Ribosomal DNA에 따라 RNA 샘플에서 DNA 오염 평가

Genetics
 

Summary

여기, 선물이 RNA 샘플에 게놈 DNA (gDNA) 오염 추적에 대 한 프로토콜. 제시 방법 뇌관 특정 ribosomal DNA (rDNA) 유전자의 내부 베낀된 공백 지역 (ITS)을 활용합니다. 메서드는 대부분의 진핵생물과 원핵생물에서 DNA 오염의 안정적이 고 민감한 검출에 적합 합니다.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Hashemipetroudi, S. H., Nematzadeh, G., Ahmadian, G., Yamchi, A., Kuhlmann, M. Assessment of DNA Contamination in RNA Samples Based on Ribosomal DNA. J. Vis. Exp. (131), e55451, doi:10.3791/55451 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

진 식 변화와 성적 나타났는데의 정량화에 대 한 광범위 하 게 사용 하는 한 가지 방법은 반전 전사 양적 실시간 PCR (RT-정량)입니다. 그것은, 민감한, 신뢰할 수 있는, 정확 하 고 재현 가능한 결과를 제공합니다. 여러 가지 요인 감도 실시간 정량 Pcr의 특이성을 달라질 수 있습니다. 잔여 genomic DNA (gDNA) RNA 샘플 오염 그들 중 하나입니다. 유전자 표정 분석에서 gDNA 오염으로 인해 일반적인 증폭 사본 레벨의 풍부를과 대 평가 것입니다 하 고 실시간 정량 결과 영향을 미칠 수 있습니다. 일반적으로, gDNA qRT-PCR에 의해 검출 된다 intergenic 지역 또는 관심사의 유전자의 intron 어 닐 링 쌍 뇌관을 사용 하 여. 불행히도, intron/exon 주석 알려져 있지 않습니다 아직 모든 유전자에 대 한 척추, 박테리아, 원생 생물, 균 류, 식물, 및 무척 추 동물 metazoan 종에서.

RNA에서 gDNA 오염 탐지 ribosomal DNA (rDNA)을 사용 하 여 샘플에 대 한 프로토콜 여기 제시-뇌관을 기반으로. 메서드는 rDNA의 독특한 기능에 기반으로: 그들의 multigene 자연, 높은 보존된 시퀀스, 그리고 게놈에 높은 주파수. 또한 사례 연구로 서 뇌관의 고유한 집합 Poaceae 가족에서 ribosomal DNA (rDNA)의 보존된 지역에 따라 설계 되었습니다. 이 뇌관 쌍의 보편성은 용융 곡선 분석 및 agarose 젤 전기 이동 법에 의해 시험 되었다. 우리의 방법에 설명 합니다 있지만 어떻게 rDNA 기반 뇌관, Poaceae 가족에서 gDNA 오염 분석 결과 대 한 적용할 수 있습니다. 다른 원핵생물과 진핵생물 종에 쉽게 사용 될 수

Introduction

재미 있는 유전자 세트 또는 신호 네트워크의 transcriptional 규칙을 탐구 생물 학적 이벤트1에 관련 된 복잡 한 분자 메커니즘을 이해 하는 것 필수적 이다. 현재, 정량 분석은 가장 널리 사용 되는 접근 유전자 표현 연구 (게놈) DNA 또는 RNA (transcriptome) 대상 수 각각 methylome 및 transcriptome 분석을 허용 하는. 반전 녹음 방송 (RT) 정량 다음 transcriptome 분석 생물학 연구2의 다양 한 분야에서 유전자 식 수준을 측정 하는 널리 사용 됩니다. 다른 전통적인 북부 교 잡 같은 방법, 조직에 제자리 교 잡, ribonuclease 보호 분석 실험 (RPA) 및 세미-RT-PCR, 정확도, 편의 속도, 및의 넓은 동적 범위를 통해 특정 검색에 비해 정량 Pcr 기반 분석 실험은 매우 놀라운3,4. 메신저 RNA (mRNA), RNA 시작 물자의 양과 품질 등의 신뢰할 수 있는 정량화에 대 한 고려해 야 할 몇 가지 중요 한 요인이 있다. 또한, 일반적인 증폭, 실시간 정량 Pcr의 효율성 및 PCR 효율5,6간주 해야 합니다.

GDNA의 존재는 고유의 문제입니다 RNA 추출 시 인해, 부분적으로, DNA와 RNA7의 유사한 육체 및 화학 재산에. GDNA 및 보완 DNA (cDNA) mRNA 샘플에서 파생 된 시퀀스 id, 때문에 일반적인 확대는 실시간 정량 Pcr 결과의 정확도 영향을 미칠 것입니다 발생할 수 있습니다. 나머지 gDNA의 풍요로 움과 이어질 것입니다 유전자 표정 분석8에서 mRNA를 대상.

기본적으로, 일반적인 amplicon 뇌관 이합체 형성 또는 불특정 배경 증폭 gDNA, 둘 중 적절 한 컨트롤 샘플을 사용 하 여 평가 될 수 있다 때문에에서 주로 발생 한다. 이러한 샘플은 서식 파일 제어 (NTC)와 역전사 제어 (NRT), 각각. 공부 되 고 샘플에서 gDNA 오염 수준의 다른 gDNA 향해 감도 분석 유전자 사이 크게 다릅니다 때문에, NRT 컨트롤은 각 샘플/분석 결과 쌍에 대 한 필요. 이 실질적으로 비용 및 실시간 정량 프로 파일링 연구에 노동 증가 시키지만, 이러한 컨트롤은 필요한7,9.

Intergenic 지역 또는 관심10, 유전자와 큰 intron 측면 또는 스팬 엑손-엑손 교차점, 즉, 뇌관의 사용의 intron 단련 하는 뇌관 쌍의 사용을 포함 하는 gDNA 오염 처리 방법 어 닐 링 사이트는 성숙한 mRNA에서 시퀀스1,4. 그러나, 많은 등뼈 동물, 박테리아, 원생 생물, 균 류, 식물, 및 metazoan 무척 추 동물 종에서 모든 유전자의 intron/exon 주석 아직 알려져 있습니다. 또한, 많은 진 핵 유기 체 pseudogenes 중복 이벤트에서 파생 된 있다. 또한, 뇌관 디자인 introns에 걸쳐 증폭 gDNA 보장 하지 않습니다. 염색 질으로 DNase 를 게놈 지역 접근성 다릅니다, 것이 좋습니다 다른 염색체10를 대상으로 하는 다른 뇌관 쌍을 디자인.

진 핵 생물의 게놈 ribosomal 소 단위 리보솜의 형성에 필요한 인코딩 rDNA 유전자의 한 천 부까지 포괄 수 있습니다. 이러한 rDNA 유전자 종종 단일 또는 탠덤 반복 배열11구성 됩니다. Polycistronic rRNAs (그림 1) 큰 소 단위 (LSU) 등 작은 소 단위 (SSU)는 RNA 중 합 효소에 의해 복사할 수 난 (RNA pol I). 결과 사전 rRNAs ITS1와 ITS2 두 내부 베낀된 공백 영역을 제거 하 여 추가로 처리 됩니다. 최종 제품으로 3 성숙 rRNAs, 17-18S rRNA (SSU), 5.8S, 및 25-28S rRNA (LSU)는 생성 된12. rDNA 유전자는 매우 보존 시퀀스 multigene 가족의 전형적인 대표자. 그들은 게놈에 고주파 발생 되며 하나 이상의 염색체 위치13에 잠재적으로 존재. rRNA의 처리와 베낀된 스페이서의 저하는 핵소체에서 빠른 프로세스입니다. 반복성의 높은 학위 때문 게놈 사본 수와 감지 처리 RNA premolecules의 비율 낮은 복사 intron 시퀀스 및 unspliced 유도체에 비해 낮은. 이러한 기능 대부분의 진핵생물과 원핵생물3에서 gDNA 오염의 안정적이 고 매우 민감한 탐지 적합 rDNA 유전자 확인 합니다.

여기 RNA 샘플에서 gDNA 오염 검출을 위한 새로운 절차 설명 되어 있습니다. 보편적인 뇌관 rDNA 보존 순서에 따라 집합 여러 Poaceae 종에서 gDNA 분석에 대 한 제공 됩니다. 특이성 및 제안 된 뇌관의 템플렛으로 DNA를 사용 하 여 용융 곡선 분석에 의해 시험 되었다. 우리의 프로토콜만 Poaceae, 적용 되지 않습니다 하지만 다른 진 핵 prokaryotic 종에도 쉽게 적용할 수 있습니다.

Protocol

참고: 모든 조직을 사용할 수 있습니다.

1. 핵 산 추출

  1. 조직 샘플의 100 mg 2.0 mL 튜브에 넣어 두 5 m m 스테인리스 구슬을 추가 하 고 30에 대 한 25-30 Hz에서 조직 균질 RNA와 DNA에 대 한 s (균질 기간 및 조직 유형에 따라 주파수).
  2. 제조업체의 지침에 따라 총 RNA 격리.
  3. 제조업체의 지침에 따라 전체 DNA를 분리.
  4. 260와 280 nm에서 흡 광도 측정 하 여 고 순도 RNA 샘플의 수량을 제어 합니다.
  5. 260와 280 nm에서 흡 광도 측정 하 여 순도 및 DNA 샘플의 수량을 제어 합니다.
    참고: 동안 260의 파장으로 빛을 흡수 하는 핵 산 (A260), 파장 280에 빛의 흡 광도 (A280) 단백질의 양을 계량 하는 데 사용할 수 있습니다 및 페 놀 샘플에 존재. 따라서, A260/A280 nm의 비율 DNA와 RNA 샘플에서 추출한 순도 평가 하기 위해 사용할 수 있습니다. ≥1.8의 범위에서 A260/280 값 및 > 2.0 일반적으로 각각 DNA와 RNA, "순수한" 것 여겨진다. A260/280 값이 낮은 단백질 이나 유기 화학 물질에 의해 오염을 나타낼 수 있습니다.
  6. 0.7 %agarose 젤 전기 이동 법을 실행 하 여 DNA의 품질을 테스트 합니다. 젤을 준비 하 고 트리 스 붕 소 EDTA-버퍼 x 1에서 실행 (TBE: 89 mM Tris, 89 m m 붕 소 산, 그리고 2 mM EDTA) 100 V에서 30 분 높은 품질 gDNA를 날카로운으로 표시에 대 한 높은-분자-무게 (HMW) 밴드와 낮은 분자량 (LMW) 분자의 범위에 아무 얼룩.
  7. 제조업체의 지침에 따라 수량, 순수성, 및 guanidine 안산 (GTC) agarose 젤 전기 이동 법에 의해 또는 모 세관 전기 이동 법 칩에 의해 조건을 변성 시키기에서 무결성에 대 한 격리 된 RNA를 확인 합니다.
    1. GTC 젤 60 ° c 천 냉각 후 표준 1 x TBE 1 %agarose 젤에 5mm GTC를 추가 하 여 준비
      참고: GTC는 독성, 그래서 연기 후드, 분배 하 고 적절 한 개인 보호 장비를 착용.
    2. 준비 하는 RNA 선적 버퍼를 변성 시키기: 95 %formamide, 10 mM EDTA pH 8.0, 0.1 %bromophenol 파랑, 0.1% 자일 렌 cyanole, 및 10 µ L ethidium 평범한 사람.
      참고: Formamide 및 ethidium 평범한 사람 독성, 그리고 증기 두건에 적절 해야 한다.
    3. 로드 1-5 µ g의 RNA 선적 버퍼, 열 70 ° C에서 5 분을 위한 혼합물을 변성 시키기에 총 RNA 젤에 그것을 로드 하기 전에 얼음에 배치 하 고 함께 표준으로 100 V 45 분 부하 DNA 또는 RNA 분자 무게 마커 GTC 젤에 RNA를 분리 RNA 샘플입니다.
    4. Ethidium 평범한 사람으로 젤 얼룩 하 고 자외선 아래 이미지 캡처 시스템을 사용 하 여 밴드를 시각화. 진핵생물, 그대로 총 RNA 조건을 변성 시키기에서 실행 두 개 이상 선명 하 고 뚜렷하게 rRNA 밴드 (28S와 18S) 2:1 강도 비율 표시 됩니다.
  8. DNase 가진 처리에 의해 gDNA의 흔적을 제거 (DNase RNase 무료 나). 10 µ L 전체 볼륨에서 RNase 무료 튜브에 추가: 0.1-1 µ g의 총 RNA, DNase I 및 10 x 반응의 1 µ L MgCl2버퍼의 한 단위. 37 ° c.에 30 분 동안 혼합물을 품 어 50 mM EDTA의 1 µ L을 추가 하 고 10 분 동안 65 ° C에서 배양 하 여 반응을 종료.
  9. 제조 업체의 프로토콜에 따라 gDNA 추출 DNase 무료 RNase A를 사용 하 여에서 RNA의 흔적을 제거 합니다. RNase의 5 µ L를 추가 총 DNA에 10 mg/mL 1 h. 저장소 RNA와 DNA 추출-80 ° c.에 대 한 37 ° C에서 품 어와

2. 뇌관 디자인 rDNA 지역 gDNA 분석 결과에서

참고: rDNA 전장 시퀀스 endonucleolytic 분열의 일련에 의해 성숙한 rRNA 분자에서 제거 되 고 다음 (그림 1)를 저하는 두 영역 (ITS1 및 ITS2)를 포함 합니다.

  1. NCBI (http://www.ncbi.nlm.nih.gov)의 종에서에서 rDNA 염기 순서를 검색 합니다. 데이터베이스를 검색 하기 위한 최고의 키워드는 "내부 베낀된 스페이서를."
  2. 지역 보존 내부 베낀된 공백 영역 (ITSs), SSU, 및 LSU를 찾기 위한 BLASTn 검색으로 대상 뉴클레오티드 시퀀스를 입력 합니다.
  3. 뇌관도 ITSs 시퀀스 측면을 선택 하는 성숙한 rRNA에 존재 하지 않은 ITSs 순서를 증폭 또는.
    1. 측면에 서는 ITS1 또는 ITS2 시퀀스 뇌관 설계: 정렬 ClustalW 다양 한 종족에서 보존된 지역. AlleleID 소프트웨어와 함께 taxa 특정/크로스-종 분석 후 뇌관 특정 측면에 서 그 지역에 대 한 디자인. 2 개의 뇌관 쌍 증폭 SSU-5.8S 및 5.8S-LSU amplicons 디자인 될 수 있다 기반 ITS1 ITS2, 측면에 서 지역에 각각. Amplicon 길이 적어도 300로 증가 이러한 amplicons는 그것의 지역에 걸쳐 확장, 때문에 bp에서 gDNA amplicons. 이 증가 감도 감소 시킨다.
      1. ITS1 측면: SSU와 5.8S 선택 rRNA 순서. Poaceae에 대 한 선택 된 뇌관은: SSU, SF: CGTAACAAGGTTTCCGTAGGTG, r: GGTTCACGGGATTCTGCAAT. 이 뇌관 쌍 (SF: 앞으로 및 연구: 역방향) SSU의 부분 지역, ITS1의 길이 그리고 5.8S의 부분 지역 증폭 rDNA.
      2. ITS2 측면: 5.8S 및 LSU 시퀀스를 선택 합니다. Poaceae에 대 한 선택 된 뇌관은: f: ATTGCAGAATCCCGTGAACC LSU 합의 시퀀스, LR: TGCTTAAAYTCAGCGGGTAGYC. 뇌관 쌍이 5.8S의 부분 지역, ITS2, LSU (그림 1)의 부분 지역의 전체 길이 증폭 한다.
        참고: ITSs 지역, SSU의 높은 보존된 지역 측면에 기반 하는 뇌관 디자인의 경우 5.8S, 및 LSU 확인 되었다. 정방향 및 역방향 뇌관 5.8S의 rRNA 꽃 식물14보존된 모티브에 따라 설계 되었습니다. 정방향 및 역방향 뇌관을 기반으로 설계 되었습니다 SSU와 LSU에 각각 Poaceae에서 영역을 보존. 각 종족에 대 한 SSU와 LSU 뇌관의 발산은 표 1에 주어진 다.
    2. 증폭 ITSs 시퀀스 뇌관:이 프로토콜에서 디자인 ITS1 뇌관에 따라 Aeluropus 는 시퀀스 (NCBI taxid 번호: 110873). 프라이 머를 사용 하 여: 앞으로: GGTATGGCGTCAAGGAACACT, 역: ATAGCATCGCTGCAAGAGGT. 뇌관 쌍에는 실리콘에의해 생성 된 amplicons 따라 크기 다양 60에서 200 bp. 정량 분석에 대 한 권장된 크기 이기도합니다.
  4. 이러한 권장 사항을 고려 하는 동안 뇌관을 선택: GC 내용: 40-60%, 뇌관 길이: 18-23, PCR 제품 길이: 60-160 bp (특수에 대 한 그것의 뇌관), 용융 온도 (Tm): 60 ° C, 두 뇌관에 대 한 최종 Tm 보다 5 ° C, 그리고는 꼼꼼한 차이가 없습니다 ers 스스로 보완 또는 뇌관 파트너.
  5. 뇌관 특이성 및 복사 번호를 확인 하십시오. 뇌관 폭발 프로그램 (https://www.ncbi.nlm.nih.gov/tools/primer-blast/)에 의해 선택 된 뇌관 순서의 철에서 분석을 수행.
    1. 뇌관 폭발 제출 페이지를 엽니다. 폼의 뇌관 매개 변수 섹션에 두 뇌관 시퀀스를 입력 합니다. 뇌관 쌍 특이성 검사 매개 변수 섹션에에서는 유기 체 이름 (또는 유기 체 그룹 이름)을 입력 하 고 게놈 데이터베이스를 선택 합니다. 이러한 설정은 대상 시퀀스 및 뇌관 매개 변수 제품 길이, 염색체, 위치를 포함 하 여에 대 한 구체적 정보를 제공 하 고 번호를 복사 합니다.

3. DNA 템플렛과 뇌관 rDNA 기반 유효성 검사에 대 한 정량 단계 수행

참고: 설계 뇌관의 기능 템플릿으로 gDNA를 사용 하 여 정량 Pcr을 수행 하 여 확인 되어야 합니다. 여러 병렬 반응을 수행 하 고 pipetting 오류 감소, 마스터 믹스의 준비 것이 좋습니다. 마스터 믹스에 대 한 반응 혼합물 플러스 ~ 10%의 총 수에 해당 볼륨을 준비 합니다.

  1. DNA 템플렛 PCR 반응 관에 제외한 모든 반응의 구성 요소를 혼합 하 여 마스터 믹스를 준비 합니다. 마스터 믹스를 준비 한 반응에서 필요에 따라 고급: 5 µ L SYBR 녹색 (SYBR) 혼합 (2 배), 0.3 µ L 뇌관 (0.3 µ M 각 정방향 및 역방향 뇌관의), 마스터 볼륨을 조정 최종 RNase 무료 물으로 10 µ L. 템플릿 gDNA의 1 µ L의 약 ≤200 ng를 사용 하 여 분석을 위해.
    참고: 해 동, 조립, 그리고 모든 시 약, 구성 요소, 및 얼음에 반응 믹스.
  2. 약 수는 광학 96 잘 접시에 마스터 믹스. 1 µ L의 각 음에 gDNA 플라스틱 그리고 광 플레이트 씰링 필름 그것을 커버. 스핀과 cycler에 놓습니다.
  3. 정량 분석 결과 다음과 같은 조건에서 실시간 열 cycler에 실행: 95 ° C에서 10 분 뒤 95 ° C의 40 주기 15 s와 1 분 60 ℃ 어 닐 링/확장 수행 데이터 수집에 대 한 60 ° C 단계.
  4. 95 ° c 55 ° C에서 연속 형광 측정으로 녹는 곡선 분석을 모든 PCR 반응 대상이 확대 절차 후 일반적으로, 수집 데이터 요소 하나씩 각 주기 온도의 stepwise 증가 사이클 당 0.5 ° c.
    참고: 각 뇌관 쌍 마스터 믹스에 대 한 적어도 2 비-템플릿 컨트롤 (NTC)를 포함 합니다. 적어도 3 개의 복제에 모든 분석을 수행 합니다.
  5. 용융 곡선 분석을 통해 뇌관 특이성을 확인 합니다. 단일 임계값 주기 곡선을 분석 하 고 뺀된 곡선 맞춤 방법.
    참고: 날카로운 개별 피크의 모양이 균일 한 개별 amplicon을 나타냅니다. 뇌관 이합체 제품 낮은 온도에서 개별 봉우리로 나타날 수 있습니다.
  6. Agarose 젤 전기 이동 법에 의해 각 amplicon의 크기를 확인 합니다.
    1. 3 세대 agarose TBE 버퍼의 100 mL와 혼합 하 여 3 %agarose 젤 준비 (TBE: 89 mM Tris, 89 m m 붕 소 산, 그리고 2 mM EDTA).
    2. 5-10 µ L PCR 제품의 DNA와 로딩 버퍼 x 6의 1-2 µ L 믹스. PCR 제품 3 %agarose 젤에 DNA 사다리와 함께 로드 합니다. 트리 스 붕 소 EDTA-버퍼 100 V 45 분 x 1에 전기 이동 별거를 수행 합니다.
    3. Ethidium 평범한 사람 또는 다른 intercalating 에이전트 젤 얼룩 하 고 자외선 아래 이미지 캡처 시스템을 사용 하 여 밴드를 시각화.
      참고: DNA intercalating 에이전트 (예를 들어, ethidium 평범한 사람)는 cancerogenic와 해야 신중 하 게 처리 되며 별도로 적절. (크기 기준 및 뇌관 이합체 또는 인공 배경 증폭 없이) 독특한 날카로운 밴드의 모양을 amplicon의 특이성을 확인합니다.

4. gDNA 오염 분석 결과 절차 RNA 템플릿

참고: DNase, 순화 된 RNA와 치료 후 샘플 rDNA 특정 뇌관에 의해 테스트 됩니다. ITSs의 intron 같은 기능 처리로 인해이 지역 확대를 위해 사용 하는 경우 RNA DNA 무료 샘플에서 증폭 신호가 감지 한다. 정량에 증폭 신호 감지 또는 agarose 젤에 악대가 gDNA 오염 때문 이어야 한다 ( 실리콘에서 분석에 의해 추정), 예상된 크기와 관찰 하는 경우,이에 따라. 이 섹션에서 수행 하는 단계 모든 샘플의 cDNA gDNA 대신 템플릿으로 사용 섹션 3와 비슷합니다.

  1. RNA는 PCR 반응 관에 서식 파일을 제외한 모든 반응 구성 요소를 혼합 하 여 마스터 믹스를 준비 합니다. 하나의 반응에 대 한 믹스 조합 마스터: 5 µ L SYBR 믹스 (2 배), 0.3 µ L 뇌관 (0.3 µ M 각 정방향 및 역방향 뇌관 믹스), 마스터 볼륨을 조정 최종 RNase 무료 물으로 10 µ L. 1 µ L 볼륨에 약 500 ng 템플릿 RNA를 사용 하 여 분석을 위해.
  2. 약 수는 광학 96 잘 접시에 마스터 믹스. 플라스틱을 각 영역 1 µ L RNA 그리고 광 플레이트 씰링 필름으로 그것을 커버. 원심 분리기과 cycler에 장소입니다.
    참고: 적어도 두 개의 NTC 컨트롤 및 각 분석 결과 대 한 두 개의 긍정적인 gDNA 컨트롤이 포함 됩니다. 3 기술 복제에 모든 분석을 수행 합니다.
  3. 정량 분석 결과 다음과 같은 조건에서 실시간 열 cycler에 실행: 95 ° C에서 10 분 뒤 95 ° C의 40 주기 15 s와 1 분 60 ℃ 어 닐 링/확장 수행 데이터 수집에 대 한 60 ° C 단계.
  4. 95 ° c 55 ° C에서 연속 형광 측정으로 녹는 곡선 분석을 모든 PCR 반응 대상이 확대 절차 후 일반적으로, 수집 데이터 요소 하나씩 각 주기 온도의 stepwise 증가 사이클 당 0.5 ° c.
  5. 3 %agarose 실행 하 여 모든 PCR 제품 젤 전기 이동 법을 확인 하십시오.
    참고: 어떤 밴드 나 NTC 반응에서 피크의 모양은 뇌관 이합체 대형 밴드 또는 RNA 샘플에서 피크의 존재는 gDNA 오염의 결과 녹는 곡선에서 낮은 온도에서 일반적으로 볼을 아마 관련 있다. 그것은 모든 RNA 샘플을 먼저 테스트 하 rDNA 기반 뇌관에 의해 권장 되 고 비 DNA 오염 된 샘플 cDNA 합성, 유전자 표정 분석, 등과 같은 다운스트림 응용 프로그램에 사용 됩니다.

5. RT-PCR 단계 cDNA 합성 및 정량 분석

  1. 녹여 DNase-실 온에서 RNA, cDNA 합성 시 약을 취급. 녹고, 후는 시 약을 아래로 회전 합니다. RNA의 1 µ g를 더하고 올리고 (dT) 18의 1 µ L nuclease 무료 튜브에 뇌관. RNase 무료 물 12 µ L의 총 볼륨을 조정 하 고 부드럽게, 혼합 후 얼음에 저장.
  2. 그리고 아래로 5 분 스핀 65 ° C에서 반응 잠복기에 의해 RNA 서식 파일의 보조 구조를 녹여 얼음에 유리병을 냉각.
  3. 다음과 같이 반응 마스터 믹스 (각 반응에 대 한 최종 볼륨 20 µ L) 준비: 역전사 (200 U / µ L)의 1 µ L, 반응 버퍼 (5 배)의 4 µ L, 1 µ L의 RNase 억제제 (20 U / µ L), 및 2 µ L dNTP 믹스 (10mm)의. 부드럽게 혼합 하 고 얼음에 유리병을 냉각. RNA를 포함 하는 준비 된 튜브에 19 µ L를 추가 합니다.
  4. 42 ° C에서 60 분에 대 한 반응을 품 어 그리고 역전사 작업 종료를 5 분 동안 70 ° C에서 품 어. 얼음에 RT 반응을 놓고 (3, 4 섹션에 설명)으로 일상적인 정량 절차에 의해 유전자 표정 분석을 진행 합니다.

Representative Results

우리 잎 조직의 RNA 샘플에서 gDNA 오염의 부재를 확인 하기 위해 rDNA 기반 뇌관의 사용을 제안 합니다. 정량 분석 및 gDNA 오염 분석 결과의 순서도 그림 2에 표시 됩니다. 제시 프로토콜에서는 두 개의 상호 보완적인 전략 rDNA 기반 뇌관 디자인을 위해 사용 되었다: 1) 종의 뇌관 ITSs 시퀀스에서 선정 됐다 고 2) 보편적인 뇌관 ITSs 영역 측면에서 선정 됐다. -의 증거-개념, 우리 Aeluropus littoralis 에 대 한 특정 뇌관 및 보편적인 뇌관 프로토콜에 주어진 Poaceae 종에 따라 설계 되었습니다. 5.8S 앞으로 역 뇌관 꽃 식물, bryophytes, 조류 및 균 류14의 여러 명령 사이의 유사성을 보여 주는 보존된 14 기본적인 쌍 (bp) 주제에 따라 선정 됐다. 설계 된 프라이 머의 기능 표 2에 주어진 다. 보편성 SSU의 5.8S, 및 LSU 뇌관 BLASTn에 의해 확인 되었다 고 뇌관 homology 결과 주제 로고로 그림 3 에 표시 됩니다. 종 각 종족에 대 한 분기 뇌관 homology 분석에 포함 된 목록 주어진 표 1. 뇌관 특이성 뇌관 폭발에 의해 확인 했다입니다. 전체 게놈 시퀀스를 사용할 수 있는 수 종, rDNA 유전자의 염색체 위치 추정 되었다. 예를 들어, Oryza sativa 애기 thaliana rDNA 유전자에서는 두 개의 서로 다른 염색체에 위치 하 고 있으며 지 시 메이 스 에 3 개의 다른 염색체에 있습니다.

rDNA 기반 뇌관의 정량 유효성 검사 녹는 곡선 분석 ITS1와 ITS2 측면 amplicons 템플렛으로 DNA를 사용 하 여 수행 되었다. 에 제시 된으로 그림 4 그림 5, 뇌관 특이성 Poaceae 종 등에서 전혀 뇌관 이합체 형성 단일 날카로운 피크의 관찰에 의해 실험적으로 확인 되었다 Triticum aestivum, Hordeum vulgare, Oryza sativa, 그리고 dicots 개자리속 sativa, 쿠쿠미스 sativus, Nicotiana tabacum, 붉은 alexandrinum, 얼 faba 애기 thaliana. 전기 이동 크기 분리 하 여 증폭 제품의 추가 테스트 독특한 밴드를 보여주었다. 예상 대로, 밴드 크기 (그림 6A , 6B)에서 다양 한 다른 종의 샘플에서 파생. 흥미롭게도, 보편적인 뇌관 3 Poaceae 종족을 위해 설계 된를 사용 하 여 유용 하지 않습니다만 다른 Poaceae 종, 하지만 또한 A. thaliana 등 다른 식물 종 및 endophytic 균 류 즉. Piriformospora indica.

설계 된 특정 뇌관 (ITS1)의 유효성 또한 정량 A. littoralis 템플릿으로 gDNA를 사용 하 여에 의해 확인 되었다. 뇌관 이합체 대형에 아무 단일 피크가 관찰 되었다. (특정 뇌관)으로 A. littoralis ITS1 뇌관 A. littoralis, 뿐만 아니라 다른 모든 종족 Nicotiana tabacum 붉은 alexandrinum 제외한 테스트에 대 한 하나의 예리한 밴드를 생성 하는 두 밴드 (그림 6 c) 생산. GDNA 오염 분석 결과 모든 RNA 샘플에서 자사 또는 자사 측면 뇌관에 의해 수행 되었다. 증폭 접시 gDNA 오염 분석 결과에 도식 표현 및 해석 결과의 그림 7에 표시 됩니다.

Figure 1
그림 1: 진 핵 rDNA 시퀀스 조직의 일반적인 패턴입니다.
진 핵 rDNA 세그먼트 포함 17-18 (레드) 5.8S (블루), 및 25-28S rRNA (분홍색). 내부 베낀된 스페이서 (ITS)은 검은 선으로 표시 됩니다. 5´and 3´ DNA 분자의 방향을 나타냅니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 2
그림 2: 실시간 정량 및 gDNA 오염 분석 결과 대 한 워크플로. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 3
그림 3: A. SSU, B. 5.8S, C. LSU 뇌관 homology의 모티브 로고. SSU, 5.8S를 위한 LSU 뇌관, 모티브 로고 2000 녹색 식물 기록에 따라 BLASTn에 의해 건설 되었다 (NCBI taxid 번호: 33090) 컷오프 e 값 ≤ 10-10으로. C 시 토 신, G A-아데닌, T-Thymine,-구 아닌. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 4
그림 4: 용융 곡선 분석 다른 종에서 ITS1 측면 amplicon의.
이 amplicon SSU와 5.8S에 의해 증폭-R 뇌관, 17-18 인코딩 영역에서 시퀀스, ITS1의 전체 시퀀스와 5.8S의 부분 시퀀스의 부분을 포함. 녹는 곡선 amplicons 생성 (분홍색)와 NTC Triticum aestivum, Hordeum vulgare, Oryza sativa, 개자리속 truncatula, 쿠쿠미스 sativus, Nicotiana tabacum, (적색)은 붉은 alexandrinum, 얼 faba, 애기 thaliana,Piriformospora indica. 평면 대담한 라인 기준 임계값을 나타냅니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 5
그림 5: 용융 곡선 분석 다른 종에서 ITS2 측면 amplicon의.
이 amplicon 5.8S 사용 하 여 생성 하는-F 및 LSU 뇌관. 설명된 amplicon 5.8 S 부분의 시퀀스, ITS2의 전체 시퀀스 및 25-28S의 부분 열을 포함합니다. Amplicons (녹색)와 NTC (빨간색) Triticum aestivum, Hordeum vulgare, Oryza sativa, 개자리속 truncatula, 쿠쿠미스 sativus, Nicotiana tabacum, 에서 생성 된 용융 곡선은 붉은 alexandrinum, 얼 faba, 애기 thalianaPiriformospora indica. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 6
그림 6: rDNA의 PCR 제품의 Agarose 젤 분석.
(A), ITS2 옆구리 ITS1 측면의 amplicon (B), 및 ITS1 (C) 3 %agarose 젤에서 실행 했다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 7
그림 7: ITSs의 Intron 같은 기능 gDNA 오염 검출할 수 있는 뇌관 디자인을 고려하실 수 있습니다.
모든 피크 또는 정량 분석에서 예상 되는 크기와 밴드 RNA 샘플에서 gDNA 오염을 나타냅니다. Unk: 알 수 없는 샘플, pos: 긍정적인 통제, NTC: 비-템플릿 컨트롤. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

뇌관 Taxid ID 분기 뇌관
SSU 애기 3701 kamchatica, thaliana lyrata -
3904 흔하다는, 아메리카나, unijuga, amoenane, 나무, craccamal, 의사-orobus, multicaulis, 나무, ramuliflora faba
트리폴리 3898 alexandrinum, montanum, resupinatum repens -
Nicotiana 4085 tabacum, benthamiana, otophora, picilla, bigelovii, palmeri, tomentosiformis, tomentosa, digluta, kawakamii, clevelandii, nesophila, solanifolia, cordifolia, debneyi, arentsii, thyrsiflora, wigandioides, undulata, glutinosa, noctiflora, petunioides, obtusifolia, miersii, pauciflora, 감쇠, alata acuminata, linearis, sylvestris, rustica suaveolens -
쿠쿠미스 3655 anguria, 멜로 sativus CGTAACAAGGTTTCCGTAGGKG
Aeluropus 110873 - 아무 뇌관 발견
개자리속 3877 sativa로 구나, lupulina, pamphylica, lunata, rostrate, plicata truncatula -
Oryza 4597 sativa로 구나, glumipatula, rufipogon barthii glaberrima punctate, longistaminata, meridionalis, nivara, meridionalis longistaminata -
Triticum 4564 aestivum, 우라르투 monococcum -
Hordeum 4512 vulgare, bulbosum, marinum, brevisubulatum bogdanii -
LSU 애기 3701 petraea, thaliana lyrata TGCTTAAACTCAGCGGGTAATC
3904 sylvatica, tetrasperma, sativa로 구나, 상하고, sepium, parviflora, cracca, lathyroides, orobus, orobus, bithynica faba TGCTTAAATTCAGCGGGTAGCC
트리폴리 3898 가 식, nigrescens, resupinatum, occidentale, subterraneum, strictum, ochroleucon, glomeratum, squamosum, ornithopodioides repens TGCTTAAATTCAGCGGGTAGCC
Nicotiana 4085 tabacum, benthamiana, otophora, picilla, bigelovii, palmeri, tomentosiformis, tomentosa, digluta, kawakamii, clevelandii, nesophila, solanifolia, cordifolia, debneyi, arentsii, thyrsiflora, wigandioides, undulata, glutinosa, noctiflora, petunioides, obtusifolia, miersii, pauciflora, 감쇠, acuminata, linearis, alata, sylvestris , suaveolens TGCTTAAACTCAGCGGGTAGTC
쿠쿠미스 3655 멜로, ritchiei javanica TGCTTAAACTCAGCGGGTAGTC
Aeluropus 110873 lagopoide, pungens littoralis TGCTTAAATTCAGCGGGTAATC
개자리속 3877 sativa로 구나, arabica, polymorpha, ruthenica, lupulina 최소 TGCTTAAATTCAGCGGGTAGCC
pamphylica, lunata, rostrate plicata TGCTTAAACTCAGCGGGTAGTC
Oryza 4597 sativa로 구나, glumipatula, rufipogon, barthiial, glaberrima, australiensis, officinalis, australiensis, ridleyi, malampuzhaensis, 알 타, nivara, rufipogon, meridionalis longistaminata TGCTTAAACTCAGCGGGTAGTC
Triticum 4564 aestivum, spelta, turgidum, dicoccoides, petropavlovskyi, 우라르투 monococcum TGCTTAAACTCAGCGGGTAGTC
Hordeum 4512 vulgare, bulbosum, murinum, secalinum, brevisubulatum bogdanii TGCTTAAACTCAGCGGGTAGTC
퇴 화 한 뇌관은 뉴클레오티드 전문 어를 위한 IUPAC 시스템으로 정의

표 1: 종 rDNA 기반 뇌관을 따기에 대 한 고려의 목록입니다.
SSU 바인딩 사이트 이상 더 높은 순서 상 동을 보여준 LSU 바인딩 사이트에 비해 주어진 속.

Amplicon 길이 증폭 지역 시퀀스 뇌관 이름 Amplicon
332-405 혈압 SSU, ITS1의 전체 시퀀스와 5.8S의 부분 시퀀스의 부분 시퀀스 CGTAACAAGGTTTCCGTAGGTG SSU ITS1 측면
GGTTCACGGGATTCTGCAAT 5.8S-R
318-361 혈압 5.8S, ITS2의 전체 시퀀스와 LSU의 부분 시퀀스의 부분 시퀀스 ATTGCAGAATCCCGTGAACC 5.8S-F ITS2 측면
TGCTTAAAYTCAGCGGGTAGYC LSU
100-200 bp ITS1 GGTATGGCGTCAAGGAACACT ITS1 F ITS1
ATAGCATCGCTGCAAGAGGT ITS1-R

표 2: 뇌관 시퀀스.

Discussion

양이 많은 PCR에 의해 유전자 표정 분석 최근 몇 년 동안에서 널리 적용 되었습니다. 이, 비용, 신속 하 고 자동화 된 방법의 주요 이점은 그것의 정확 하 고 정확한 결과입니다. 그러나, 이러한 장점에서 최적의 혜택을 얻고 정량 실험에 사용 되는 매개 변수 설정에 대 한 명확한 이해 필요. 정량 유전자 표정 분석에서 신뢰할 수 있는 결과 수신, RNA 샘플3,15뇌관 이합체 또는 gDNA 오염에서 발생 하는 일반적인 증폭을 피할 필요가 있다. 그것은 RNA 사본 수준 gDNA 오염8에서 대 평가 될 것으로 예상 된다. 여기, rDNA 유전자의 독특한 특징은 RNA 샘플에서 gDNA 오염 분석 결과 대 한 고려 되었다.

이 프로토콜에 사용 되는 rDNA의 기본 속성: Ribosomal 유전자 구성 두 ITSs, 즉 ITS1 ITS2, 그리고 3 개의 rRNA 인코딩 유전자, 17-18, 5.8S, 및 25-28S 소 단위12. 두는 지역 ribosomal 소 단위의 코딩 시퀀스의 일부가 되지 않습니다. 그들은 성숙 rRNA 전조 처리를 3 개 이상 효소 활동에 의해 제거 됩니다: endonuclease, helicase, 및 exonuclease 활동. 리보솜 RNA는 polycistronic 사본으로 복사할 수 있습니다, 포함 하는 ITSs 기본 제품 확실히 존재 이다. 처리가 매우 빠른 이며, 핵소체에서 이며 ITS를 포함 하는 감지 선구자 분자의 양을 정량 방법의 검출 한계 미만. 따라서 때 ITS1 또는 ITS2는 증폭 ITS에 의해 측면에 서는 뇌관, 아니 증폭 감지할 수 있습니다 RNA 샘플에서 gDNA 오염 존재 하지 않는. 진 핵 생물의 게놈에 있는 rDNA 유전자의 수는 염색체11에 단일 또는 협동 배열에서 배열 최대 천 복사본을 포함 하도록 추정 되었다. 이 프로토콜에서 대체 하는 방법, NRT, 대신 gDNA 오염, 각 반응/분석 결과에 사용 되는 검색 제안 한다.

이점 및 기존의 방법에 관하여 제한: NRT는 일반적으로 깨끗 한 또는 gDNA에 의해 오염 된 준비 RNA 샘플 인지 테스트 하는 데 사용 됩니다. GDNA 오염은 다른 RNA 샘플 사이 하지 균일 하 게 분산 되 고 반응 감도 gDNA 분석 하는 유전자에 의해 크게 영향을 받습니다, NRT 제어는 각 샘플/분석 결과 쌍7,15필요 합니다. 이것은 실질적으로 비용을 추가 및 노동 많은 처리 하는 경우 동시에3,9합니다. 문학에서 문서화 하는 다른 대체 방법 intron gDNA의 검출에 대 한 특정 뇌관 또는 그는 intron 측면 또는 스팬 엑손-엑손 접합 설계 뇌관의 사용을 포함 합니다. 이러한 방법의 한계 intron 시퀀스 정보, intron/exon 구조의 불완전 한 주석 및 유전자에서 introns의 부재 또는 관심1,4,10의 pseudogenes의 불가능에서 줄기 . 때문에 진화, rDNA 유전자 multigene 고 고도로 보존 유전자 가족으로 존재 한다. 그들은 매우 게놈에서 풍부 하 고 다른 염색체13에입니다. 다른 코딩 또는 nonconding 유전자에 비해, rDNA 유전자 표시 gDNA 오염 탐지에 대 한 최적. 비교 transcriptomic 분석, rRNA 캘 리브레이 터에 의해 정량 데이터의 정규화 추천 되지 않는다 cDNA 차이 같은 몇 가지 문제에 대 한 준비 (무작위 hexamer 못쓰게 대 polyA 못쓰게), rRNA mRNA 사이에서 큰 차이 그리고 오해의 소지가 발생할 수 있습니다 다른 속 결과10,16. 그러나, 우리가 방금 언급 한 문제는 gDNA 오염 분석 결과 대 한 장점. 예를 들어 높은 대상 사이트 풍부한 게놈, 및 다른 염색체에 지역화에 관하여 rDNA 기반 뇌관 기존의 방법에 비해 gDNA의 검출 감도 크게 향상 됩니다.

의 rDNA-다른 유기 체를 기반 versality: rDNA 유전자는 대부분의 유기 체에서 확인 된 잘 공부 유전자 가족. 제안된 된 rDNA 기반 방법 다른 진 핵 prokaryotic 유기 체 (프로토콜 2-5)에 쉽게 적용할 수 있습니다 gDNA 오염 분석을 위한 간단 하 고 매우 민감한 경제 시스템을 나타냅니다. 사례 연구로 우리 시연 여기 일부 Poceae 종 (그림 4그림 5)에이 방법의 유틸리티. 사용 된 뇌관 다른 Poceae 종 종 가운데 rDNA subunits의 높은 보존된 구조 때문에 양도의 높은 속도 표시합니다. 충분 한 게놈 시퀀스 정보 뇌관 디자인을 위해 사용할 수 없는 경우이 문제가 더욱 중요 해 집니다. 따라서, 한 종족에 대 한 설계는 측면 뇌관 관련된 종에 사용할 수 있습니다. 또한, 5.8S-F/R 뇌관 대부분 꽃 식물14높은 유사성을 보여 주는 보존된 모티브에 따라 선택 되었다. 높은 처리량 시퀀싱 기법 영구적으로 알려진된 유전자의 수를 증가, 하지만 대부분의 유기 체의 exon intron 주석 완료 되지 않으면, 그리고 그래서 그것은 종종 불가능 엑손-엑손 경계에 걸쳐 뇌관 디자인. 우리의 방법에 설명 합니다 어떻게 rDNA 기반 뇌관 gDNA 오염 분석 결과 각 분석 결과/뇌관 조합에 비싼 NRT 컨트롤 제거의 목표를 가진 원핵생물과 진핵생물의 정량 분석에 적용할 수 있습니다.

Disclosures

저자 아무 경쟁 금융 관심사 있다.

Acknowledgments

이 연구는 유전 및 농업 생명 공학 연구소의 Tabarestan (GABIT), 사리 농업 과학과 자연 자원 대학 (SANRU)에 의해 지원 되었다. 주니어 리서치 그룹 Abiotic 스트레스 유전체학 IZN (작물 식물 연구, 할레 (Saale), 독일 학 제 센터에 의해 투자 되었다. 우리는 중요 한 독서의 원고에 대 한 론다 메이어를 감사합니다.

Materials

Name Company Catalog Number Comments
Maxima SYBR Green / ROX qPCR Master Mix (2X) Thermo Scientific K0221
TissueLyser II QIAGEN 85300
RevertAid H Minus First Strand cDNA Synthesis Kit Thermo Scientific K1631
GeneRuler 100 bp Plus DNA Ladder Thermo Scientific SM0321
96 well WHT/CLR Bio-Rad HSP9601
Microseal B film Bio-Rad MJ-0558
Low tube strip CLR Bio-Rad TLS0801
Flat cap strips Bio-Rad TCS0803
NanoDrop 2000 Peqlab ND-2000
RNaseZAP Ambion 9780
Centrifuge Eppendorf 5810 R
Agilent RNA 6000 Nano Kit Agilent Technologies 5067-1511
2100 Electrophoresis Bioanalyzer Agilent Technologies G2939AA
RNase A, DNase and Protease-free Thermo Scientific EN0531
DNase I, RNase-free Thermo Scientific EN0523
TRIZOL Reagent Ambion 15596026
CFX96 Touch Real-Time PCR Detection System BIO RAD 1855195
PCR tube, 0.2 mL, RNase-free Stratagene Z376426
Guanidine thiocyanate for molecular biology Sigma-Aldrich G9277
Agarose - Nucleic Acid Electrophoresis Sigma-Aldrich A9414
Boric Acid for molecular biology AppliChem A2940
bromophenol blue AppliChem A2331
ethidium bromide AppliChem A1151
Gel documentation system BIO RAD Gel Doc 2000

DOWNLOAD MATERIALS LIST

References

  1. Bustin, S. A., Nolan, T. Pitfalls of quantitative real-time reverse-transcription polymerase chain reaction. J Biomol Tech. 15, (3), 155-166 (2004).
  2. Gutierrez, L., Mauriat, M., Pelloux, J., Bellini, C., Van Wuytswinkel, O. Towards a systematic validation of references in real-time RT-PCR. Plant Cell. 20, (7), 1734-1735 (2008).
  3. Hashemi, S. H., Nematzadeh, G., Ahmadian, G., Yamchi, A., Kuhlmann, M. Identification and validation of Aeluropus littoralis reference genes for Quantitative Real-Time PCR Normalization. J Biol Res (Thessalon). 23, (1), 18 (2016).
  4. Bustin, S. A. Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. J. Mol. Endocrinol. 25, (2), 169-193 (2000).
  5. Andersen, C. L., Jensen, J. L., Orntoft, T. F. Normalization of real-time quantitative reverse transcription-PCR data: a model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res. 64, (15), 5245-5250 (2004).
  6. Bustin, S. A., et al. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin Chem. 55, (4), 611-622 (2009).
  7. Laurell, H., et al. Correction of RT-qPCR data for genomic DNA-derived signals with ValidPrime. Nucleic Acids Res. 40, (7), e51 (2012).
  8. Galiveti, C. R., Rozhdestvensky, T. S., Brosius, J., Lehrach, H., Konthur, Z. Application of housekeeping npcRNAs for quantitative expression analysis of human transcriptome by real-time PCR. RNA. 16, (2), 450-461 (2010).
  9. Laurell, H., et al. Correction of RT-qPCR data for genomic DNA-derived signals with ValidPrime. Nucleic Acids Res. 40, e51 (2012).
  10. Caldana, C., Scheible, W. R., Mueller-Roeber, B., Ruzicic, S. A quantitative RT-PCR platform for high-throughput expression profiling of 2500 rice transcription factors. Plant Methods. 3, (1), 7 (2007).
  11. Lawrence, R. J., Pikaard, C. S. Perspectives Chromatin Turn Ons and Turn Offs of Ribosomal RNA Genes. Cell Cycle. 3, (7), 880 (2004).
  12. Boisvert, F. M., van Koningsbruggen, S., Navascues, J., Lamond, A. I. The multifunctional nucleolus. Nat Rev Mol Cell Biol. 8, (7), 574-585 (2007).
  13. Alvarez, I., Wendel, J. F. Ribosomal ITS sequences and plant phylogenetic inference. Mol Phylogenet Evol. 29, (3), 417-434 (2003).
  14. Jobes, D. V., Thien, L. B. A conserved motif in the 5.8 S ribosomal RNA (rRNA) gene is a useful diagnostic marker for plant internal transcribed spacer (ITS) sequences. Plant Mol Biol Report. 15, (4), 326-334 (1997).
  15. Padhi, B. K., Singh, M., Huang, N., Pelletier, G. A PCR-based approach to assess genomic DNA contamination in RNA: Application to rat RNA samples. Anal Biochem. 494, 49-51 (2016).
  16. Dheda, K., et al. Validation of housekeeping genes for normalizing RNA expression in real-time PCR. Biotechniques. 37, (1), 112-114 (2004).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics