Vurdering av DNA forurensning i RNA eksempler basert på Ribosomal DNA

Genetics
 

Summary

Her presenterer vi en protokoll for sporing genomisk DNA (gDNA) forurensning i RNA prøver. Presentert metoden benytter primere bestemt intern transkribert spacer regionen (ITS) ribosomal DNA (rDNA) gener. Metoden er egnet for pålitelig og følsom oppdagelsen av DNA forurensning i de fleste eukaryoter og prokaryoter.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Hashemipetroudi, S. H., Nematzadeh, G., Ahmadian, G., Yamchi, A., Kuhlmann, M. Assessment of DNA Contamination in RNA Samples Based on Ribosomal DNA. J. Vis. Exp. (131), e55451, doi:10.3791/55451 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

En metode mye brukt for kvantifisering av gene expression endringer og transkripsjon krillens er omvendt-transkripsjon kvantitative sanntid PCR (RT-qPCR). Det gir nøyaktig, sensitive, pålitelige og reproduserbar resultater. Flere faktorer kan påvirke sensitivitet og spesifisitet av RT-qPCR. Gjenværende genomisk DNA (gDNA) forurensende RNA prøver er en av dem. Gene expression analyse, uspesifisert forsterkning på grunn av gDNA forurensning vil overvurdere overflod av transkripsjon nivåer og RT-qPCR resultatet. Generelt gDNA er oppdaget av qRT PCR bruker primer par annealing intergenisk regioner eller en intron av genet av interesse. Dessverre er intron/ekson merknader ennå ikke kjent for alle gener fra virveldyr, bakterier, protist, sopp, plante og metazoan vannrenseanlegg.

Her presenterer vi en protokoll for oppdagelse av gDNA forurensning i RNA prøver ved hjelp av ribosomal DNA (rDNA)-basert primere. Metoden er basert på de unike funksjonene til rDNA: deres multigene natur, høyt konservert sekvenser og høy frekvens i genomet. Også som en case study, et unikt sett av primere ble designet basert på bevarte regionen ribosomal DNA (rDNA) i Poaceae familien. Universalitet av disse primer ble testet smelte curve analyse og agarose gel geleelektroforese. Selv om vår metode forklarer hvordan rDNA-baserte primere kan brukes for gDNA forurensning analysen i Poaceae familien, det kan lett brukes til andre ifølge og eukaryoter arter

Introduction

Utforske transcriptional regulering av interessante genet sett eller signalering nettverk er viktig å forstå komplekse molekylære mekanismer involvert i biologiske events1. QPCR analyse er foreløpig mest brukte tilnærming for gene expression studier som kan målrette DNA (genomet) eller RNA (transcriptome) som methylome og transcriptome analyse, henholdsvis. Omvendt transkripsjon (RT) etterfulgt av qPCR er mye brukt for transcriptome analyse som måler gene expression nivåer i ulike områder av biologiske2. Sammenlignet med andre metoder som tradisjonelt Nord hybridization, vev spesifikke gjenkjennings via i situ hybridisering, ribonuclease beskyttelse analyser (RPA) og semi-RT-PCR, nøyaktigheten, komfort, hastighet og bredt dynamisk område av qPCR-baserte analyser er svært bemerkelsesverdig3,4. Det er flere viktige faktorer som må vurderes for en pålitelig kvantifisering av budbringer RNA (mRNA), inkludert kvaliteten og kvantiteten av starter materiale. Videre har uspesifisert forsterkning, effektiviteten av RT-qPCR og PCR effektivitet vurderes5,6.

GDNA er en iboende problem under RNA utvinning skyldes, delvis til lignende fysiske og kjemiske egenskaper av DNA og RNA7. På grunn av sekvens identiteten til gDNA og komplementære DNA (cDNA) fra mRNA prøvene, kan ikke-spesifikk forsterkning oppstå, som vil påvirke nøyaktigheten av RT-qPCR resultater. Den gjenværende gDNA vil føre til overvurdering av overflod av målrette mRNA i gene expression analyse8.

I utgangspunktet, ikke-spesifikk amplicon mest oppstår fra primer-dimer formasjon eller uspesifikke bakgrunn forsterkning på grunn av gDNA, begge kan bli vurdert av aktuelle kontrollen utvalg. Slike eksempler er ingen mal kontroll (NTC) og ingen revers transkriptase kontroll (NRT), henholdsvis. Siden gDNA forurensning i prøvene blir studert er forskjellige og sensitivitet overfor gDNA varierer sterkt mellom genene analysert, er NRT kontrollene nødvendig for hvert utvalg/analysen par. Selv om dette øker vesentlig kostnader og arbeid RT-qPCR profilering studier, er disse kontrollene nødvendig7,9.

Alternative metoder håndtere gDNA forurensning omfatter bruk av primer annealing intergenisk regioner eller en intron genet av interesse10og bruk av primer som flanke en stor intron eller span en ekson-ekson junction, dvs. webområdene annealing er fraværende i de eldre mRNA sekvens1,4. Imidlertid er intron/ekson merknader for alle gener fra mange virveldyr, bakterier, protist, sopp, anlegg og metazoan vannrenseanlegg kjent ennå. I tillegg har mange eukaryote organismer pseudogenes avledet fra duplisering hendelser. Videre garanterer ikke primer design over introns ikke-forsterkning av gDNA. Som chromatin tilgjengelighet av genomisk regionene DNase jeg varierer, er det anbefalt å utforme forskjellige primer par målretting ulike kromosomene10.

Genomer eukaryote organismer kan omfatte opptil tusen kopier av rDNA gener koding ribosomal underenheter nødvendig for ribosomer formasjon. Disse rDNA gener organiseres ofte i enkle eller tandem gjenta matriser11. Polycistronic rRNAs (figur 1) inkludert store delenhet (LSU) og små delenhet (Hei) er transkribert av RNA polymerase jeg (RNA pol jeg). De resulterende pre-rRNAs behandles videre ved å fjerne de to interne transkribere spacer regionene ITS1 og ITS2. Som siste produkter, tre eldre rRNAs, 17-18S rRNA (Hei), 5.8S og 25-28S rRNA (LSU) er generert12. rDNA gener er typiske representanter for en multigene familie med høyt konservert sekvenser. De oppstår ofte i genomet og finnes potensielt flere chromosomal sted13. Behandlingen av rRNA og nedbrytning av transkribert avstandsstykkene er en rask prosess i kjerne. På grunn av den høye graden av ballen, er forholdet mellom antall genomisk kopier og synlig ubehandlet RNA premolecules lavere i forhold til lav-kopi intron sekvenser og unspliced prekursorer. Disse funksjonene gjør rDNA gener velegnet for pålitelig og svært følsom påvisning av gDNA forurensning i de fleste prokaryoter og eukaryoter3.

Her er en ny prosedyre for å oppdage gDNA forurensning i RNA prøver beskrevet. Et sett med universell primere basert på rDNA bevart rekkefølgen er presentert for gDNA analyser i flere Poaceae arter. Spesifisitet og universalitet foreslåtte primerne ble testet av smelte curve analyse ved hjelp av DNA som en mal. Våre protokollen gjelder ikke bare for Poaceae, men kan også lett tilpasses andre eukaryote og prokaryote arter.

Protocol

Merk: Alle typer vev kan brukes.

1. nukleinsyre utvinning

  1. Sette 100 mg av vevsprøver i en 2.0 mL tube, legge til to 5 mm rustfritt stål perler og homogenize vev på 25-30 Hz for 30 s (homogenisering varighet og frekvens avhengig av vev type) for både RNA og DNA.
  2. Isolere totale RNA i henhold til produsentens instruksjoner.
  3. Isolere totale DNA i henhold til produsentens instruksjoner.
  4. Kontrollere renhet og antallet av RNA prøvene ved å måle absorbans ved 260 og 280 nm.
  5. Kontrollere renhet og mengde DNA-prøver ved å måle absorbans ved 260 og 280 nm.
    Merk: Mens nukleinsyrer absorberer lys med en bølgelengde på 260 nm (A260), absorbansen lys i bølgelengdeområdet 280 (A280) kan brukes å kvantifisere mengden av proteiner og fenoler tilstede i utvalget. Forholdet mellom A260/A280 nm kan derfor brukes til å evaluere renheten av DNA og RNA Hentet fra et utvalg. A260/280 verdier mellom ≥1.8 og > 2.0 er generelt anses å være "ren" for DNA og RNA, henholdsvis. Lavere A260/280 verdier kan indikere forurensning av protein eller organiske kjemikalier.
  6. Teste kvaliteten på DNA ved å kjøre en 0,7% agarose gel geleelektroforese. Forberede gel og kjører i 1 x TRIS-boric EDTA-buffer (TBE: 89 mM Tris 89 mM borsyre og 2 mM EDTA) på 100 V for 30 min. høy kvalitet gDNA vises som en skarp, høy-molekylvekt (HMW) band med ingen utstryk mellom lav molekylvekt (LMW) molekyler.
  7. Sjekk isolert RNA for antall, renhet og integritet under denaturing forhold ved en guanidine thiocyanate (GTC) agarose gel geleelektroforese eller kapillært geleelektroforese chip, i henhold til produsentens instruksjoner.
    1. Forberede GTC gel ved å legge til 5 mM GTC en standard 1 x TBE 1% agarose gel etter avkjøling agar til 60 ° C.
      Merk: GTC er giftig, så kvitte deg det i avtrekksvifte, og bruke riktig personlig verneutstyr.
    2. Forberede RNA denaturing lasting buffer: 95% formamide, 10 mM EDTA pH 8.0, 0,1% bromophenol blå og 0,1% xylen cyanole 10 µL ethidium bromide.
      Merk: Formamide og ethidium bromide er giftige, og bør bli utlevert i avtrekksvifte.
    3. Last 1-5 µg av totalt i RNA denaturing lasting buffer, varme blandingen for 5 min på 70 ° C, plassere den på is før du legger det til en gel, og deretter skille RNA på GTC gel på 100 V for 45 min. Last DNA eller RNA molekylvekt markør som standard sammen med RNA prøven.
    4. Stain gels med ethidium bromide og visualisere bandene bruke image capture systemer under ultrafiolett lys. I eukaryoter, vil intakt totale RNA kjøre denaturing betingelser vise minst to skarpe og klare rRNA band (28S og 18S) med forholdet 2:1 intensitet.
  8. Fjerne spor av gDNA av behandling med DNase (DNase jeg RNase-fri). Legge til en RNase-fri rør i 10 µL totalt volum: 0,1 - 1 µg av totalt DNase jeg, og 1 µL av 10 x reaksjon buffer med MgCl2enheter. Inkuber blandingen for 30 min på 37 ° C. Avslutte reaksjonen ved å legge 1 µL 50 mm EDTA og rugende ved 65 ° C i 10 min.
  9. Fjerne spor av RNA fra gDNA ekstrakter bruker DNase gratis RNase A, i henhold til produsentens protokollen. Legge til 5 µL av RNase 10 mg/mL til totalt DNA og Inkuber ved 37 ° C i 1 h. Store RNA og DNA trekker på-80 ° C.

2. primer Design fra rDNA regionen for gDNA analysen

Merk: RDNA full lengde sekvensen inneholder to regioner (ITS1 og ITS2), som er fjernet i det eldre rRNA molekylet av en rekke endonucleolytic cleavages og deretter degradert (figur 1).

  1. Hente rDNA nukleotid sekvensen fra NCBI (http://www.ncbi.nlm.nih.gov) for arten av interesse. Den beste søkeordet søkes databasen er "interne transkribert spacer."
  2. Input målet nukleotid sekvensen i et BLASTn-søk for å finne interne transkribert spacer regioner (ITSs), SSU og LSU bevart regioner.
  3. Velg primere at enten flanke en ITSs sekvens eller som forsterke ITSs sekvenser som ikke finnes i den eldre rRNA.
    1. Utforme primere flankerer den ITS1 eller ITS2 sekvenser: justere i konserverte områder fra ulike arter av ClustalW. Utforme primere bestemt flankemanøveren regionen etter taxa spesifikke/cross-species analyse med AlleleID programvare. To primer par forsterke SSU-5.8S og 5.8S-LSU amplicons kan være designet basert på flankemanøveren regionene ITS1 og ITS2, henholdsvis. Fordi disse amplicons er strekker seg over sin regionen, hvor amplicon skal økes for minst 300 bp i amplicons fra gDNA. Denne økningen reduserer sensitivitet.
      1. Flankert ITS1: Velg SSU og 5.8S rRNA sekvens. Valgte primere for Poaceae: Hei, SF: CGTAACAAGGTTTCCGTAGGTG, R: GGTTCACGGGATTCTGCAAT. Dette primer paret (SF: forover og R: bakover) forsterker delvis regionen SSU, den fulle av ITS1 og delvis regionen 5.8S rDNA.
      2. Flankert ITS2: Velg 5.8S og LSU sekvens. Valgte primere for Poaceae er: F: ATTGCAGAATCCCGTGAACC LSU konsensus sekvens, LR: TGCTTAAAYTCAGCGGGTAGYC. Dette primer paret forsterker delvis regionen 5.8S, full-lengde ITS2 og delvis regionen LSU (figur 1).
        Merk: Ved primer design basert på ITSs flankert regionen, høyt konservert områdene SSU, 5.8S og LSU ble identifisert. Forover og bakover grunning av 5.8S rRNA ble designet basert på en bevart motiv i planter14. Revers primerne ble designet basert på SSU og LSU bevart regioner i Poaceae, henholdsvis. Divergens av SSU og LSU primere for hver art er gitt i tabell 1.
    2. Primere forsterke en ITSs sekvens: I denne protokollen, design ITS1 primere basert på Aeluropus sekvensen (NCBI taxid nummer: 110873). Grunning, bruker: fremover: GGTATGGCGTCAAGGAACACT, omvendt: ATAGCATCGCTGCAAGAGGT. Ifølge amplicons generert av primer par i sili, bør størrelsen varierer fra 60 til 200 bp. Dette er også anbefalt størrelse for qPCR analyse.
  4. Plukke primerne mens vurderer disse anbefalingene: GC innhold: 40-60%, primer lengde: 18-23 base, PCR produktet lengde: 60-160 bp (spesielt for sin primer), smelter temperatur (Tm): 60 ° C, siste Tm for begge primere ikke avviker mer enn 5 ° C, og prim ERS er ikke utfyllende til seg selv eller partner primere.
  5. Sjekknummeret primer spesifisitet og kopiere. Utføre i sili analyse av valgte primer sekvensen av primer-blast program (https://www.ncbi.nlm.nih.gov/tools/primer-blast/).
    1. Åpne siden Primer-BLAST innlevering. Angi begge primer sekvenser i delen primer parametere i skjemaet. I primer par spesifisitet sjekke parametere inndelingen, angir en organisme (eller organisme gruppenavnet) og velger genomet Database. Disse innstillingene gir spesifisitet informasjon om målet sekvensen og primer parametere inkludert produkt lengde, posisjon på kromosom, og kopiere tall.

3. Utfør qPCR trinn for validering av rDNA-baserte primere med DNA maler

Merk: Funksjonen designet primerne skal valideres ved å utføre qPCR med gDNA som en mal. For å utføre flere parallelle reaksjoner og redusere pipettering feil, anbefaler utarbeidelse av en master blanding. For en master blanding, forberede like antall reaksjonen blanding pluss ~ 10%.

  1. Forberede en master blanding ved å blande alle reaksjon komponenter unntatt malen DNA i et PCR-reaksjon rør. Oppskalere etter behov fra en reaksjonen å forberede Master mix: 5 µL SYBR grønn (SYBR) master mix (2 x), 0,3 µL primer (0,3 µM hver av forover og bakover grunning) og justere endelige volumet til 10 µL med RNase-fritt vann. Bruke ca ≤200 ng i 1 µL av malen gDNA for analyse.
    Merk: Tine, sette sammen og holde alle reagenser, komponenter og reaksjon mikser på is.
  2. Aliquot Master mix i en optisk 96-brønns plate. Pipetter 1 µL av gDNA i hver brønn, og deretter dekke med optisk plate tetting film. Spinn og sett i cycler.
  3. Kjøre qPCR analysen på en sanntid termisk cycler under følgende betingelser: 10 minutter til 95 ° C etterfulgt av 40 sykluser av 95 ° C for 15 s og 60 ° C i 1 utføre datainnsamling på 60 ° C annealing/forlengelsen trinn.
  4. Etter forsterkning prosedyren, underlagt alle PCR reaksjoner på en smeltende curve analyse med kontinuerlig fluorescens måling fra 55 ° C til 95 ° C. Vanligvis samle ett datapunkt hver syklus av en gradvis økning i temperaturen med 0,5 ° C per syklus.
    Merk: Inkluder minst 2 ikke-mal kontroller (NTC) for hver primer par master blanding. Utfør alle analyser i minst tre gjennomkjøringer.
  5. Bekreft primer spesifisitet via smelte curve analyse. Analysere kurver med enkelt terskelen syklus og trukket fra kurve metoden.
    Merk: En skarp personlige topp viser en jevn personlige amplicon. Primer dimer produkter kan vises som individuelle topper ved lavere temperaturer.
  6. Validere størrelsen på hver amplicon ved agarose gel geleelektroforese.
    1. Forberede en 3% agarose gel ved å blande 3 g agarose med 100 mL TBE buffer (TBE: 89 mM Tris 89 mM borsyre og 2 mM EDTA).
    2. Bland 5-10 µL av PCR produkt med DNA og 1-2 µL av 6 x lasting buffer. Last PCR produktet sammen med en DNA stige på 3% agarose gel. Utføre en electrophoretic separasjon i 1 x TRIS-boric EDTA-buffer på 100 V for 45 min.
    3. Stain gels med ethidium bromide eller noen andre intercalating agent og visualisere bandene bruke image capture systemer under ultrafiolett lys.
      Merk: DNA intercalating agenter (f.eks, ethidium bromide) cancerogenic og bør være håndteres med forsiktighet og separat utlevert. Utseendet på en enestående skarpe sammenbinding (med hensyn til størrelse og uten primer-dimer eller kunstig bakgrunn forsterkning) bekrefter spesifisiteten av amplicon.

4. gDNA forurensning analysen prosedyre med RNA maler

Merk: Etter behandling med DNase, den renset RNA prøven er testet av rDNA-spesifikke primere. På grunn av behandlingen av funksjonen intron-lignende i ITSs når disse regionene brukes for forsterkning, skal ingen forsterkning signalet oppdages i DNA-fri RNA prøver. Basert på dette, hvis en forsterkning i qPCR signalet eller et band i agarose gel observert med den forventede størrelsen (estimert i sili analysen), dette bør komme gDNA forurensning. Trinnene i dette avsnittet er lik for del 3, bortsett fra at cDNA av alle prøver brukes som mal i stedet for gDNA.

  1. Forberede en master blanding ved å blande alle reaksjon komponenter unntatt RNA mal i et PCR-reaksjon rør. Master mix kombinasjon for en reaksjon: 5 µL SYBR master mix (2 x), 0,3 µL primer (0,3 µM hver forover og bakover grunning Mix) og justere det siste bindet til 10 µL med RNase-fritt vann. Bruk ca 500 ng mal RNA i 1 µL volum for analyse.
  2. Aliquot master mix i en optisk 96-brønns plate. Pipetter 1 µL RNA i hver brønn, og deretter dekke av optisk plate tetting film. Sentrifuger og plass i cycler.
    Merk: Inkluder minst to NTC kontroller og to positiv gDNA kontroller for hver analysen. Utfør alle analyser i tre tekniske replikeringer.
  3. Kjøre qPCR analysen på en sanntid termisk cycler under følgende betingelser: 10 minutter til 95 ° C etterfulgt av 40 sykluser av 95 ° C for 15 s og 60 ° C i 1 utføre datainnsamling på 60 ° C annealing/forlengelsen trinn.
  4. Etter forsterkning prosedyren, underlagt alle PCR reaksjoner på en smeltende curve analyse med kontinuerlig fluorescens måling fra 55 ° C til 95 ° C. Vanligvis, samle inn ett datapunkt hver syklus av en gradvis økning i temperaturen ved 0,5 ° C per syklus.
  5. Sjekk alle PCR-produkter ved å kjøre på 3% agarose gel geleelektroforese.
    Merk: Utseendet av bandet eller topp i NTC reaksjonen er sannsynligvis knyttet til primer-dimer formasjon som er vanligvis sett ved lave temperaturer i smeltende kurven, mens noen band eller topp i RNA prøver er resultatet av gDNA forurensning. Det anbefales å først teste alle RNA prøver av rDNA-baserte primere, og deretter ikke-DNA forurensede prøver brukes for nedstrøms programmer som cDNA syntese, gene expression analyse, etc.

5. RT PCR trinn for cDNA syntese og qPCR analyse

  1. Tine DNase-behandlet RNA og cDNA syntese reagensene ved romtemperatur. Etter tining, Nedspinning reagenser. Legge til 1 µg av RNA og 1 µL av Oligo (dT) 18 primer inn i et nuclease-fri rør. Juster det totale volumet av 12 µL med RNase-fritt vann, bland forsiktig, og deretter lagre på is.
  2. Smelte sekundære strukturer av RNA mal av rugende reaksjonen på 65 ° C i 5 min. spinn ned og kul ampullen på is.
  3. Forberede reaksjonen master blanding (siste bindet 20 µL for hver reaksjon) som følger: 1 µL av revers transkriptase (200 U/µL), 4 µL reaksjon bufferen (5 x), 1 µL av RNase hemmer (20 U/µL) og 2 µL av dNTP Mix (10 mM). Bland forsiktig og kul ampullen på is. Legge til 19 µL i forberedt røret som inneholder RNA.
  4. Inkuber reaksjonen for 60 min på 42 ° C, og deretter ruge ved 70 ° C i 5 min å avslutte revers transkriptase aktivitet. Plasser RT reaksjonene på is og fortsette til gene expression analyse av rutine qPCR (som forklart i delen 3 og 4).

Representative Results

Vi foreslår bruk av rDNA-baserte primere å godkjenne fravær av gDNA forurensning i RNA prøver av blad vev. Flytskjema for qPCR analyse og gDNA forurensning analysen er vist i figur 2. I presentert protokollen, to utfyllende strategier ble brukt for rDNA-baserte primer design: 1) artsspesifikke primere ble valgt fra ITSs sekvenser og 2) universal primere ble valgt fra ITSs flankert regioner. For proof-of-concept designet vi primere spesifikke for Aeluropus littoralis, og universell primere basert på Poaceae arter, som gis i protokollen. 5.8S forover og bakover grunning ble valgt basert på en bevart 14 base par (bp) motiv som viser likheten mellom blomstrende planter, bryophytes og flere bestillinger av alger og sopp14. Funksjonene i designet primere er gitt i tabell 2. Universalitet av SSU, 5.8S og LSU primer var kontrollert av BLASTn og primer homologi resultatene presenteres i Figur 3 som motiv logo. Listen over arter inkludert i homologi analyse, samt de forskjellige primerne for hver art er gitt i tabell 1. Primer spesifisitet var sjekk av Primer-BLAST. For arter der det hele Genova orden er tilgjengelig, ble hvor chromosomal rDNA gener anslått. For eksempel i Oryza sativa og Arabidopsis thaliana, rDNA er gener plassert på to forskjellige kromosomer, og i Zea mays på tre forskjellige kromosomer.

qPCR validering av rDNA-baserte primere ble utført med smeltende curve analyse av ITS1 og ITS2-flanke amplicons bruke DNA som mal. Som presentert i Figur 4 og figur 5, primer spesifisitet bekrefter eksperimentelt observasjon av en enkelt skarpe topp med ingen primer-dimer formasjon i ulike Poaceae arter inkludert Triticum aestivum, Hordeum vulgare, Oryza sativa, og i dicots Medicago sativa, Cucumis sativus, Nicotiana tabacum, Trifolium alexandrinum, vikker fabaog Arabidopsis thaliana. Ytterligere testen av forsterkning varer electrophoretic størrelse separasjon viste en enestående sammenbinding. Som forventet, bandene avledet fra prøver av ulike arter varierte i størrelse (figur 6A og 6B). Interessant, bruk av universal primerne spesielt utformet for tre Poaceae arter er ikke bare nyttig for andre Poaceae arter, men også andre plantearter som A. thaliana, og en endophytic sopp nemlig. Piriformospora indikerer.

Gyldigheten av designet bestemt primer (ITS1) ble også bekreftet av qPCR i A. littoralis bruker gDNA som mal. En enkelt topp med ingen primer-dimer formasjon ble observert. Overraskende, A. littoralis ITS1 primer (som bestemt primer) generert et enkelt skarpe band ikke bare i A. littoralis, men også for alle andre arter testet unntatt Nicotiana tabacum og Trifolium alexandrinum, som produsert to band (figur 6C). GDNA forurensning analysen ble utført av enten ITS eller ITS-flankert primere i alle RNA prøver. En skjematisk fremstilling av forsterkning plate i gDNA forurensning analysen og tolkning av resultatene vises i figur 7.

Figure 1
Figur 1: Den generelle mønsteret eukaryote rDNA sekvens organisasjon.
Eukaryote rDNA segmentet inneholder 17-18 år (rød), 5.8S (blå) og 25-28S rRNA (rosa). Intern transkribert avstandsstykkene (ITS) er angitt som svarte linjer. 5´and 3´ angir retningen på DNA molekylet. Klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2: arbeidsflyt for en RT-qPCR og gDNA forurensning analysen. Klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3: motiv logoen til A. SSU, B. 5.8S og C. LSU primer homologi. For SSU, 5.8S, og LSU primere, motiv logoen ble bygget av BLASTn basert på 2000 grønn plante poster (NCBI taxid nummer: 33090) med en cut-off e-verdien ≤10-10. A-Adenine, T-Thymine, G-Guanine, C-Cytosine. Klikk her for å se en større versjon av dette tallet.

Figure 4
Figur 4: Smelte curve analyse av ITS1-flankert amplicon i forskjellige arter.
Denne amplicon, forsterket av SSU og 5.8S-R primere, inneholder en del av sekvensen fra 17-18S koding regionen, hele sekvensen av ITS1 og delvis rekkefølgen for 5.8S. Vises smeltende kurvene amplicons generert (rosa) og NTC (rød) fra Triticum aestivum, Hordeum vulgare, Oryza sativa, Medicago truncatula, Cucumis sativus, Nicotiana tabacum, Trifolium alexandrinum, fuglevikke faba, Arabidopsis thaliana, og Piriformospora indica. Flat fet linjen angir grunnlinjen terskelen. Klikk her for å se en større versjon av dette tallet.

Figure 5
Figur 5: Smelte curve analyse av ITS2-flankert amplicon i forskjellige arter.
Denne amplicon genereres ved bruk av 5.8S-F og LSU primere. Den beskrevet amplicon inneholder sekvenser av 5,8 S, hele sekvensen av ITS2 og en delvis sekvens av 25-28S. Vises den smeltende kurver av amplicons (grønn) og NTC (rød) generert fra Triticum aestivum, Hordeum vulgare, Oryza sativa, Medicago truncatula, Cucumis sativus, Nicotiana tabacum, Trifolium alexandrinum, fuglevikke faba, Arabidopsis thaliana og Piriformospora indica. Klikk her for å se en større versjon av dette tallet.

Figure 6
Figur 6: Agarose gel analyse av rDNA-baserte PCR produktet.
Amplicon av ITS1-flankene (A), ITS2-flankene (B) og ITS1 (C) ble kjørt på 3% agarose gel. Klikk her for å se en større versjon av dette tallet.

Figure 7
Figur 7: Intron-lignende funksjoner i ITSs kan anses å designe primer som kan oppdage gDNA forurensning.
Noen topp eller band med den forventede størrelsen i qPCR analyse viser gDNA forurensning i RNA utvalget. UNK: ukjent eksempel pos: positiv kontroll, NTC: ikke-mal kontroll. Klikk her for å se en større versjon av dette tallet.

Primer Slekt Taxid-ID Arter Divergerende primer
HEI Arabidopsis 3701 kamchatica, thaliana og lyrata -
Vikker 3904 villosa, americana, unijuga, amoenane, amurensis, craccamal, pseudo-orobus, multicaulis, japonica, ramuliflora og faba
Trifolium 3898 Alexandrinum, montanum, resupinatum og repens -
Nicotiana 4085 tabacum, benthamiana, otophora, picilla, bigelovii, palmeri, tomentosiformis, tomentosa, digluta, kawakamii, clevelandii, nesophila, solanifolia, cordifolia, debneyi, arentsii, thyrsiflora, wigandioides, undulata, først, noctiflora, petunioides, obtusifolia, miersii, pauciflora, dempe, acuminata, linearis, alata, sylvestris, rustica og suaveolens -
Cucumis 3655 anguria, melo og sativus CGTAACAAGGTTTCCGTAGGKG
Aeluropus 110873 - Ingen primer funnet
Medicago 3877 sativa, lupulina, pamphylica, lunata, rostrate, plicata og truncatula -
Oryza 4597 sativa, glumipatula, rufipogon barthii glaberrima vises punctate, longistaminata, meridionalis, nivara, meridionalis og longistaminata -
Triticum 4564 aestivum, urartu og monococcum -
Hordeum 4512 vulgare, bulbosum, marinum, brevisubulatum og bogdanii -
LSU Arabidopsis 3701 petraea, thaliana og lyrata TGCTTAAACTCAGCGGGTAATC
Vikker 3904 sylvatica, tetrasperma, sativa, hirsute, sepium, parviflora, cracca, lathyroides, orobus, orobus, bithynica og faba TGCTTAAATTCAGCGGGTAGCC
Trifolium 3898 unnskyldning, nigrescens, resupinatum, occidentale, subterraneum, strictum, ochroleucon, glomeratum, squamosum, ornithopodioides og repens TGCTTAAATTCAGCGGGTAGCC
Nicotiana 4085 tabacum, benthamiana, otophora, picilla, bigelovii, palmeri, tomentosiformis, tomentosa, digluta, kawakamii, clevelandii, nesophila, solanifolia, cordifolia, debneyi, arentsii, thyrsiflora, wigandioides, undulata, først, noctiflora, petunioides, obtusifolia, miersii, pauciflora, dempe, acuminata, linearis, alata, sylvestris og suaveolens TGCTTAAACTCAGCGGGTAGTC
Cucumis 3655 Melo, ritchiei og javanica TGCTTAAACTCAGCGGGTAGTC
Aeluropus 110873 lagopoide, pungens og littoralis TGCTTAAATTCAGCGGGTAATC
Medicago 3877 ruthenica, sativa, lupulina, arabica, polymorpha og minima TGCTTAAATTCAGCGGGTAGCC
pamphylica, lunata, rostrate og plicata TGCTTAAACTCAGCGGGTAGTC
Oryza 4597 sativa, glumipatula, rufipogon barthiial, glaberrima, australiensis, officinalis, australiensis, ridleyi, malampuzhaensis, alta, nivara, rufipogon, meridionalis og longistaminata TGCTTAAACTCAGCGGGTAGTC
Triticum 4564 aestivum, Spelta, turgidum, dicoccoides, petropavlovskyi, urartu og monococcum TGCTTAAACTCAGCGGGTAGTC
Hordeum 4512 vulgare, bulbosum, murinum, secalinum, brevisubulatum og bogdanii TGCTTAAACTCAGCGGGTAGTC
En degenerert primer er definert som IUPAC systemet for nukleotid nomenklatur

Tabell 1: Liste over Artsgruppe for plukking rDNA-baserte primere.
Hei binding området i forhold til LSU bindende nettsted viste høyere sekvens homologi gitt slekten.

Amplicon lengde Forsterkning området Sekvens Primer navn Amplicon
332 - 405 bp Delvis rekke SSU, hele sekvensen av ITS1 og delvis rekkefølgen for 5.8S CGTAACAAGGTTTCCGTAGGTG HEI ITS1-flankene
GGTTCACGGGATTCTGCAAT 5.8S-R
318 - 361 bp Delvis sekvens av 5.8S, hele sekvensen av ITS2 og delvis rekkefølgen for LSU ATTGCAGAATCCCGTGAACC 5.8S-F ITS2-flankene
TGCTTAAAYTCAGCGGGTAGYC LSU
100 - 200 bp ITS1 GGTATGGCGTCAAGGAACACT ITS1-F ITS1
ATAGCATCGCTGCAAGAGGT ITS1-R

Tabell 2: Primer sekvenser.

Discussion

Gene expression analyse av kvantitative PCR har vært mye brukt de siste årene. Den viktigste fordelen med denne rask, kostnadseffektiv og automatisert metoden er presis og nøyaktig resultatet. Få optimale ytelser fra disse fordelene krever imidlertid en klar forståelse av oppsettet av parameterne som brukes for qPCR eksperimentet. For å få et pålitelig resultat i qPCR gene expression analyse, er det nødvendig å unngå uspesifikke forsterkning som oppstår fra primer-dimer eller gDNA forurensning i RNA eksempel3,15. Det forventes at RNA transkripsjon nivåene vil bli overvurdert under gDNA forurensning8. Her, de unike funksjonene til en rDNA genet ble ansett for en gDNA forurensning analysen i RNA prøver.

Grunnleggende egenskaper for rDNA brukes i denne protokollen: Ribosomal gener består av to ITSs, nemlig ITS1 og ITS2, og tre rRNA koding genene, 17-18 år, 5.8S og 25-28S delenhet12. De to ITS regionene er ikke del av koding sekvensen av ribosomal underenheter. De fjernes av minst tre enzymatisk aktivitet behandle forløperen å modne rRNA: en endonuclease, helicase og exonuclease aktivitet. Som ribosomal RNA er transkribert som polycistronic avskrift, er en primær produkt som inneholder ITSs absolutt tilstede. Behandling er veldig rask og foregår i kjerne, og mengden av synlig forløper molekyler som inneholder ITS er under gjenkjenning grensen av metoden qPCR. Derfor når ITS1 eller ITS2 er forsterket med ITS flankert primere, kan ingen forsterkning oppdages i RNA prøver med mindre gDNA forurensning er tilstede. Antall rDNA gener i genomet av eukaryote organismer ble anslått for å inkludere opptil tusen eksemplarer, som er ordnet i enkle eller tandem matriser kromosomene11. I denne protokollen foreslå vi en alternativ måte, i stedet for NRT, å oppdage gDNA forurensning, som brukes i hver reaksjon/analysen.

Fordeler og begrensninger med hensyn til eksisterende metoder: NRT brukes vanligvis til å teste om forberedt RNA prøven er ren og forurenset av gDNA. Siden gDNA forurensning ikke er fordelt jevnt mellom forskjellige RNA prøvene, og reaksjonen følsomheten til gDNA er betydelig påvirket av gener analysert, er NRT kontroller nødvendig for hver prøve/analysen par7,15. Legges vesentlig kostnader og arbeid ved håndtering av mange eksempler samtidig3,9. Andre alternative metoder i litteraturen inkluderer bruk av intron bestemt primere for påvisning av gDNA, eller designe primere som flanke en intron eller dekker et ekson-ekson kryss. Begrensningene for disse metodene stammer fra utilgjengelighet av intron oppstartsrekkefølgen, ufullstendig merknad intron/ekson struktur og fravær av introns i gener eller pseudogenes av interesse1,4,10 . På grunn av evolusjon finnes rDNA gener som multigene og høyt konservert genet familier. De er svært rikt i genomet og på ulike kromosomene13. Sammenlignet med andre koding eller nonconding gener, viser rDNA gener beste tilpassing for gjenkjenning av gDNA forurensning. I sammenlignende transcriptomic analyser, normalisering av qPCR data ved rRNA kalibrator anbefales ikke noen problemer, for eksempel forskjeller i cDNA forberedelse (polyA grunning vs tilfeldig praktiske grunning), store forskjeller i overflod mellom rRNA og mRNA , og ulike biogenesis som kan generere villedende resultater10,16. Problemene vi har nevnt er imidlertid en fordel for gDNA forurensning analysen. For eksempel med hensyn til høyere målretting stedet overflod i genom og lokalisering på ulike kromosomer forbedre rDNA-baserte primere betydelig gjenkjenning følsomheten til gDNA i forhold til eksisterende metoder.

Versality av rDNA-baserte for andre organismen: rDNA gener er en godt studert genet familie identifisert i de fleste organismer. Den foreslåtte rDNA-baserte metoden representerer et enkelt, svært følsom og økonomisk system for gDNA forurensning analyser som kan lett tilpasses andre eukaryote og prokaryote organismer (Protocol 2 - 5). Som en case study, har vi vist her nytten av denne metoden i noen Poceae arter (Figur 4 og figur 5). Brukte primerne viser en høy grad av overførbarhet til andre Poceae art på grunn av høyt konservert strukturen i rDNA underenheter blant arter. Dette problemet blir enda viktigere når tilstrekkelig genomisk oppstartsrekkefølgen ikke er tilgjengelig for primer design. Således, ITS-flankert primere designet for en art kan brukes i en beslektede arter. Også 5.8S-F/R primere ble plukket basert på en bevart motiv som viser høy likheten i de fleste planter14. Selv om høy gjennomstrømning sekvensering teknikker permanent øke antall kjente genomer, ekson-intron merknaden mest organismer er ikke fullført, og så det er ofte ikke mulig utforme primere å strekke seg over en ekson-ekson kantlinje. Vår metode forklarer hvordan rDNA-baserte primere gjeldt for gDNA forurensning analysen i qPCR analyse av prokaryoter og eukaryoter med mål om å eliminere kostbare NRT kontroller i hver analysen/primer kombinasjon.

Disclosures

Forfatterne har ingen konkurrerende økonomiske interesser.

Acknowledgments

Denne forskningen ble støttet av genetiske og landbruket bioteknologi Institute av Tabarestan (GABIT), Sari landbruksvitenskap og naturressurser University (SANRU). Junior forskningsgruppen abiotiske Stress Genomics ble finansiert av IZN (tverrfaglig senter for beskjære planteforskning, Halle (Saale), Tyskland. Vi takker Rhonda Meyer for kritisk lesning av manuskriptet.

Materials

Name Company Catalog Number Comments
Maxima SYBR Green / ROX qPCR Master Mix (2X) Thermo Scientific K0221
TissueLyser II QIAGEN 85300
RevertAid H Minus First Strand cDNA Synthesis Kit Thermo Scientific K1631
GeneRuler 100 bp Plus DNA Ladder Thermo Scientific SM0321
96 well WHT/CLR Bio-Rad HSP9601
Microseal B film Bio-Rad MJ-0558
Low tube strip CLR Bio-Rad TLS0801
Flat cap strips Bio-Rad TCS0803
NanoDrop 2000 Peqlab ND-2000
RNaseZAP Ambion 9780
Centrifuge Eppendorf 5810 R
Agilent RNA 6000 Nano Kit Agilent Technologies 5067-1511
2100 Electrophoresis Bioanalyzer Agilent Technologies G2939AA
RNase A, DNase and Protease-free Thermo Scientific EN0531
DNase I, RNase-free Thermo Scientific EN0523
TRIZOL Reagent Ambion 15596026
CFX96 Touch Real-Time PCR Detection System BIO RAD 1855195
PCR tube, 0.2 mL, RNase-free Stratagene Z376426
Guanidine thiocyanate for molecular biology Sigma-Aldrich G9277
Agarose - Nucleic Acid Electrophoresis Sigma-Aldrich A9414
Boric Acid for molecular biology AppliChem A2940
bromophenol blue AppliChem A2331
ethidium bromide AppliChem A1151
Gel documentation system BIO RAD Gel Doc 2000

DOWNLOAD MATERIALS LIST

References

  1. Bustin, S. A., Nolan, T. Pitfalls of quantitative real-time reverse-transcription polymerase chain reaction. J Biomol Tech. 15, (3), 155-166 (2004).
  2. Gutierrez, L., Mauriat, M., Pelloux, J., Bellini, C., Van Wuytswinkel, O. Towards a systematic validation of references in real-time RT-PCR. Plant Cell. 20, (7), 1734-1735 (2008).
  3. Hashemi, S. H., Nematzadeh, G., Ahmadian, G., Yamchi, A., Kuhlmann, M. Identification and validation of Aeluropus littoralis reference genes for Quantitative Real-Time PCR Normalization. J Biol Res (Thessalon). 23, (1), 18 (2016).
  4. Bustin, S. A. Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. J. Mol. Endocrinol. 25, (2), 169-193 (2000).
  5. Andersen, C. L., Jensen, J. L., Orntoft, T. F. Normalization of real-time quantitative reverse transcription-PCR data: a model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res. 64, (15), 5245-5250 (2004).
  6. Bustin, S. A., et al. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin Chem. 55, (4), 611-622 (2009).
  7. Laurell, H., et al. Correction of RT-qPCR data for genomic DNA-derived signals with ValidPrime. Nucleic Acids Res. 40, (7), e51 (2012).
  8. Galiveti, C. R., Rozhdestvensky, T. S., Brosius, J., Lehrach, H., Konthur, Z. Application of housekeeping npcRNAs for quantitative expression analysis of human transcriptome by real-time PCR. RNA. 16, (2), 450-461 (2010).
  9. Laurell, H., et al. Correction of RT-qPCR data for genomic DNA-derived signals with ValidPrime. Nucleic Acids Res. 40, e51 (2012).
  10. Caldana, C., Scheible, W. R., Mueller-Roeber, B., Ruzicic, S. A quantitative RT-PCR platform for high-throughput expression profiling of 2500 rice transcription factors. Plant Methods. 3, (1), 7 (2007).
  11. Lawrence, R. J., Pikaard, C. S. Perspectives Chromatin Turn Ons and Turn Offs of Ribosomal RNA Genes. Cell Cycle. 3, (7), 880 (2004).
  12. Boisvert, F. M., van Koningsbruggen, S., Navascues, J., Lamond, A. I. The multifunctional nucleolus. Nat Rev Mol Cell Biol. 8, (7), 574-585 (2007).
  13. Alvarez, I., Wendel, J. F. Ribosomal ITS sequences and plant phylogenetic inference. Mol Phylogenet Evol. 29, (3), 417-434 (2003).
  14. Jobes, D. V., Thien, L. B. A conserved motif in the 5.8 S ribosomal RNA (rRNA) gene is a useful diagnostic marker for plant internal transcribed spacer (ITS) sequences. Plant Mol Biol Report. 15, (4), 326-334 (1997).
  15. Padhi, B. K., Singh, M., Huang, N., Pelletier, G. A PCR-based approach to assess genomic DNA contamination in RNA: Application to rat RNA samples. Anal Biochem. 494, 49-51 (2016).
  16. Dheda, K., et al. Validation of housekeeping genes for normalizing RNA expression in real-time PCR. Biotechniques. 37, (1), 112-114 (2004).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics