RNA premolecules lager ten opzichte van de lage-kopie intron sequenties en unspliced precursoren. Deze eigenschappen maken rDNA genen geschikt voor betrouwbare en zeer gevoelige detectie van gDNA besmetting in meeste eukaryoten en prokaryoten3.

Hier wordt een nieuwe procedure voor het opsporen van gDNA besmetting in RNA monsters beschreven. Een set universele inleidingen op basis van de volgorde van rDNA bewaard wordt gepresenteerd voor gDNA testen in de verschillende soorten van de grassenfamilie. De specificiteit en de universaliteit van de voorgestelde inleidingen werden getest door smelt kromme analyse met behulp van DNA als een sjabloon. Ons protocol is niet alleen van toepassing voor de grassenfamilie, maar kan ook gemakkelijk worden aangepast aan andere eukaryotische en prokaryotische soorten.

Protocol

Opmerking: Elke weefsel kan worden gebruikt.

1. nucleïnezuur extractie

  1. 100 mg weefselsteekproeven te zetten in een tube 2,0 mL, Voeg twee 5 mm roestvrij staal kralen en meng het weefsel bij 25-30 Hz voor 30 s (homogenisering duur en frequentie afhankelijk van weefseltype) voor zowel RNA en DNA.
  2. Isoleren totaal RNA volgens de instructies van de fabrikant.
  3. Isoleren van totale DNA volgens de instructies van de fabrikant.
  4. Bepalen de zuiverheid en de hoeveelheid van de RNA-monsters door het meten van de absorptie bij 260 en 280 nm.
  5. Bepalen de zuiverheid en de kwantiteit van de DNA-monsters door het meten van de absorptie bij 260 en 280 nm.
    Opmerking: Terwijl nucleïnezuren absorberen licht met een golflengte van 260 nm (A260), de absorptie van licht bij de golflengte 280 (A280) kan worden gebruikt voor het meten van de hoeveelheid eiwitten en fenolen aanwezig in het monster. Daarom kan de verhouding van A260/A280 nm worden gebruikt om te evalueren van de zuiverheid van DNA en RNA die uit het monster geëxtraheerd. A260/280 waarden in het bereik van ≥1.8 en > 2.0 worden over het algemeen beschouwd als "zuivere" voor DNA en RNA, respectievelijk. Lagere waarden van de A260/280 kunnen duiden op besmetting door eiwit of organische chemische stoffen.
  6. Test de kwaliteit van DNA door het uitvoeren van een 0,7% agarose gelelektroforese. Voorbereiding van de gel en uitgevoerd in 1 x TRIS-boorzuur EDTA-buffer (TBE: 89 mM Tris, boorzuur 89 mM en 2 mM EDTA) bij 100 V voor 30 min. hoge kwaliteit gDNA wordt weergegeven als een scherpe, hoog-moleculair-gewicht (HMW) band met geen uitstrijkjes in het bereik van laag molecuulgewicht (LMW) moleculen.
  7. Selectievakje geïsoleerd RNA voor kwantiteit, zuiverheid en integriteit onder denaturerende omstandigheden door een guanidine kaliumthiocyanaat (GTC) agarose gelelektroforese of door capillaire elektroforese chip, volgens de instructies van de fabrikant.
    1. Bereiden de GTC gel door toevoeging van 5 mM AV aan een standaard 1 x TBE 1% agarose gel na afkoeling van de agar tot 60 ° C.
      Opmerking: AV is giftig, dus afzien van het in een zuurkast en passende persoonlijke beschermingsmiddelen dragen.
    2. Bereiden van RNA denaturering laden buffer: 95% formamide, 10 mM EDTA pH 8.0, 0,1% bromophenol blauw, 0,1% xyleen cyanole en 10 µL ethidiumbromide.
      Opmerking: Formamide en ethidium bromide zijn giftig, en moet worden afgeleverd in een zuurkast.
    3. Laden 1-5 µg totaal RNA in RNA denaturering laden buffer, warmte het mengsel gedurende 5 minuten bij 70 ° C, plaatst u deze op het ijs alvorens het te laden op een gel, en weer RNA worden gescheiden op GTC gel bij 100 V voor 45 min. Load DNA of RNA molecuulgewicht marker als een standaard naast het monster van RNA.
    4. De gels met ethidiumbromide vlek en visualiseren van de bands met behulp van image capture systemen onder UV-licht. In eukaryoten, intact totaal RNA draaien op de denaturering voorwaarden zal het tonen van ten minste twee scherpe en heldere rRNA bands (28 en 18S) met een intensiteit van 2:1 ratio.
  8. Verwijderen van sporen van gDNA door behandeling met DNase (DNase ik RNase-gratis). Toevoegen aan een RNase-gratis buis in 10 µL totale volume: 0,1 - 1 µg totaal RNA, één eenheid van DNase ik en 1 µL van 10 x reactie buffer met MgCl2. Incubeer het mengsel gedurende 30 minuten bij 37 ° C. Het beëindigen van de reactie door toevoeging van 1 µL van 50 mM EDTA en incuberen bij 65 ° C gedurende 10 minuten.
  9. Verwijder sporen van RNA uit extracten van de gDNA met behulp van DNase gratis RNase A, volgens protocol van de fabrikant. Voeg 5 µL van RNase 10 mg/mL tot het totale DNA en Incubeer bij 37 ° C gedurende 1 h. extracten van de winkel RNA en DNA bij-80 ° C.

2. primer Design van rDNA regio voor gDNA Assay

Opmerking: De volledige reeks van rDNA bevat twee regio's (ITS1 en ITS2), die in het volwassen rRNA molecuul worden verwijderd door een reeks van endonucleolytic breuklijnen en vervolgens afgebroken (Figuur 1).

  1. De volgorde van de nucleotide rDNA ophalen NCBI (http://www.ncbi.nlm.nih.gov) voor de soorten van belang. De beste sleutelwoorden voor het zoeken in de database is "interne getranscribeerde spacer."
  2. Ingang de doelgroep nucleotide sequentie in het zoeken van een BLASTn voor regio's vinden van interne getranscribeerde spacer regio's (ITS), SSU LSU bewaard.
  3. Selecteer inleidingen dat ofwel een reeks ITSs flank of die ITSs sequenties die niet aanwezig in de volwassen rRNA zijn versterken.
    1. Ontwerpen van inleidingen, de ITS1 of ITS2 opeenvolgingen flankerend: de geconserveerde gebieden van verschillende soorten door ClustalW uitlijnen. Ontwerp primers specifiek voor de begeleidende regio na taxa specifieke/Kruis-soorten analyse met AlleleID software. De twee primer paren uitdeinende SSU-5.8S en 5.8S-LSU waarbij kan worden ontworpen op basis van de flankerende gebieden van ITS1 en ITS2, respectievelijk. Omdat deze waarbij spanning in de hele regio ITS, de lengte van de amplicon zal worden verhoogd voor ten minste 300 bp in waarbij van gDNA. Deze stijging vermindert de gevoeligheid.
      1. Flankerende ITS1: Selecteer SSU en 5.8S rRNA volgorde. Geselecteerde inleidingen voor grassenfamilie zijn: SSU, SF: CGTAACAAGGTTTCCGTAGGTG, R: GGTTCACGGGATTCTGCAAT. Dit paar primer (SF: vooruit en R: omgekeerde) versterkt de gedeeltelijke regio van SSU, de gemiddelde lengte van ITS1 en de gedeeltelijke regio van 5.8S rDNA.
      2. Flankerende ITS2: Selecteer 5.8S en LSU volgorde. Geselecteerde inleidingen voor grassenfamilie zijn: F: ATTGCAGAATCCCGTGAACC LSU consensus volgorde, LR: TGCTTAAAYTCAGCGGGTAGYC. Dit paar primer versterkt de gedeeltelijke regio van 5.8S en de lengte van de ITS2, en de gedeeltelijke provincie LSU (Figuur 1).
        Opmerking: In het geval van primer ontwerp op basis van ITSs flankerende regio, de zeer geconserveerde gebieden van SSU, 5.8S en LSU werden geïdentificeerd. De voorwaartse en omgekeerde inleidingen van 5.8S rRNA werden ontworpen op basis van een geconserveerde motief in bedektzadigen14. De voorwaartse en omgekeerde inleidingen werden ontworpen gebaseerd op SSU en LSU geconserveerd regio's in de grassenfamilie, respectievelijk. Het verschil tussen SSU en LSU inleidingen voor elke soort is opgenomen in tabel 1.
    2. Inleidingen een reeks ITSs frequentiebanden te versterken: In dit protocol, ontwerp ITS1 primers op basis van Aeluropus de volgorde (NCBI taxid nummer: 110873). Voor primers, gebruiken: vooruit: GGTATGGCGTCAAGGAACACT, Reverse: ATAGCATCGCTGCAAGAGGT. Volgens de waarbij gegenereerd door de primer paren in silico, moet de grootte variëren van 60 tot 200 bp. Dit is tevens het aanbevolen formaat voor qPCR analyse.
  4. Kies de inleidingen bij het bestuderen van deze aanbevelingen: GC inhoud: 40-60%, primer lengte: 18-23 base, PCR product lengte: 60-160 bp (speciaal voor haar primer), smelttemperatuur (Tm): 60 ° C, de definitieve Tm voor beide inleidingen onderling geen verschillen meer dan 5 ° C en de prim ers zijn niet complementair is aan zichzelf of partner van inleidingen.
  5. Primer specificiteit en kopie nummer te controleren. In silico analyse van de geselecteerde primer volgorde uitvoeren door primer-blast programma (https://www.ncbi.nlm.nih.gov/tools/primer-blast/).
    1. Open de pagina Primer-BLAST indienen. Voer beide primer sequenties in de sectie parameters primer van het formulier. In de primer paar specificiteit sectie parameters controleren, voer een naam van het organisme (of de naam van de groep van het organisme) en selecteer het genoom Database. Deze instellingen geven de specificiteit-informatie over de volgorde en primer uitkomstmaten met inbegrip van product lengte, positie op chromosoom, en nummer kopiëren.

3. Voer qPCR stap voor de validatie van rDNA gebaseerde Primers met DNA-sjablonen

Opmerking: De functionaliteit van de ontworpen inleidingen moet worden gevalideerd door het uitvoeren van qPCR met behulp van gDNA als een sjabloon. Te voeren verschillende parallelle reacties en pipetting fouten verminderen, wordt de voorbereiding van een master mix aanbevolen. Voorbereiding voor een master mix, een volume gelijk is aan het totale aantal reactie mix plus ~ 10%.

  1. Bereid een master mix door het mengen van alle onderdelen van de reactie met uitzondering van de DNA-sjabloon in de buis van een PCR-reactie. Upscale zo nodig uit een reactie voor te bereiden op de Master-mix: 5 µL SYBR groen (SYBR) master mix (2 x), 0,3 µL primer (0,3 µM elke voorwaartse en omgekeerde primer), en het uiteindelijke volume aan 10 µL met RNase-gratis water. Gebruik ongeveer ≤200 ng in 1 µL van sjabloon gDNA voor analyse.
    Opmerking: Ontdooien, assembleren en houden alle reagentia, componenten en reactie mixes op ijs.
  2. Aliquot de Master mix in een optische 96-wells-plaat. Pipetteer 1 µL van gDNA aan elk putje en vervolgens bedekken met optische plaat verzegeling film. Spin en breng in cycler.
  3. Uitvoeren van de bepaling van de qPCR op een real-time thermische cycler onder de volgende voorwaarden: 10 min bij 95 ° C gevolgd door 40 cycli van 95 ° C voor 15 s en 60 ° C gedurende 1 min. uitvoeren data-acquisitie bij de 60 ° C gloeien/polymerisatie stap.
  4. Nadat de procedure is versterking, onderwerp alle PCR reacties op een smeltende analyse van de curve met continue fluorescentie-meting van 55 ° C tot 95 ° C. Typisch, verzamelen één gegevenspunt elke cyclus door een stapsgewijze verhoging van de temperatuur met 0.5 ° C per cyclus.
    Opmerking: Ten minste 2 niet-template besturingselementen (NTC) bevatten voor elke primer paar master mix. Alle testen in ten minste drie replicaties uitvoeren.
  5. Bevestig de specificiteit van de primer via de analyse van de kromme smelt. Analyseren van bochten met de drempel van één cyclus en afgetrokken kromme passen methode.
    Opmerking: Het uiterlijk van een scherpe individuele piek geeft een uniforme individuele amplicon. Primer dimeer producten kunnen worden weergegeven als afzonderlijke pieken bij lagere temperaturen.
  6. De grootte van elke amplicon valideren door agarose gelelektroforese.
    1. Bereid een 3% agarose gel door het mengen van 3 g agarose met 100 mL TBE buffer (TBE: 89 mM Tris, boorzuur 89 mM en 2 mM EDTA).
    2. Meng 5-10 µL van het PCR-product met DNA en 1-2 µL van 6 x laden buffer. Laden van PCR product naast een DNA-ladder op 3% agarose gel. Voer een elektroforetische scheiding in 1 x TRIS-boorzuur EDTA-buffer bij 100 V voor 45 min.
    3. De gels met ethidiumbromide of elke andere intercalating agent vlek en visualiseren van de bands met behulp van image capture systemen onder UV-licht.
      Opmerking: DNA intercalating agenten (b.v., ethidiumbromide) zijn kankerverwekkende en moeten worden met zorg behandeld en afzonderlijk aangeboden. Het uiterlijk van een unieke scherpe band (met betrekking tot de grootte en zonder primer-dimeer of kunstmatige achtergrond amplificatie) bevestigt de specificiteit van de amplicon.

4. gDNA besmetting Assay Procedure met RNA sjablonen

Opmerking: Na behandeling met DNase, de gezuiverde RNA monster wordt getest door rDNA-specifieke primers. Als gevolg van de verwerking van de intron-achtige functie van ITSs wanneer deze regio's worden gebruikt voor amplificatie, geen versterking signaal moet worden gevonden in RNA DNA-gratis monsters. Op basis van deze, als een signaal versterking in qPCR wordt gevonden of een band in de agarose gel met de verwachte grootte (naar schatting door in silico analyse) waargenomen, dat dit zou te wijten zijn aan gDNA besmetting. De stappen in dit gedeelte uitgevoerd zijn vergelijkbaar met sectie 3, behalve dat van alle monsters cDNA wordt gebruikt als sjabloon in plaats van gDNA.

  1. Bereid een master mix door het mengen van alle onderdelen van de reactie met uitzondering van RNA sjabloon in de buis van een PCR-reactie. Meester mix combinatie voor een reactie: 5 µL SYBR master mix (2 x), 0,3 µL primer (0,3 µM elke voor voorwaartse en omgekeerde primer mix), en het uiteindelijke volume aan 10 µL met RNase-gratis water. Gebruik ongeveer 500 ng sjabloon RNA in 1 µL volume voor analyse.
  2. Aliquot de master mix in een optische 96-wells-plaat. Pipetteer 1 µL RNA aan elk putje en vervolgens bedekken door optische plaat verzegeling film. Centrifuge en plaats in de cycler.
    Opmerking: Omvatten ten minste twee besturingselementen van de NTC en twee positieve gDNA voor elke assay. Alle testen in drie technische replicaties uitvoeren.
  3. Uitvoeren van de bepaling van de qPCR op een Real-time thermische cycler onder de volgende voorwaarden: 10 min bij 95 ° C gevolgd door 40 cycli van 95 ° C voor 15 s en 60 ° C gedurende 1 min. uitvoeren data-acquisitie bij de 60 ° C gloeien/polymerisatie stap.
  4. Nadat de procedure is versterking, onderwerp alle PCR reacties op een smeltende analyse van de curve met continue fluorescentie-meting van 55 ° C tot 95 ° C. Meestal, verzamelen één gegevenspunt elke cyclus door een stapsgewijze verhoging van de temperatuur met 0.5 ° C per cyclus.
  5. Controleer alle PCR producten door te voeren op 3% agarose gel elektroforese.
    Opmerking: De verschijning van de band of de piek in de reactie van de NTC is waarschijnlijk gerelateerd aan primer-dimeer vorming die meestal bij lage temperaturen in de smeltende curve, gezien wordt terwijl de aanwezigheid van een band of piek in RNA monsters het resultaat van gDNA besmetting is. Het is aanbevolen om de eerste testopnames alle RNA door rDNA gebaseerde inleidingen, en dan niet-DNA-monsters besmet worden gebruikt voor downstream toepassingen zoals cDNA synthese, gen expressie analyse, enz.

5. RT-PCR stap voor cDNA synthese en qPCR analyse

  1. Ontdooien DNase-RNA en de cDNA synthese reagentia behandeld bij kamertemperatuur. Na het ontdooien, spin down de reagentia. Voeg 1 µg voor RNA en 1 µL van Oligo (dT) 18 primer in een buis nuclease-vrij. Het totale volume van 12 µL met RNase-gratis water, meng zachtjes, en sla op ijs.
  2. Smelten van secondaire structuren van RNA sjabloon door het broeden van de reactie bij 65 ° C gedurende 5 min. Spin down en koel het flesje op ijs.
  3. Bereiden de reactie master mix (eindvolume 20 µL voor elke reactie) als volgt: 1 µL van reverse-transcriptase (200 U/µL), 4 µL van reactie buffer (5 x), 1 µL van RNase remmer (20 U/µL) en 2 µL van dNTP Mix (10 mM). Meng voorzichtig en koel het flesje op ijs. Voeg 19 µL in de bereid buis met RNA.
  4. Incubeer de reactie voor 60 min op 42 ° C, en vervolgens uit te broeden bij 70 ° C gedurende 5 minuten tot beëindiging van de activiteit van de reverse-transcriptase. Plaats de RT-reacties op het ijs en ga naar gen expressie analyse door routine qPCR procedure (zoals uitgelegd in sectie 3 en 4).

Representative Results

Wij stellen voor het gebruik van rDNA gebaseerde inleidingen voor het valideren van de afwezigheid van besmetting van de gDNA in RNA monsters van weefsel van het blad. Het stroomdiagram van qPCR analyse en gDNA besmetting assay is afgebeeld in Figuur 2. In het voorgestelde protocol, twee complementaire strategieën werden gebruikt voor primer rDNA gebaseerde ontwerp: 1) soortspecifieke inleidingen werden geselecteerd uit ITSs sequenties en 2) universele inleidingen werden geselecteerd uit ITSs flankerende gebieden. Voor bewijs-van-concept ontwierpen we primers specifiek voor Aeluropus littoralis, en universele inleidingen op basis van de grassenfamilie soorten, als bepaald in het protocol. De 5.8S voorwaartse en omgekeerde inleidingen werden geselecteerd op basis van een geconserveerde 14 basenpaar (bp) motief dat gelijkenis tussen bloeiende planten, bryophytes en meerdere orders van algen en schimmels14 toont. De kenmerken van ontworpen inleidingen zijn gegeven in tabel 2. De universaliteit van SSU, 5.8S en LSU primer werden gecontroleerd door BLASTn en primer homologie resultaten worden gepresenteerd in Figuur 3 als een motief-logo. De lijst van soorten opgenomen in de analyse van de homologie, alsmede de uiteenlopende inleidingen voor elke soort worden gegeven in tabel 1. Primer specificiteit was controle door Primer-BLAST. Voor de soorten waar het hele genoom beschikbaar is, werd de chromosomale locatie van rDNA genen geschat. Bijvoorbeeld, in Oryza sativa en Arabidopsis thaliana, rDNA bevinden genen zich op twee verschillende chromosomen, en in Zea mays op drie verschillende chromosomen.

qPCR validatie van rDNA gebaseerde primers werd uitgevoerd met het smelten van de kromme analyse van ITS1 en ITS2-flank waarbij DNA als sjabloon gebruiken. Zoals gepresenteerd in Figuur 4 en Figuur 5, primer specificiteit werd experimenteel bevestigd door de waarneming van een enkele scherpe piek met geen primer-dimeer vorming in verschillende grassenfamilie plantensoorten, waaronder Triticum aestivum, Hordeum vulgare, Oryza sativa, en in de dicots Medicago sativa, Cucumis sativus, Nicotiana tabacum Trifolium alexandrinum, Vicia fabaen Arabidopsis thaliana. De nieuwe test van de amplificatie producten door de grootte van de elektroforetische scheiding toonde een unieke band. Zoals verwacht, de banden afgeleid van monsters van de verschillende soorten variëren in grootte (figuur 6A en 6B). Interessant is dat het gebruik van de universele inleidingen, speciaal ontworpen voor de drie soorten van de grassenfamilie zijn niet alleen nuttig voor andere soorten van de grassenfamilie, maar ook voor andere plantensoorten zoals A. thaliana, en voor een endophytic schimmel viz. Piriformospora indica.

De geldigheid van de ontworpen specifieke primer (ITS1) werd ook bevestigd door qPCR in A. littoralis gDNA als sjabloon gebruiken. Een enkele piek met geen primer-dimeer vorming werd waargenomen. Verrassend, de A. littoralis ITS1 primer (als de specifieke primer) gegenereerd een enkele scherpe band niet alleen in A. littoralis, maar ook voor alle andere soorten getest met uitzondering van Nicotiana tabacum en Trifolium alexandrinum, die geproduceerd twee bands (Figuur 6 c). De gDNA besmetting assay werd uitgevoerd door ITS of ITS-begeleidende inleidingen in alle RNA monsters. Een schematische weergave van de plaat van de versterking in de gDNA besmetting bepaling en de interpretatie van resultaten is gepresenteerd in Figuur 7.

Figure 1
Figuur 1: Het algemene patroon van eukaryotische rDNA reeks organisatie.
De eukaryotische rDNA segment bevat 17-18S (rood), 5.8S (blauw) en 25-28 rRNA (roze). De interne getranscribeerde spacers (ITS) worden aangeduid als zwarte lijnen. 5´and 3´ geven de richting van de DNA-molecule. Klik hier voor een grotere versie van dit cijfer.

Figure 2
Figuur 2: Workflow voor een RT-qPCR en gDNA besmetting assay. Klik hier voor een grotere versie van dit cijfer.

Figure 3
Figuur 3: Motif logo van A. SSU, B. 5.8S en C. LSU primer homologie. Voor SSU, 5.8S, en LSU primers, het motief-logo werd gebouwd door de BLASTn op basis van 2.000 groene plant records (NCBI taxid nummer: 33090) met een licht-donkerscheiding e-waarde ≤10-10. A-Adenine, Thymine-T, G-Guanine, C-Cytosine. Klik hier voor een grotere versie van dit cijfer.

Figure 4
Figuur 4: De smelt kromme analyse van ITS1-begeleidende amplicon in verschillende soorten.
Deze amplicon, versterkt door SSU en 5.8S-R primers, bevat een deel van de reeks van de 17-18S coderen regio, de hele reeks van ITS1 en partiële sequentie van 5.8S. Getoond worden de smeltende curven van waarbij gegenereerd (roze) en NTC (rood) vanaf Triticum aestivum Hordeum vulgare, Oryza sativa, Medicago truncatula, Cucumis sativus, Nicotiana tabacum, Trifolium alexandrinum, Vicia fabaen Arabidopsis thaliana, Piriformospora indica. De vlakke vet lijn geeft de drempel van de basislijn. Klik hier voor een grotere versie van dit cijfer.

Figure 5
Figuur 5: De smelt kromme analyse van ITS2-begeleidende amplicon in verschillende soorten.
Deze amplicon wordt gegenereerd door het gebruik van 5.8S-F en LSU inleidingen. De beschreven amplicon bevat sequenties van deel van 5,8 S, de hele reeks ITS2 en een partiële sequentie van 25-28. Getoond worden de smeltende curven van waarbij (groen) en NTC (rood) gegenereerd op basis van Triticum aestivum Hordeum vulgare, Oryza sativa, Medicago truncatula, Cucumis sativus, Nicotiana tabacum, Trifolium alexandrinum, Tuinboon, Arabidopsis thaliana en Piriformospora indica. Klik hier voor een grotere versie van dit cijfer.

Figure 6
Figuur 6: Agarose gel analyse van rDNA gebaseerde PCR product.
De amplicon van ITS1-flanken (A), ITS2-flanken (B), en ITS1 (C) werden uitgevoerd op 3% agarose gel. Klik hier voor een grotere versie van dit cijfer.

Figure 7
Figuur 7: Intron-achtige kenmerken van ITSs kunnen worden beschouwd als ontwerpen van inleidingen die gDNA besmetting kunnen detecteren.
Een piek of de band met de verwachte grootte in qPCR analyse geven gDNA besmetting in het RNA-monster. UNK: onbekend monster, pos: positieve controle, NTC: niet-sjabloon controle. Klik hier voor een grotere versie van dit cijfer.

Primer Geslacht Taxid ID Soorten Uiteenlopende primer
SSU Arabidopsis 3701 kamchatica, thaliana en lyrata -
Vicia 3904 villosa americana, unijuga, amoenane, amurensis, craccamal, pseudo-orobus, multicaulis, japonica, ramuliflora en faba
Trifolium 3898 Alexandrinum, montanum resupinatum en repens -
Nicotiana 4085 tabacum, benthamiana, otophora, picilla, bigelovii, palmeri, tomentosiformis, tomentosa, digluta, kawakamii, clevelandii, nesophila, solanifolia, cordifolia, debneyi, arentsii, thyrsiflora, wigandioides, undulata, Els, noctiflora, petunioides, obtusifolia, miersii, pauciflora, verzachten, acuminata linearis alata, sylvestris, rustica en suaveolens -
Cucumis 3655 anguria, melo en sativus CGTAACAAGGTTTCCGTAGGKG
Aeluropus 110873 - Geen primer gevonden
Rupsklaver 3877 Sativa, lupulina, pamphylica, lunata, rostrate, plicata en truncatula -
Oryza 4597 Sativa, glumipatula, rufipogon barthii glaberrima punctate, longistaminata, olifant, nivara, olifant en longistaminata -
Triticum 4564 aestivum urartu en monococcum -
Hordeum 4512 vulgare bulbosum, marinum, brevisubulatum en bogdanii -
LSU Arabidopsis 3701 petraea thaliana en lyrata TGCTTAAACTCAGCGGGTAATC
Vicia 3904 sylvatica, tetrasperma, sativa, oorlogszuchtig, sepium, parviflora, cracca, lathyroides, orobus, orobus, bithynica en faba TGCTTAAATTCAGCGGGTAGCC
Trifolium 3898 pretentie nigrescens, resupinatum, occidentale, klaver, strictum, ochroleucon, glomeratum, squamosum, ornithopodioides en repens TGCTTAAATTCAGCGGGTAGCC
Nicotiana 4085 tabacum, benthamiana, otophora, picilla, bigelovii, palmeri, tomentosiformis, tomentosa, digluta, kawakamii, clevelandii, nesophila, solanifolia, cordifolia, debneyi, arentsii, thyrsiflora, wigandioides, undulata, Els, noctiflora, petunioides, obtusifolia, miersii, pauciflora, verzachten, acuminata linearis, alata, sylvestris en suaveolens TGCTTAAACTCAGCGGGTAGTC
Cucumis 3655 Melo, ritchiei en javanica TGCTTAAACTCAGCGGGTAGTC
Aeluropus 110873 lagopoide pungens en littoralis TGCTTAAATTCAGCGGGTAATC
Rupsklaver 3877 ruthenica sativa lupulina, arabica, polymorpha en minima TGCTTAAATTCAGCGGGTAGCC
pamphylica lunata, rostrate en plicata TGCTTAAACTCAGCGGGTAGTC
Oryza 4597 Sativa, glumipatula, rufipogon, barthiial, glaberrima, australiensis, officinalis australiensis, ridleyi, malampuzhaensis, alta, nivara, rufipogon, olifant en longistaminata TGCTTAAACTCAGCGGGTAGTC
Triticum 4564 aestivum, Spelta, turgidum, dicoccoides, petropavlovskyi, urartu en monococcum TGCTTAAACTCAGCGGGTAGTC
Hordeum 4512 Margriet, bulbosum, murinum, secalinum, brevisubulatum en bogdanii TGCTTAAACTCAGCGGGTAGTC
Een gedegenereerde primer is gedefinieerd als IUPAC-systeem voor nucleotide nomenclatuur

Tabel 1: De lijst van soorten beschouwd voor het plukken van rDNA gebaseerde inleidingen.
SSU bindende site in vergelijking met de LSU bindende site toonde hogere reeks homologie over gegeven geslacht.

Amplicon lengte Gebied van de versterking Volgorde De naam van de primer Amplicon
332 - 405 bp Partiële sequentie van SSU, hele opeenvolging van ITS1 en partiële sequentie van 5.8S CGTAACAAGGTTTCCGTAGGTG SSU ITS1-flanken
GGTTCACGGGATTCTGCAAT 5.8S-R
318 - 361 bp Partiële sequentie van 5.8S, hele opeenvolging van ITS2 en partiële sequentie van LSU ATTGCAGAATCCCGTGAACC 5.8S-F ITS2-flanken
TGCTTAAAYTCAGCGGGTAGYC LSU
100 - 200 bp ITS1 GGTATGGCGTCAAGGAACACT ITS1-F ITS1
ATAGCATCGCTGCAAGAGGT ITS1-R

Tabel 2: Primer sequenties.

Discussion

Gen expressie analyse door kwantitatieve PCR heeft grote schaal toegepast in de afgelopen jaren. Het belangrijkste voordeel van deze snelle, rendabele en geautomatiseerde methode is het precies en nauwkeurig resultaat. Het verkrijgen van optimale voordelen van deze voordelen vereist echter een duidelijk inzicht in de installatie van de parameters die worden gebruikt voor de qPCR-experiment. Voor het ontvangen van een betrouwbaar resultaat in qPCR gen expressie analyse, is het noodzakelijk om te voorkomen dat de niet-specifieke versterking die uit verontreiniging van de primer-dimeer of gDNA in de RNA monster3,15 voortvloeit. Verwacht wordt dat de RNA transcriptie niveaus onder gDNA besmetting8zal worden overschat. Hier, de unieke kenmerken van een gen rDNA werd geacht voor een gDNA besmetting assay in RNA monsters.

Basiseigenschappen van het rDNA in dit protocol gebruikt: Ribosomal genen bestaan uit de twee ITSs, namelijk ITS1 en ITS2 en de drie codering rRNA-genen, 17-18S, 5.8S, en 25-28 subeenheid12. De twee ITS regio's maken geen deel uit van de codering opeenvolging van de ribosomal subeenheden. Ze worden verwijderd door ten minste drie enzymatische activiteiten voor het verwerken van de voorloper om oudere rRNA: een endonuclease, helicase en exonuclease activiteit. Zoals het ribosomaal RNA wordt omgezet als een afschrift van het polycistronic, is een primair product met de ITSs zeker aanwezig. De verwerking is erg snel en in de nucleolus plaatsvindt, en het bedrag van de voorloper van de detecteerbare moleculen bevat de ITS lager is dan de detectiegrens van de qPCR-methode. Daarom, wanneer ITS1 of ITS2 worden versterkt door ITS flankerende inleidingen, geen versterking kan worden opgespoord in RNA monsters tenzij gDNA besmetting aanwezig is. Het aantal rDNA genen in de genoom van eukaryote organismen werd geraamd op maximaal duizend exemplaren, die zijn gerangschikt in enkele of tandem arrays op de chromosomen11bevatten. In dit protocol stellen we een alternatieve manier, in plaats van NRT, om het detecteren van gDNA vervuiling, die wordt gebruikt in elke reactie/assay.

Voordelen en beperkingen met betrekking tot bestaande methoden: NRT wordt meestal gebruikt om te testen of het voorbereide monster van RNA schoon of daarmee verontreinigd gDNA is. Aangezien gDNA besmetting is niet gelijkmatig verdeeld tussen de verschillende monsters van RNA, en de reactie gevoeligheid voor gDNA wordt sterk beïnvloed door de genen geanalyseerd, zijn NRT-besturingselementen vereist voor elk monster/assay paar7,15. Dit zal aanzienlijk kosten toevoegen en arbeid bij het verwerken van vele monsters tegelijk3,9. Andere alternatieve methoden beschreven in de literatuur omvatten het gebruik van intron specifieke primers voor de detectie van gDNA, of ontwerpen inleidingen die een intron flank of omvatten een exon-exon-knooppunt. De beperkingen van deze methoden vloeien voort uit de onbeschikbaarheid van intron opeenvolgingsinformatie onvolledig aantekening van intron/exon structuur en het ontbreken van introns in genen of pseudogenes voor belang1,4,10 . Als gevolg van de evolutie bestaan rDNA genen als multigene en zeer geconserveerde gene gezinnen. Ze zijn zeer overvloedig in het genoom en op verschillende chromosomen13aanwezig. Vergeleken met andere genen coderen of nonconding, Toon de genen rDNA het beste geschikt voor detectie van gDNA besmetting. In de vergelijkende transcriptomic analyses, de normalisering van de qPCR gegevens door rRNA kalibrator is niet aanbevolen voor enkele problemen, zoals verschillen in cDNA voorbereiding (polyA priming vs. willekeurige hexamer priming), grote verschillen in overvloed rRNA en mRNA , en verschillende biogenese die misleidende genereren kan resultaten10,16. De problemen die we hebben zojuist genoemd zijn echter een voordeel voor de gDNA besmetting assay. Bijvoorbeeld met betrekking tot hogere targeting site overvloed in het genoom, en lokalisatie op verschillende chromosomen verbeteren rDNA gebaseerde inleidingen aanzienlijk de gevoeligheid van de detectie van gDNA in vergelijking met bestaande methoden.

Versality van het rDNA gebaseerde aan andere organisme: rDNA genen zijn een familie van de goed bestudeerde gen geïdentificeerd in de meeste organismen. De voorgestelde rDNA gebaseerde methode vertegenwoordigt een eenvoudige, zeer gevoelige en economische systeem voor gDNA besmetting testen die kan gemakkelijk aangepast aan andere eukaryotische en prokaryote organismen (Protocol 2 - 5 worden). Als een case-studie, we hebben hier laten zien het nut van deze methode in sommige soorten van de Poceae (Figuur 4 en Figuur 5). De gebruikte inleidingen tonen een hoge mate van overdraagbaarheid naar andere soorten van de Poceae als gevolg van de zeer geconserveerde structuur van rDNA subeenheden tussen soorten. Dit probleem wordt nog belangrijker wanneer voldoende genomic opeenvolgingsinformatie niet beschikbaar voor primer design is. ITS-begeleidende inleidingen ontworpen voor één soort kunnen dus worden gebruikt in een verwante soorten. Ook de 5.8S-F/R inleidingen werden geplukt op basis van een geconserveerde motief waarin hoge gelijkenis in meeste bedektzadigen14. Hoewel high throughput sequencing technieken permanent het aantal bekende genoom verhogen, de exon-intron aantekening van de meeste organismen is niet voltooid, en dus is het vaak niet mogelijk om het ontwerpen van inleidingen over een exon-exon grens worden verdeeld. Onze methode wordt uitgelegd hoe rDNA gebaseerde inleidingen voor de gDNA besmetting assay in qPCR analyse van prokaryoten en eukaryoten, met het doel van de afschaffing van de dure NRT besturingselementen in elke combinatie assay/primer kan worden toegepast.

Disclosures

De auteurs hebben geen concurrerende financiële belangen.

Acknowledgments

Dit onderzoek werd gesteund door de genetische en agrarische biotechnologie Instituut van Tabarestan (GABIT), Sari landbouwwetenschappen en natuurlijkehulpbronnen Universiteit (SANRU). De junior onderzoeksgroep abiotische Stress Genomics werd gefinancierd door IZN (Interdisciplinair Centrum voor gewas plantenonderzoek, Halle (Saale), Duitsland. Wij danken Rhonda Meyer voor kritische lezing van het manuscript.

Materials

Name Company Catalog Number Comments
Maxima SYBR Green / ROX qPCR Master Mix (2X) Thermo Scientific K0221
TissueLyser II QIAGEN 85300
RevertAid H Minus First Strand cDNA Synthesis Kit Thermo Scientific K1631
GeneRuler 100 bp Plus DNA Ladder Thermo Scientific SM0321
96 well WHT/CLR Bio-Rad HSP9601
Microseal B film Bio-Rad MJ-0558
Low tube strip CLR Bio-Rad TLS0801
Flat cap strips Bio-Rad TCS0803
NanoDrop 2000 Peqlab ND-2000
RNaseZAP Ambion 9780
Centrifuge Eppendorf 5810 R
Agilent RNA 6000 Nano Kit Agilent Technologies 5067-1511
2100 Electrophoresis Bioanalyzer Agilent Technologies G2939AA
RNase A, DNase and Protease-free Thermo Scientific EN0531
DNase I, RNase-free Thermo Scientific EN0523
TRIZOL Reagent Ambion 15596026
CFX96 Touch Real-Time PCR Detection System BIO RAD 1855195
PCR tube, 0.2 mL, RNase-free Stratagene Z376426
Guanidine thiocyanate for molecular biology Sigma-Aldrich G9277
Agarose - Nucleic Acid Electrophoresis Sigma-Aldrich A9414
Boric Acid for molecular biology AppliChem A2940
bromophenol blue AppliChem A2331
ethidium bromide AppliChem A1151
Gel documentation system BIO RAD Gel Doc 2000

DOWNLOAD MATERIALS LIST

References

  1. Bustin, S. A., Nolan, T. Pitfalls of quantitative real-time reverse-transcription polymerase chain reaction. J Biomol Tech. 15, (3), 155-166 (2004).
  2. Gutierrez, L., Mauriat, M., Pelloux, J., Bellini, C., Van Wuytswinkel, O. Towards a systematic validation of references in real-time RT-PCR. Plant Cell. 20, (7), 1734-1735 (2008).
  3. Hashemi, S. H., Nematzadeh, G., Ahmadian, G., Yamchi, A., Kuhlmann, M. Identification and validation of Aeluropus littoralis reference genes for Quantitative Real-Time PCR Normalization. J Biol Res (Thessalon). 23, (1), 18 (2016).
  4. Bustin, S. A. Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. J. Mol. Endocrinol. 25, (2), 169-193 (2000).
  5. Andersen, C. L., Jensen, J. L., Orntoft, T. F. Normalization of real-time quantitative reverse transcription-PCR data: a model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res. 64, (15), 5245-5250 (2004).
  6. Bustin, S. A., et al. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin Chem. 55, (4), 611-622 (2009).
  7. Laurell, H., et al. Correction of RT-qPCR data for genomic DNA-derived signals with ValidPrime. Nucleic Acids Res. 40, (7), e51 (2012).
  8. Galiveti, C. R., Rozhdestvensky, T. S., Brosius, J., Lehrach, H., Konthur, Z. Application of housekeeping npcRNAs for quantitative expression analysis of human transcriptome by real-time PCR. RNA. 16, (2), 450-461 (2010).
  9. Laurell, H., et al. Correction of RT-qPCR data for genomic DNA-derived signals with ValidPrime. Nucleic Acids Res. 40, e51 (2012).
  10. Caldana, C., Scheible, W. R., Mueller-Roeber, B., Ruzicic, S. A quantitative RT-PCR platform for high-throughput expression profiling of 2500 rice transcription factors. Plant Methods. 3, (1), 7 (2007).
  11. Lawrence, R. J., Pikaard, C. S. Perspectives Chromatin Turn Ons and Turn Offs of Ribosomal RNA Genes. Cell Cycle. 3, (7), 880 (2004).
  12. Boisvert, F. M., van Koningsbruggen, S., Navascues, J., Lamond, A. I. The multifunctional nucleolus. Nat Rev Mol Cell Biol. 8, (7), 574-585 (2007).
  13. Alvarez, I., Wendel, J. F. Ribosomal ITS sequences and plant phylogenetic inference. Mol Phylogenet Evol. 29, (3), 417-434 (2003).
  14. Jobes, D. V., Thien, L. B. A conserved motif in the 5.8 S ribosomal RNA (rRNA) gene is a useful diagnostic marker for plant internal transcribed spacer (ITS) sequences. Plant Mol Biol Report. 15, (4), 326-334 (1997).
  15. Padhi, B. K., Singh, M., Huang, N., Pelletier, G. A PCR-based approach to assess genomic DNA contamination in RNA: Application to rat RNA samples. Anal Biochem. 494, 49-51 (2016).
  16. Dheda, K., et al. Validation of housekeeping genes for normalizing RNA expression in real-time PCR. Biotechniques. 37, (1), 112-114 (2004).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics