एक मिलीसेकंड समय स्केल पर प्रोटीन परिसरों की गतिशीलता का अध्ययन करने के लिए विट्रो प्रतिदीप्ति अनुनाद ऊर्जा हस्तांतरण में उपयोग करना

Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

प्रोटीन प्रोटीन बातचीत जैविक प्रणालियों के लिए महत्वपूर्ण हैं, और बाध्यकारी कैनेटीक्स के अध्ययन गतिशीलता और प्रोटीन परिसरों की कार्यप्रणाली में अंतर्दृष्टि प्रदान करते हैं । हम एक विधि है कि एक प्रोटीन प्रतिदीप्ति अनुनाद ऊर्जा हस्तांतरण और बंद प्रवाह तकनीक का उपयोग कर परिसर के गतिज मापदंडों quantifies का वर्णन ।

Cite this Article

Copy Citation | Download Citations

Garsamo, M., Zhou, Y., Liu, X. Using In Vitro Fluorescence Resonance Energy Transfer to Study the Dynamics Of Protein Complexes at a Millisecond Time Scale. J. Vis. Exp. (145), e59038, doi:10.3791/59038 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

प्रोटीन जैविक प्रणालियों के प्राथमिक ऑपरेटर हैं, और वे आम तौर पर अन्य मैक्रो-या छोटे अणुओं के साथ अपने जैविक कार्यों को पूरा करने के लिए बातचीत करते हैं । इस तरह की बातचीत अत्यधिक गतिशील हो सकती है, जिसका अर्थ है इंटरैक्ट करने वाली उपइकाइयां निश्चित दरों पर लगातार संबद्ध और वियोजित की जाती हैं । इस तरह के मात्रात्मक पुल नीचे के रूप में तकनीक का उपयोग बाध्यकारी समानता को मापने जबकि बातचीत की ताकत का पता चलता है, बाइंडिंग कैनेटीक्स का अध्ययन कितनी तेजी से बातचीत होती है पर अंतर्दृष्टि प्रदान करता है और प्रत्येक जटिल कैसे लंबे समय तक मौजूद कर सकते हैं. इसके अलावा, एक अतिरिक्त कारक की उपस्थिति में एक बातचीत के कैनेटीक्स को मापने, जैसे एक प्रोटीन विनिमय कारक या एक दवा के रूप में, मदद करता है तंत्र जिसके द्वारा बातचीत अन्य कारक द्वारा विनियमित है प्रकट, के लिए महत्वपूर्ण ज्ञान प्रदान जैविक और चिकित्सा अनुसंधान की उन्नति । यहां, हम एक प्रोटीन जटिल है कि एक उच्च आंतरिक संबद्धता दर है की बाध्यकारी कैनेटीक्स को मापने के लिए एक प्रोटोकॉल का वर्णन है और जल्दी से एक और प्रोटीन द्वारा वियोजित किया जा सकता है । विधि विट्रो में प्रोटीन परिसर के गठन की रिपोर्ट करने के लिए प्रतिदीप्ति अनुनाद ऊर्जा हस्तांतरण का उपयोग करता है, और यह एक बंद प्रवाह fluorimeter पर वास्तविक समय में तेजी से एसोसिएशन और परिसर के वियोजन की निगरानी के लिए सक्षम बनाता है । इस परख का उपयोग करना, एसोसिएशन और प्रोटीन परिसर के वियोजन दर स्थिरांक quantified हैं ।

Introduction

जैविक गतिविधियों अंततः प्रोटीन से बाहर किया जाता है, जिनमें से ज्यादातर उचित जैविक कार्यों के लिए दूसरों के साथ बातचीत । एक कंप्यूटेशनल दृष्टिकोण का प्रयोग, प्रोटीन की कुल मात्रा मानव में प्रोटीन बातचीत ~ ६५०,०००1होने का अनुमान है, और इन बातचीत के विघटन अक्सर2रोगों की ओर जाता है । सेलुलर और जैविक प्रक्रियाओं को नियंत्रित करने में उनकी आवश्यक भूमिकाओं के कारण, कई तरीकों को प्रोटीन-प्रोटीन इंटरैक्शन का अध्ययन करने के लिए विकसित किया गया है, जैसे कि खमीर-दो-हाइब्रिड, बाइआण्विक प्रतिदीप्ति पूरकता, विभाजन-ल्यूसिफेरेज़ पूरकता, और सह-इम्यूनोरेसिसिटेशन परख3. हालांकि इन तरीकों की खोज और प्रोटीन प्रोटीन बातचीत की पुष्टि करने में अच्छा कर रहे हैं, वे आम तौर पर गैर मात्रात्मक है और इस प्रकार बातचीत प्रोटीन भागीदारों के बीच समानता के बारे में सीमित जानकारी प्रदान करते हैं । मात्रात्मक पुल-चढ़ाव का उपयोग बाध्यकारी समानता (उदा., वियोजन स्थिरांक Kd) को मापने के लिए किया जा सकता है, लेकिन यह बाइंडिंग के कैनेटीक्स को मापने नहीं देता है, न ही इसे लागू किया जा सकता है जब Kd अपर्याप्त होने के कारण बहुत कम है सिगनल-से-रव अनुपात4. सतह plasmon अनुनाद (spr) स्पेक्ट्रोस्कोपी बाध्यकारी कैनेटीक्स quantifies, लेकिन यह एक विशिष्ट सतह और सतह पर एक अभिकारक के स्थिरीकरण की आवश्यकता है, जो संभावित अभिकारक5की बाध्यकारी संपत्ति बदल सकते हैं. इसके अलावा, यह spr के लिए मुश्किल है तेजी से एसोसिएशन और वियोजन दर5उपाय, और यह उचित spr का उपयोग करने के लिए एक प्रोटीन परिसर में प्रोटीन उपइकाइयों का आदान प्रदान की घटना की विशेषता नहीं है । यहां, हम एक तरीका है कि प्रोटीन की दरों को मापने की अनुमति देता है का वर्णन जटिल विधानसभा और disassembly एक मिलीसेकंड समय पैमाने पर. यह विधि सीullin-एकssociated-Nedd8-dissociated प्रोटीन 1 (Cand1) के रूप में एफ बॉक्स प्रोटीन विनिमय कारक6,7की भूमिका निर्धारित करने के लिए आवश्यक था ।

Cand1 Skp1 की गतिशीलता को विनियमित करता है • Cul1 • एफ-बॉक्स प्रोटीन (scf) E3 ligases, जो cullin-अंगूठी बैरि itin ligases के बड़े परिवार से संबंधित हैं । scfs cullin Cul1, जो अंगूठी डोमेन प्रोटीन Rbx1 बांध से मिलकर बनता है, और एक विनिमेय एफ बॉक्स प्रोटीन है, जो substrates और8Skp1 एडेप्टर प्रोटीन के माध्यम से Cul1 बांधता है । एक E3 ligase के रूप में, scf अपने सब्सट्रेट करने के लिए बैरि itin के विकार catalyzes, और यह सक्रिय है जब सब्सट्रेट एफ बॉक्स प्रोटीन द्वारा भर्ती किया जाता है, और जब Cul1 द्वारा संशोधित किया जाता है बैरि-प्रोटीन की तरह Nedd89। Cand1 असंशोधित Cul1 बाइंड कर देता है, और बाध्यकारी पर, यह दोनों के सहयोग को बाधित करता है Skp1 • एफ बॉक्स Cul1 के साथ प्रोटीन और Nedd810,11,12,13के लिए Cul1 के विकार । नतीजतन, Cand1 विट्रो में scf गतिविधि के एक अवरोधक होने के लिए दिखाई दिया, लेकिन जीवों में Cand1 की कमी दोष है कि वीवो में scf गतिविधियों को विनियमित करने में Cand1 की एक सकारात्मक भूमिका का पता चलता है के कारण14,15,16 , 17. यह विरोधाभास अंत में एक मात्रात्मक अध्ययन है कि Cul1, Cand1, और Skp1 • एफ बॉक्स प्रोटीन के बीच गतिशील बातचीत से पता चला द्वारा समझाया गया था । प्रतिदीप्ति अनुनाद ऊर्जा अंतरण (fret) assays कि scf और Cul1 • Cand1 परिसरों के गठन का पता लगाने का उपयोग करना, एसोसिएशन और वियोजन दर स्थिरांक (कश्मीरपर और कश्मीरबंद, क्रमशः) थे व्यक्तिगत रूप से मापा । माप से पता चला है कि दोनों Cand1 और Skp1 • एफ बॉक्स प्रोटीन Cul1 के साथ बेहद तंग जटिल फार्म, लेकिन scf के बंद कश्मीर नाटकीय रूप से Cand1 और Cul1 केबंद कश्मीर से वृद्धि हुई है Cand1 • नाटकीय रूप से बढ़ जाती है द्वारा Skp1 • F-box प्रोटीन6,7. इन परिणामों के एक प्रोटीन विनिमय कारक है, जो पुराने scf परिसरों से Cul1 रीसाइक्लिंग के माध्यम से नए scf परिसरों के गठन catalyzes के रूप में Cand1 की भूमिका को परिभाषित करने के लिए प्रारंभिक और महत्वपूर्ण समर्थन प्रदान करते हैं ।

यहां, हम विकसित करने की प्रक्रिया और fret परख का उपयोग करने के लिए Cul1 • Cand1 परिसर7की गतिशीलता का अध्ययन वर्तमान, और एक ही सिद्धांत विभिंन biomolecules की गतिशीलता का अध्ययन करने के लिए लागू किया जा सकता है । fret तब होता है जब एक दाता उचित तरंग दैर्घ्य के साथ उत्साहित है, और उत्तेजना स्पेक्ट्रम अतिव्यापी दाता उत्सर्जन स्पेक्ट्रम के साथ एक स्वीकारकर्ता 10-100 Å की दूरी के भीतर मौजूद है । उत्तेजित राज्य स्वीकारकर्ता को हस्तांतरित कर दिया जाता है, जिससे दाता की तीव्रता कम हो जाती है और स्वीकारकर्ता तीव्रता१८बढ़ जाती है. fret की दक्षता () दोनों förster त्रिज्या पर निर्भर करता है (आर0) और दाता और स्वीकारकर्ता fluorophores (आर) के बीच की दूरी, और द्वारा परिभाषित किया गया है: e = r06/(r0 6 + आर6). förster त्रिज्या (R0) कुछ कारकों पर निर्भर करता है, द्विध्रुव कोणीय अभिविन्यास सहित, दाता-acceptor जोड़ी के वर्णक ओवरलैप, और समाधान का इस्तेमाल किया19. एक बंद-प्रवाह fluorimeter, जो वास्तविक समय में दाता उत्सर्जन के परिवर्तन पर नज़र रखता है और पर और कश्मीर केबंदतेजी से कश्मीर के मापन में सक्षम बनाता है पर fret परख लागू करने के लिए, यह कुशल fret स्थापित करने के लिए आवश्यक है कि दाता उत्सर्जन की एक महत्वपूर्ण कमी में परिणाम । इसलिए, डिजाइन कुशल fret फ्लोरोसेंट रंजक और साइटों के लक्ष्य प्रोटीन पर उपयुक्त जोड़ी का चयन करने के लिए रंजक संलग्न करने के लिए महत्वपूर्ण है और इस प्रोटोकॉल में चर्चा की जाएगी ।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. डिजाइन झंट परख ।

  1. प्रोटीन डाटा बैंक (फाइल 1u6g) से Cul1 • Cand1 कॉम्प्लेक्स की संरचना फाइल डाउनलोड करें ।
  2. pymol में Cul1 • Cand1 कॉम्प्लेक्स की संरचना देखें ।
  3. Cand1 के पहले एमिनो एसिड और Cul1 (चित्रा 1) के अंतिम एमिनो एसिड के बीच की दूरी का अनुमान लगाने के लिए pymol के जादूगर मेनू के तहत माप समारोह का प्रयोग करें ।
  4. ऑनलाइन स्पेक्ट्रा दर्शक लोड ( सामग्री की तालिकादेखें) और उत्तेजना और 7-एमिनो-4-methylcoumarin (एएमसी) और फ्लैश एक साथ (चित्रा 2) के उत्सर्जन स्पेक्ट्रा देखें । ध्यान दें कि एएमसी fret दाता है और फ्लैश झंट acceptor है ।

Figure 1
चित्रा 1: Cul1 की क्रिस्टल संरचना • Cand1 और संभावित लेबलिंग साइटों के बीच की दूरी का मापन । क्रिस्टल संरचना फ़ाइल प्रोटीन डेटा बैंक (फ़ाइल 1u6g) से डाउनलोड किया गया था, और pymol में देखा । चयनित परमाणुओं के बीच माप pymol द्वारा किया गया । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण देखने के लिए ।

Figure 2
चित्रा 2: उत्तेजना और fret के लिए फ्लोरोसेंट रंगों का उत्सर्जन स्पेक्ट्रा । एएमसी के स्पेक्ट्रा (7-एमिनो-4-methylcoumarin) और फ्लैश दिखाए जाते हैं । डैश्ड रेखाएं उत्तेजन स्पेक्ट्रा का संकेत देती हैं, और ठोस रेखाएं उत्सर्जन स्पेक्ट्रा का संकेत देती हैं । छवि मूल रूप से प्रतिदीप्ति spectraviewer द्वारा उत्पंन किया गया था और बेहतर स्पष्टता के लिए संशोधित किया गया था । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण देखने के लिए ।

2. Cul1 एएम सीकी तैयारी • Rbx1, fret दाता प्रोटीन

  1. ई. कोली कोशिकाओं में मानव Cul1sortase• Rbx1 व्यक्त करने के लिए plasmids का निर्माण । ध्यान दें कि दो plasmids सह ई. कोलाई कोशिकाओं में मानव Cul1 • Rbx1 व्यक्त एक पिछली रिपोर्ट20में विस्तार से वर्णित हैं ।
    1. मानक पीसीआर और क्लोनिंग के तरीकों के माध्यम से Cul1 कोडिंग अनुक्रम के 3 अंत करने के लिए "lpetgghhhhhh" (sortase-अपने6 टैग) कोडिंग डीएनए अनुक्रम जोड़ें21,22
    2. अनुक्रम नई प्लाज्मिड जीन डालने की पुष्टि करने के लिए सही है ।
  2. सह-एक्सप्रेस Cul1sortase• Rbx1 ई. कोली कोशिकाओं में । विधि पिछली रिपोर्ट20से व्युत्पंन है ।
    1. मिक्स १०० के साथ दो plasmids के प्रत्येक एनजी BL21 (DE3) सह के लिए रासायनिक सक्षम कोशिकाओं गर्मी सदमे विधि23का उपयोग कर परिवर्तन । पौंड आगर प्लेट पर कोशिकाओं को विकसित करें जिसमें १०० μg/एमएल एम्पीसिलीन और ३४ μg/एमएल क्लॉरॅंफेनिकोल को ३७ डिग्री सेल्सियस पर रातोंरात ।
    2. हौसले से बदल कालोनियों के साथ पौंड संस्कृति के inoculate ५० मिलीलीटर और २५० rpm मिलाते के साथ ३७ डिग्री सेल्सियस पर रातोंरात हो जाना । यह एक स्टार्टर संस्कृति देता है ।
    3. 5 मिलीलीटर स्टार्टर संस्कृति के साथ, पौंड मध्यम के 1 एल के साथ प्रत्येक और ३७ डिग्री सेल्सियस पर बढ़ने के साथ, प्रत्येक के साथ 6 flasks inoculate २५० rpm के साथ मिलाते हुए जब तक आयुध डिपो६०० ~ १.० है । 16 डिग्री सेल्सियस के लिए संस्कृति शांत और isopropyl-β-D-thiogalactoside (iptg) को ०.४ मिमी जोड़ें । २५० rpm मिलाते के साथ रात भर 16 डिग्री सेल्सियस पर संस्कृति रखो ।
    4. फसल 15 मिनट के लिए ५,००० एक्स जी पर centrifugation के माध्यम से ई. कोलाई कोशिकाओं और ५० मिलीलीटर शंकु ट्यूबों में सेल छर्रों को इकट्ठा ।
      नोट: प्रोटीन शुद्धि के लिए आगे बढ़ने से पहले सेल छर्रों को प्रोटीन शुद्धिकरण के लिए संसाधित किया जा सकता है या-८० डिग्री सेल्सियस पर जमे रहना चाहिए ।
  3. Cul1sortaseकी शुद्धि • Rbx1 complex. यह विधि पिछली रिपोर्ट20से प्राप्त की गई है ।
    1. lysis बफर की ५० मिलीलीटर (30 मिमी Tris-HCl, २०० मिमी nacl, 5 मिमी डीटीटी, 10% ग्लिसरीन, प्रोटीज़ अवरोधक कॉकटेल के 1 गोली, पीएच ७.६) ई. कोलाई कोशिकाओं के गोली Cul1sortaseव्यक्त करने के लिए Rbx1 जोड़ें ।
    2. ५०% आयाम पर sonication के साथ बर्फ पर कोशिकाओं lyse । 1-सेकंड पर और 1-सेकंड के बीच वैकल्पिक बंद और 3 मिनट के लिए चलाते हैं ।
    3. चरण 2.3.2 2-3x दोहराएं ।
    4. सेल lysate एक ५०-मिलीलीटर अपकेंद्रीकरण ट्यूब में स्थानांतरण और ४५ मिनट के लिए २५,००० एक्स जी पर centrifugation द्वारा सेल मलबे को हटा दें ।
    5. 2 एच के लिए 4 डिग्री सेल्सियस पर ग्लूटाथिओन मोतियों के 5 मिलीलीटर के साथ स्पष्ट सेल lysate सेते ।
    6. 4 डिग्री सेल्सियस पर 2 मिनट के लिए १,५०० एक्स जी पर मोती-lysate मिश्रण अपकेंद्रिका । सुपरनेटंट को हटा दें ।
    7. lysis बफर के 5 मिलीलीटर के साथ मोती धोने (कोई प्रोटीज अवरोधकों के साथ) और 2 मिनट के लिए 4 डिग्री सेल्सियस पर १,५०० एक्स जी पर अपकेंद्रीकरण के बाद सतह पर तैरनेवाला हटा दें ।
    8. चरण 2.3.7 2x दोहराएं ।
    9. धोया मोती के लिए lysis बफर के 3 मिलीलीटर जोड़ें और मनका घोल को एक खाली कॉलम में ट्रांसफर करें ।
    10. 5 मिलीलीटर का रेफरेंस बफर (५० एमएम Tris-HCl, २०० एमएम nacl, 10 एमएम घटा ग्लूटाथिओन, पीएच ८.०) कॉलम में जोड़ें । 10 मिनट के लिए सेते और eluate इकट्ठा ।
    11. चरण 2.3.10 3-4x दोहराएं ।
    12. 5 मिलीग्राम की २०० μl जोड़ें/मिलीलीटर थ्रोम्बिन ( सामग्री तालिकादेखें) glutathione मोतियों से eluate करने के लिए और 4 डिग्री सेल्सियस पर रात भर सेते हैं ।
      नोट: प्रोटोकॉल यहां रोका जा सकता है ।
    13. एक बफर के साथ प्रोटीन नमूना पतला (25 मिमी hepes, 1 मिमी डीटीटी, 5% ग्लिसरोल, पीएच ६.५) threefold ।
    14. एक धनायन विनिमय क्रोमैटोग्राफी कॉलम ( सामग्री तालिकादेखें) एक एफपीएलसी सिस्टम पर बफर ए के साथ equilibrate ।
    15. एक ०.५ मिलीलीटर/मिनट प्रवाह दर पर equilibrated धनायन विनिमय क्रोमेटोग्राफी कॉलम के लिए प्रोटीन नमूना लोड ।
    16. एक 1 मिलीलीटर/न्यूनतम प्रवाह दर पर बफर ए और 0 से ५०% बफर बी (25 एमएम हेप्स, 1 एम nacl, 1 एमएम डीटीटी, 5% ग्लिसरोल, पीएच ६.५) मिश्रण करके ४० मिलीलीटर में nacl की ढाल के साथ प्रोटीन को कम करें ।
    17. sds-पृष्ठ24का उपयोग कर अलग भिन्न अंशों में eluted प्रोटीन की जाँच करें ।
      नोट: प्रोटोकॉल यहां रोका जा सकता है ।
    18. पूल Cul1sortase• Rbx1 युक्त eluate अंशों ।
    19. एक ultraफ़िल्ट्रेशन झिल्ली (30 केडीए कटऑफ) के माध्यम से बफर गुजर द्वारा २.५ एमएल के लिए परित Cul1sortase• Rbx1 नमूना ध्यान लगाओ.
  4. sortase के माध्यम से Cul1 के सी-टर्मिनस के लिए एएमसी जोड़ें-मध्यस्थता transpeptidation21,22.
    1. बफ़र में Cul1sortase• Rbx1 नमूना sortase बफ़र के लिए (५० mm Tris-HCl, १५० मिमी nacl, 10 mm cacl2, pH ७.५) का उपयोग कर एक डिसॉल्टिंग स्तंभ ( सामग्री तालिकादेखें) ।
      1. sortase बफर के 25 मिलीलीटर के साथ एक डिसॉल्टिंग कॉलम equilibrate ।
      2. लोड २.५ mL की Cul1sortase• Rbx1 नमूना स्तंभ में है । प्रवाह के माध्यम से त्यागें ।
      3. sortase बफर के ३.५ मिलीलीटर के साथ नमूना elute । प्रवाह के माध्यम से ले लीजिए ।
    2. में ९०० μl के Cul1 sortase • Rbx1 समाधान में sortase बफर, जोड़ें १०० μl of ६०० μm शुद्ध sortase एक समाधान और 10 μl of 25 मिमी ggggamc पेप्टाइड. रात भर अंधेरे में 30 डिग्री सेल्सियस पर प्रतिक्रिया मिश्रण सेते हैं । ध्यान दें कि यह चरण Cul1amc• Rbx1 जनरेट करेगा ।
      चेतावनी: फ्लोरोसेंट रंजक प्रकाश के प्रति संवेदनशील होते हैं, इसलिए प्रोटीन और नमूना तैयार करने के दौरान उन्हें परिवेश प्रकाश में उजागर करने से बचें जितना संभव हो उतना ।
      नोट: प्रोटोकॉल यहां रोका जा सकता है ।
    3. प्रतिक्रिया मिश्रण करने के लिए नी-nta agarose मोती के ५० μl जोड़ें और 30 मिनट के लिए कमरे के तापमान पर सेते ।
    4. 2 मिनट के लिए ५,००० एक्स जी पर सेंटिगेशन द्वारा एनटीए एगरोस मोती गोली और supernatant इकट्ठा ।
    5. एक आकार बहिष्करण क्रोमैटोग्राफी कॉलम ( सामग्री तालिकादेखें) बफर के साथ (30 मिमी Tris-एचसीएल, १०० एमएम nacl, 1 एमएम डीटीटी, 10% ग्लिसरोल) एफपीएलसी सिस्टम पर ।
    6. सभी Cul1amc• Rbx1 नमूना आकार बहिष्करण क्रोमेटोग्राफी स्तंभ पर लोड । 1.5 x बफर के कॉलम मात्रा के साथ elute ।
    7. sds द्वारा eluate अंशों की जाँच करें-पृष्ठ24.
    8. Cul1एएमसी• Rbx1 युक्त eluate अंशों पूल ।
    9. एक स्पेक्ट्रोफोटोमीटर के साथ २८० एनएम पर अपने अवशोषण का उपयोग कर प्रोटीन एकाग्रता को मापने ।
    10. ८० डिग्री सेल्सियस पर प्रोटीन समाधान और स्टोर aliquot ।
      नोट: प्रोटोकॉल यहां रोका जा सकता है ।

3. FlAsHCand1 की तैयारी, fret ग्राही प्रोटीन

नोट: इस भाग में चरणों के अधिकांश चरण 2 के समान हैं । अलग शर्तें नीचे विस्तार से वर्णित हैं ।

  1. ई. कोली कोशिकाओं में मानव tetracysCand1 व्यक्त करने के लिए प्लाज्मिड का निर्माण ।
    1. नियमित पीसीआर25 के माध्यम से Cand1 के 15वें एमिनो एसिड से पहले डीएनए अनुक्रम कोडन "ccpgccgsg" (tetracysteine/tetracys टैग) जोड़ें (प्राइमर अनुक्रम: tgctgtccgggctgcgcggaggactttag; ctaactagtgtccattgattccaag).
    2. पीसीआर उत्पाद को pgex-4t-2 वेक्टर में डालें । अनुक्रम प्लाज्मिड जीन डालने की पुष्टि करने के लिए सटीक और फ्रेम में है ।
  2. एक्सप्रेस tetracysCand1in ई. कोलाई कोशिकाओं को उसी तरह चरण २.२ के रूप में, सिवाय इसके कि प्लाज्मिड rosetta सक्षम कोशिकाओं में तब्दील हो जाता है ।
  3. ई. कोली कोशिकाओं से tetracysCand1 का शुद्धिकरण ।
    1. lyse ई. कोलाई सेल छर्रों और निकालने tetracysCand1using ग्लूटाथियोन मोती. ये चरण 2.3.1 – 2.3.12 चरणों के रूप में समान हैं ।
    2. बफर सी (५० मिमी Tris-HCl, 1 मिमी डीटीटी, 5% ग्लिसरोल, पीएच ७.५) के साथ ग्लूटाथियोन मोतियों से प्रोटीन eluate तीन परतों से पतला । एक ऋणायन विनिमय क्रोमैटोग्राफी कॉलम ( सामग्री की तालिकादेखें) बफर सी के साथ fplc प्रणाली पर और एक ०.५ मिलीलीटर/मिनट प्रवाह दर पर पतला प्रोटीन नमूना लोड equilibrate ।
    3. एक 1 मिलीलीटर/ंयूनतम प्रवाह दर पर बफर सी और 0 से ५०% बफर डी (५० मिमी Tris-HCl, 1 मीटर nacl, 1 मिमी डीटीटी, 5% ग्लिसरीन, पीएच ७.५) मिश्रण करके ४० मिलीलीटर में nacl की ढाल के साथ प्रोटीन को कम करें । sds का उपयोग कर विभिन्न अंशों में eluted प्रोटीन की जाँच करें-पृष्ठ24, और पूल भागों tetracysCand1 युक्त. ध्यान दें कि tetracysCand1 मुक्त GST की तुलना में एक बड़ा प्रतिधारण मात्रा है ।
    4. एक ultraफ़िल्ट्रेशन झिल्ली (30 केडीए कटऑफ) के माध्यम से बफर गुजर द्वारा परित tetracysCand1 नमूना ध्यान लगाओ.
    5. एफपीएलसी सिस्टम पर लेबलिंग बफर (20 एमएम ट्रिस-एचसीएल, १०० एमएम नेक्ल, 2 एमएम टीसीईपी, 1 एमएम एडटा, 5% ग्लिसरोल) के साथ आकार बहिष्करण क्रोमेटोग्राफी कॉलम को equilibrate करें । लोड tetracysCand1 नमूना (५०० μl हर बार) और sds द्वारा eluate भिन्न की जाँच करें-पृष्ठ24.
    6. पूल सभी Cand1 tetracysयुक्त अंशों और एक ultraफ़िल्ट्रेशन झिल्ली (30 केडीए कटऑफ) के माध्यम से बफर गुजर द्वारा प्रोटीन को ~ ४० μm ध्यान केंद्रित । २८० एनएम पर अपने अवशोषण का उपयोग कर प्रोटीन एकाग्रता का अनुमान लगाएं । प्रोटीन की दुकान के रूप में ५० μl aliquots पर-८० ° c ।
      नोट: प्रोटोकॉल यहां रोका जा सकता है ।
  4. FlAsHCand1 की तैयारी ।
    1. ५० μl tetracysCand1 समाधान करने के लिए ( सामग्री की तालिकादेखें) फ्लैश समाधान के 1 μl जोड़ें ।
    2. मिश्रण अच्छी तरह से और 1-2 एच के लिए अंधेरे में कमरे के तापमान पर मिश्रण सेते फ्लैशCand1 पाने के लिए ।
      नोट: प्रोटोकॉल यहां रोका जा सकता है ।

4. Cand1 की तैयारी, फ्रेट चेस प्रोटीन

नोट: प्रोटीन तैयारी प्रोटोकॉल निम्न संशोधनों के साथ, चरण 3 के समान है ।

  1. pgex-4t-2 वेक्टर में पूर्ण-लंबाई Cand1 के कोडिंग अनुक्रम डालें ।
  2. 30 मिमी Tris-HCl, १०० मिमी nacl, 1 मिमी डीटीटी, 10% ग्लिसरीन वाले बफर के लिए चरण 3.3.5 में उपयोग किए गए बफर को बदलें ।
  3. 3.3.7 और 3.3.8 चरणों को समाप्त करें ।

5. परीक्षण और झंट परख की पुष्टि

  1. फ्रेट बफर तैयार करें जिसमें 30 एमएम Tris-एचसीएल, १०० एमएम nacl, ०.५ एमएम डीटीटी, 1 एमजी/एमएल ओवलबुमिन, पीएच ७.६, और कमरे के तापमान पर उपयोग ।
  2. एक fluorimeter पर Cul1amc• Rbx1 और फ्लैशCand1 के बीच झरोए का परीक्षण करें.
    1. fret बफर के ३०० μl में, Cul1amc• Rbx1 (fret दाता) ७० एनएम की एक अंतिम एकाग्रता के लिए जोड़ें । विलयन को एक कुवेत्ते में हस्तांतरित कर दीजिये ।
    2. एक fluorimeter के नमूना धारक में द्रोणिका रखें. ३५० एनएम उत्तेजना प्रकाश के साथ नमूना उत्तेजित और उत्सर्जन संकेतों को स्कैन ४०० एनएम से ६०० समुद्री मील की वृद्धि पर 1 एनएम ।
    3. चरण 5.2.1 दोहराएं लेकिन बदलें Cul1amc• Rbx1 फ्लैशकरने के लिए Cand1 (fret acceptor) । फ़्लैशCand1 नमूना चरण 5.2.2 में के रूप में एक ही विधि का उपयोग कर स्कैन करें ।
    4. वैकल्पिक ५१० एनएम उत्तेजना प्रकाश के साथ फ्लैशCand1 को उत्तेजित करना, और उत्सर्जन संकेत को ५०० एनएम से ६५० एनएम तक स्कैन करें ।
    5. ३०० μl fret बफर में, दोनों Cul1amc• Rbx1 और ७० एनएम की एक अंतिम एकाग्रता के लिए फ्लैशCand1 जोड़ें । नमूना का उसी तरह से विश्लेषण करें जैसे कि चरण 5.2.2 में ।
  3. Cul1amc• Rbx1 और फ्लैशCand1 चेस (unlabeled Cand1) प्रोटीन (चित्रा 3c) जोड़कर के बीच झत की पुष्टि करें ।
    1. फ्रेट बफर के ३०० μl में, ७० एनएम Cul1amc• Rbx1 और ७०० एनएम Cand1 जोड़ें । नमूना उत्सर्जन के रूप में चरण 5.2.2 में स्कैन करें ।
    2. फ्रेट बफर के ३०० μl में, ७० एनएम फ्लैशCand1 और ७०० एनएम Cand1 जोड़ें । नमूना उत्सर्जन के रूप में चरण 5.2.2 में स्कैन करें ।
    3. fret बफर के ३०० μl में, ७० एनएम Cul1amc• Rbx1 और ७० एनएम फ्लैशCand1 जोड़ें, और 5 मिनट के लिए कमरे के तापमान पर नमूने सेते हैं । फिर ७०० एनएम Cand1 जोड़ें, और इसके तुरंत बाद, नमूना उत्सर्जन के रूप में चरण 5.2.2 में स्कैन) । ध्यान दें कि यह कदम 5.2.5 कदम के समान है ।
    4. ३०० μl fret बफर में, क्रमिक रूप से ७० एनएम Cul1amc• Rbx1, ७०० एनएम Cand1, और ७० एनएम फ्लैशCand1 जोड़ें । 5 मिनट के लिए कमरे के तापमान पर नमूने सेते हैं, और चरण 5.2.2 में के रूप में नमूना उत्सर्जन को स्कैन । ध्यान दें कि यह चेस नमूना है ( चित्रा 3cमें ग्रीन लाइन) ।

6. Cul1 • Cand1 के संबद्धता दर स्थिरांक (kon) को मापने

नोट: एक बंद प्रवाह fluorimeter ऑपरेटिंग का विवरण एक पिछली रिपोर्ट में वर्णित किया गया है26.

  1. माप के लिए बंद प्रवाह fluorimeter तैयार.
    1. निर्माता के निर्देश के अनुसार बंद कर दिया प्रवाह fluorimeter पर बारी.
    2. ३५० एनएम पर उत्तेजना प्रकाश सेट, और एक बैंड पास फिल्टर है कि ४५० एनएम उत्सर्जन प्रकाश के पास और ब्लॉक 500-650 एनएम उत्सर्जन प्रकाश की अनुमति देता है का उपयोग करें ।
    3. भरने की स्थिति में नमूना वाल्व रखें, और पानी से भरा एक 3 मिलीलीटर सिरिंज कनेक्ट करें । दो नमूना सिरिंज (ए और बी) को पानी से धो लें और कई बार नीचे के नमूने सिरिंम ड्राइव पर ले जाकर । इस चरण में उपयोग किए गए सभी जल को त्याग दें ।
    4. भरने की स्थिति में नमूना वाल्व रखें, और एक 3 मिलीलीटर सिरिंज fret बफर से भरा कनेक्ट । नमूना सिरिंज ड्राइव ऊपर और नीचे कई बार ले जाकर fret बफर के साथ दो नमूना सिरिंज धो. इस चरण में उपयोग किए गए सभी fret बफ़र छोड़ें ।
  2. एक नियंत्रण माप (चित्रा 4c) ले लो ।
    1. एक 3 मिलीलीटर सिरिंज और लोड सिरिंज एक १०० एनएम Cul1amc• Rbx1 के साथ fret बफर में कनेक्ट करें । ड्राइव की स्थिति के लिए नमूना वाल्व मुड़ें ।
    2. एक 3 मिलीलीटर सिरिंज कनेक्ट और fret बफर के साथ सिरिंज बी लोड । ड्राइव की स्थिति के लिए नमूना वाल्व मुड़ें ।
    3. परिणाम रिकॉर्डिंग के बिना बंद प्रवाह fluorimeter पर पांच शॉट्स (सिरिंज ए और सिरिंज बी से नमूनों की बराबर मात्रा मिश्रण) लेने के लिए सॉफ्टवेयर में अधिग्रहण के तहत नियंत्रण कक्ष का प्रयोग करें ।
    4. सॉफ्टवेयर में अधिग्रहण के तहत नियंत्रण कक्ष खोलें, और कार्यक्रम ६० एस पर Cul1amc के उत्सर्जन को रिकॉर्ड करने के लिए । इसके बाद एक-एक गोली ले लें ।
    5. चरण 6.2.4 2x दोहराएं ।
    6. नमूना वाल्व को भरण स्थिति में बदलें । खाली सिरिंज बी और झंट बफर के साथ धो लो ।
  3. उपाय मनाया एसोसिएशन दर स्थिरांक (kobs) के Cul1 • Cand1 (चित्रा 4b).
    1. सिरिंज में एक ही के रूप में कदम 6.2.1 में नमूना रखें.
    2. एक 3 मिलीलीटर सिरिंज और लोड सिरिंज बी १०० एनएम फ्लैशCand1 के साथ fret बफर में कनेक्ट करें । ड्राइव की स्थिति के लिए नमूना वाल्व मुड़ें ।
    3. परिणाम रिकॉर्डिंग के बिना पांच शॉट्स लेने के लिए सॉफ्टवेयर में अधिग्रहण के तहत नियंत्रण कक्ष का प्रयोग करें ।
    4. सॉफ्टवेयर में अधिग्रहण के तहत नियंत्रण कक्ष खोलें, और कार्यक्रम ६० एस पर Cul1amc के उत्सर्जन को रिकॉर्ड करने के लिए । इसके बाद एक-एक गोली ले लें ।
    5. चरण 6.3.4 2x दोहराएं ।
    6. खाली सिरिंज बी और झंट बफर के साथ धो लो ।
    7. दोहराएं कदम 6.3.1-6.3.6 fret बफर में फ्लैशCand1 की सांद्रता बढ़ाने के साथ कई बार ।
    8. प्रत्येक शॉट से समय के साथ मापा गया फ्लोरोसेंट संकेतों में परिवर्तन (कमी) को एक घातीय वक्र में फ़िट करें । यह प्रत्येक माप में कश्मीरobsदेना होगा, और इकाई एस-1है । ध्यान दें कि इस गणना के आधार पर एक पिछली रिपोर्ट में अच्छी तरह से चर्चा की गई है27.
  4. प्रत्येक फ़्लैशCand1 एकाग्रता के लिए कश्मीरobsके औसत और मानक विचलन की गणना करें । Cand1 एकाग्रता के खिलाफ औसत कश्मीरobsप्लॉट (चित्रा 4d), और लाइन की ढलान एम-1 एस-1की एक इकाई के साथ, Cul1 • Cand1 के कश्मीरपर प्रतिनिधित्व करता है.

7. वियोजन दर स्थिरांक (koff) Cul1 • Cand1 के Skp1 • F-box प्रोटीन की उपस्थिति में मापें ।

नोट: यह चरण चरण 6, निम्न संशोधनों के साथ के समान है ।

  1. सिरिंज में एक, भरने की स्थिति के तहत, १०० एनएम Cul1amc• Rbx1 और १०० एनएम फ़्लैशCand1 के एक समाधान fret बफर में लोड । "ड्राइव" स्थिति के लिए नमूना वाल्व मुड़ें ।
  2. सिरिंज B में, भरण स्थिति के तहत, Skp1 • Skp2 का समाधान लोड करें (पिछली रिपोर्ट20के बाद तैयार किया गया). "ड्राइव" स्थिति के लिए नमूना वाल्व मुड़ें ।
  3. सॉफ्टवेयर में अधिग्रहण के तहत नियंत्रण कक्ष खोलें, और कार्यक्रम 30 एस पर Cul1amc के उत्सर्जन को रिकॉर्ड करने के लिए । इसके बाद एक-एक गोली ले लें । फ्लोरोसेंट संकेतों सिरिंज ए और सिरिंज बी (चित्रा 5) से समाधान मिश्रण के बाद समय के साथ वृद्धि हुई है ।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Cul1एएमसी और फ्लैशCand1 के बीच झरेट का परीक्षण करने के लिए, हमने पहले ७० एनएम Cul1एएमसी (दाता) और ७० एनएम फ्लैशCand1 (स्वीकारकर्ता) क्रमशः (चित्रा 3 ए-सी, ब्लू लाइन्स) की उत्सर्जन तीव्रता निर्धारित की थी । प्रत्येक विश्लेषण में, केवल एक उत्सर्जन पीक मौजूद था, और फ्लैशCand1 (स्वीकारकर्ता) का उत्सर्जन कम था । जब ७० एनएम के प्रत्येक Cul1amc और फ्लैशCand1 के लिए fret उत्पंन मिश्रित थे, दो उत्सर्जन चोटियों उत्सर्जन स्पेक्ट्रा में मौजूद थे, और Cul1amc के शिखर कम हो गया और फ्लैशCand1 के शिखर उच्च बन गया (चित्रा 3a -सी, लाल रेखाएं) । जब पूर्ण लंबाई Cand1 fret के लिए इस्तेमाल किया गया था, दाता पीक तीव्रता में एक 10% कमी (चित्रा 3a, लाल रेखा) दिखाया, और जब अपनी पहली हेलिक्स के साथ Cand1 कटा हुआ इस्तेमाल किया गया था, दाता पीक तीव्रता की कमी 30% तक बढ़ गया था (चित्रा 3a -डी, लाल लाइनों), उच्च fret दक्षता का सुझाव । पुष्टि करने के लिए कि संकेत परिवर्तन Cul1amc और फ्लैशCand1, ७० एनएम Cul1amc (दाता) के बीच झल्लसे हुई ७०० एनएम बिना लेबल Cand1 (चेस) और ७० एनएम फ्लैशCand1 (acceptor) के साथ मिलाया गया था । नतीजतन, दाता पीक पूरी तरह से बहाल किया गया था और स्वीकारकर्ता पीक कम हो गया था (चित्रा 3 सी, ग्रीन लाइन), जो पुष्टि की कि मनाया झत Cul1amcके गठन पर निर्भर करता है •फ्लैशCand1 परिसर । जोड़ने ७०० एनएम Skp1 • ७० एनएम Cul1एएमसीके लिए Skp2 •फ्लैशCand1 भी पूरी तरह से दाता पीक (चित्रा 3 डी, ग्रीन लाइन) बहाल, सुझाव है कि Cul1 • Cand1 परिसर पूरी तरह से Skp1 द्वारा बाधित किया गया था • संतुलन पर Skp2 ।

Figure 3
चित्रा 3: Cul1 के लिए प्रतिनिधि झंट परख • Cand1 जटिल गठन । fret बफर में नमूने (30 मिमी Tris-एचसीएल, १०० मिमी nacl, ०.५ मिमी डीटीटी, 1 मिलीग्राम/एमएल ovalbumin, पीएच ७.६) ३५० एनएम पर उत्साहित थे, और उत्सर्जन ४०० एनएम से ६५० एनएम के लिए स्कैन किया गया । (क) ७० एनएम Cul1एएमसीका उत्सर्जन स्पेक्ट्रा, ७० एनएम फ्लैशCand1 (पूर्ण), और दो का मिश्रण (fret) । Cand1 (पूर्ण) पूर्ण लंबाई Cand1 के लिए खड़ा है । (ख) ७० एनएम Cul1एएमसीका उत्सर्जन स्पेक्ट्रा, ७० एनएम फ्लैशCand1, और दो का मिश्रण (fret) । Cand1 इसके पहले हेलिक्स के साथ इस प्रयोग में और उसके बाद इस्तेमाल किया गया था नष्ट कर दिया । (ग) ७० एनएम Cul1एएमसीका उत्सर्जन स्पेक्ट्रा, ७० एनएम फ्लैशCand1, दो का मिश्रण (fret), और fret (चेस) के लिए चेस नियंत्रण । चेस नमूना निहित ७० एनएम Cul1एएमसी, ७०० एनएम Cand1 और ७० एनएम फ्लैशCand1 । (घ) ७० एनएम Cul1एएमसीका उत्सर्जन स्पेक्ट्रा, ७० एनएम Cul1एएमसी और ७० एनएम फ्लैशCand1 (fret) का मिश्रण, और ७०० एनएम Skp1 • Skp2 ७० एनएम Cul1एएमसीफ्लैशCand1 कॉम्प्लेक्स में जोड़ा गया । प्रत्येक भूखंड में, उत्सर्जन संकेतों ४५० एनएम पर ७० एनएम Cul1amc के उत्सर्जन को सामान्यीकृत किया गया । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण देखने के लिए ।

को मापने के लिए Cul1 • Cand1 पर समय के साथ दाता संकेत की कमी की निगरानी द्वारा स्थापित झरोखे परख का उपयोग कर, हम पहले परीक्षण किया और प्रोटीन की एकाग्रता निर्धारित करने के लिए इस्तेमाल किया जाएगा । जब 5 एनएम प्रत्येक Cul1amc और फ्लैशCand1 का उपयोग किया गया था, बहुत कम संकेत परिवर्तन देखा गया था (चित्रा 4a), जबकि, जब प्रत्येक प्रोटीन की एकाग्रता ५० एनएम तक बढ़ गई थी, समय के साथ संकेत की कमी देखी गई थी ( चित्रा 4b) और इस परिवर्तन को समाप्त कर दिया गया था अगर फ्लैशके बिना बफर Cand1 (चित्रा 4b) जोड़ा गया था । इसलिए, ५० nm Cul1amc आगे विश्लेषण के लिए इस्तेमाल किया गया था, और मनाया एसोसिएशन दर स्थिरांक की एक श्रृंखला (कश्मीरobs) ५० एनएम Cul1amc फ्लैशCand1 की सांद्रता में वृद्धि के साथ मिश्रण द्वारा मापा गया । प्रत्येक प्रयोग के लिए कश्मीरobs एक ही घातीय वक्र करने के लिए अंक फिटिंग द्वारा गणना की गई थी, और एक ही फ्लैशCand1 एकाग्रता से प्राप्त कश्मीरobs औसत थे. Cand1 एकाग्रता के साथ औसत कश्मीरobs साजिश रचने और एक रैखिक प्रतीपगमन (चित्रा 4d) प्रदर्शन करके, कश्मीरपर 7, 27निर्धारित किया गया था ।

Figure 4
चित्र 4: संघ दर स्थिरांक का प्रतिनिधि मापन. (क) 5 एनएम Cul1एएमसी का प्रतिदीप्ति 5 nm फ्लैशCand1 के अलावा समय पर एक बंद प्रवाह fluorimeter द्वारा निगरानी की गई थी । (ख) ५० एनएम Cul1एएमसी का प्रतिदीप्ति ५० एनएम फ्लैशCand1 के अलावा समय पर एक बंद प्रवाह fluorimeter द्वारा निगरानी की गई थी । (ग) ५० एनएम Cul1एएमसी का प्रतिदीप्ति झंट बफर के अलावा समय के साथ एक बंद कर दिया प्रवाह fluorimeter द्वारा निगरानी की गई थी । (D) Cul1 के लिए Cand1 बाध्यकारी के लिए कश्मीरपर kobs of Cul1 • Cand1 के विभिन्न सांद्रता पर Cand1 की साजिश रची जाती है. रैखिक ढलान १.८ x 107 M-1 s-1के पर k देता है । त्रुटि पट्टियां ± SEM का प्रतिनिधित्व करती हैं; n = 4. सभी नमूनों fret बफर में तैयार किया और ३५० एनएम पर उत्साहित थे । एक बैंड-पास फिल्टर एएमसी से संकेतों को इकट्ठा करने और फ्लैश से संकेतों को बाहर करने के लिए इस्तेमाल किया गया था । कोई डेटा सामांयीकृत नहीं किया गया । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण देखने के लिए ।

परकश्मीरकी माप के समान है, हम मापा वियोजन दर स्थिरांक Cul1 • Cand1 की वृद्धि (पुनर्स्थापना) पर समय के साथ दाता संकेत के बंद प्रवाह fluorimeter की निगरानी द्वारा । Cul1एएमसी और फ्लैशCand1 पहले मिलाया गया, और फिर Skp1 • Skp2 को preassembled Cul1एएमसीके लिए जोड़ा गया था •फ्लैशCand1 बंद प्रवाह फ्लोरीमीटर पर । दाता संकेत जल्दी से वृद्धि हुई है और यह ०.४ s-1 (चित्रा 5) के एक कश्मीरobs का पता चला । इसके विपरीत, जब बफर preassembled Cul1amcके लिए जोड़ा गया था •फ्लैशCand1, कोई संकेत वृद्धि मनाया गया, Cul1 के तेज वियोजन का सुझाव • Cand1 Skp1 द्वारा ट्रिगर किया गया था • Skp2.

Figure 5
चित्र 5: वियोजन दर स्थिरांक का प्रतिनिधि मापन । दाता प्रतिदीप्ति में परिवर्तन बनाम समय १५० एनएम Skp1 • Skp2 या ५० एनएम Cul1amcके लिए fret बफर के अलावा नीचे मापा गया था •फ्लैशCand1 परिसर । सिग्नल परिवर्तन एक घातीय वक्र के लिए फिट थे, और यह ०.४ एस-1का मनाया वियोजन दर स्थिरांक प्रदान करता है । प्रायोगिक परिस्थितियां चित्रा 4में वर्णित के समान थीं । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण देखने के लिए ।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

fret एक भौतिक घटना है कि अध्ययन और समझने के लिए महान ब्याज की है जैविक प्रणालियों19। यहां, हम परीक्षण और fret का उपयोग करने के लिए दो बातचीत प्रोटीन की बाध्यकारी कैनेटीक्स का अध्ययन करने के लिए एक प्रोटोकॉल प्रस्तुत करते हैं । जब fret डिजाइन, हम तीन प्रमुख कारकों पर विचार: वर्णक दाता उत्सर्जन और ग्राही उत्तेजना के बीच ओवरलैप, दो fluorophores के बीच की दूरी, और फ्लोरोफोस28के द्विध्रुव अभिविन्यास । fret के लिए फ्लोरोफोस का चयन करने के लिए, हम उत्तेजना और फ्लोरोफोस के उत्सर्जन स्पेक्ट्रा मढ़ा, और जो उत्सर्जन चोटियों अच्छी तरह से अलग कर रहे हैं, जबकि रक्तदाता के उत्सर्जन स्पेक्ट्रम काफी उत्तेजना के साथ अधिव्याप्त फ्लोरोफोस के लिए खोजा स्वीकारकर्ता का स्पेक्ट्रम (चित्र 2) । इंटरफ्लुओरोफोर दूरी और अभिविन्यास का अनुकूलन करने के लिए, हमने सहायता के लिए क्रिस्टल संरचना का उपयोग किया, और हम मुख्य रूप से प्रोटीन की संरचना और गतिविधि को बाधित करने के कम जोखिम के कारण, प्रोटीन termini को fluorophores संलग्न माना जाता है । चूँकि Cand1 (Cand1ntd) के n-टर्मिनस और Cul1 (Cul1ctd) के c-टर्मिनस के बीच की दूरी Cand1 के c-टर्मिनस और Cul1 (चित्र 1) के n-टर्मिनस के बीच की दूरी से कम है, इसलिए हमने Cand1 ntd को लेबल करने का निर्णय लिया और Cul1ctd. क्योंकि हम 80% प्राप्त करने में सक्षम था-90% N की लेबलिंग दक्षता-tetracysteine टैग का उपयोग कर प्रोटीन के टर्मिनस25, हम tetracysteine टैग के माध्यम से फ्लैश के साथ Cand1ntd लेबल चुना । हम शुरू में सियान फ्लोरोसेंट प्रोटीन (cfp), जो एएमसी पर कुछ लाभ है के साथ Cul1ctd लेबल । सबसे पहले, यह एक आनुवंशिक रूप से इनकोडिंग फ्लोरोसेंट टैग है, तो यह अतिरिक्त लेबलिंग प्रक्रिया और न ही कदम है कि अपने दाईं ओर अनलेबल्ड अग्रदूत से लेबल फ्लोरोसेंट प्रोटीन शुद्ध की आवश्यकता नहीं है । दूसरा, cfp एएमसी की तुलना में उज्जवल है, और इसलिए, यह उच्च परख संवेदनशीलता प्रदान करता है (नीचे चर्चा देखें) । तीसरा, cfp फ्लैश के साथ एक बड़ा स्पेक्ट्रम ओवरलैप, संभावित फ्लैश के साथ अधिक कुशल झल्ट उपज है । इन फायदों के बावजूद, तथापि, cfp प्रोटीन बहुत एएमसी टैग है, जो प्रोटीन रचना और अंतर आणविक संपर्क के साथ हस्तक्षेप कर सकते है की तुलना में बड़ा है । दरअसल, हम अपने परीक्षण है, जो अपर्याप्त द्विध्रुव अभिविन्यास, या cfp टैग द्वारा Cul1 Cand1 बातचीत के विघटन के कारण की संभावना है में Cul1cfp और फ्लैशCand1 के बीच झल्ट का पालन नहीं किया । हम तो एएमसी के साथ Cul1ctd लेबल, और हम Cul1एएमसी और फ्लैशCand1 के बीच झल्ट मनाया । प्रारंभिक fret पूर्ण लंबाई का उपयोग कर Cand1 दाता उत्सर्जन (चित्रा 3a) के 10% की कमी के लिए नेतृत्व किया । हम आगे पाया कि Cand1 के पहले हेलिक्स को हटाने के द्वारा, Cul1 और Cand1 के बीच की दूरी २६.८ å से १५.५ å (चित्रा 1) छोटा है, और Cand1 पहले हेलिक्स की कमी Cul1 के साथ एक बहुत मजबूत झलाहट, दाता उत्सर्जन की 30% कमी दिखा चोटी (चित्रा 3b) । इसके अलावा, एक उच्च क्वांटम उपज और एक बड़ा विलुप्त होने गुणांक के साथ एक ग्राही फ्लोरोफोर के साथ एक दाता फ्लोरोफोर चुनकर fret दक्षता में सुधार कर सकते हैं ।

झल्ट की एक विशेषता विशेषता यह है कि जब झल्का होता है, दाता का उत्सर्जन कम हो जाता है और स्वीकारकर्ता का उत्सर्जन बढ़ जाता है (चित्रा 3 बी) । हालांकि, fluorophores उनके पर्यावरण के प्रति संवेदनशीलता प्रदर्शित कर सकते हैं, और इस प्रकार, उत्सर्जन की तीव्रता बदल सकता है जब एक और प्रोटीन मौजूद है, यहां तक कि29fret के अभाव में । यह पुष्टि करने के लिए कि हमने जो बदला हुआ उत्सर्जन देखा वह Cul1amc और FlAsHCand1 के बीच झट के कारण है, हमने बिना लेबल वाले स्वीकारक प्रोटीन (Cand1) के 10x अतिरिक्त राशि को एक चेस के रूप में जोड़ा । चेस दाता के उत्सर्जन और स्वीकारकर्ता वापस सामांय स्तर (चित्रा 3c) है, जो समर्थन करता है कि Cul1amc और फ्लैशके बदल उत्सर्जन में धर्मांतरित प्रोटीन पर निर्भर Cand1 प्रोटीन संपर्क, और इसलिए, इस परिणाम पुष्टि की है कि हम एक fret परख कि एसोसिएशन और Cul1 • Cand1 के वियोजन रिपोर्ट की स्थापना की । इसके अलावा, हम Skp1 • Skp2 preassembled Cul1amcफ्लैशCand1 परिसर में जोड़ा गया है, और Skp1 • Skp2 के लिए Cul1 Cand1 संपर्क6बाधित करने में सक्षम होने के लिए जाना जाता है । हमने पाया है कि Cul1amc और फ्लैशCand1 के बीच झड़ा गायब हो गया (चित्रा 3 डी, ग्रीन लाइन) और उत्सर्जन स्पेक्ट्रम चेस नमूना (चित्रा 3c, ग्रीन लाइन) के उत्सर्जन स्पेक्ट्रम के समान हो गया, सुझाव Cul1एएमसीफ्लैशCand1 Skp1 से अलग है • Skp2 और Cul1एएमसी असामान्य उत्सर्जन प्रदर्शित नहीं करता है जब Skp1 • Skp2 मौजूद है ।

दाता उत्सर्जन में परिवर्तन की निगरानी करके, हम सीधे संघ और Cul1amcके वियोजन का निरीक्षण कर सकते है • एक बंद प्रवाह fluorimeter परफ्लैशCand1 । बंद प्रवाह प्रणाली तेजी से reactants मिश्रण करने के लिए एक मिश्रण चैंबर के लिए reactants इंजेक्शन द्वारा काम करता है, और मिश्रित reactants एक प्रेक्षण कक्ष में स्थानांतरित कर रहे हैं एक बार प्रवाह को रोकने के5. सिग्नल का पता लगाने आमतौर पर शुरू होता है 1-2 मिलीसेकंड (ms) मिश्रण के बाद, जो मिलीसेकंड टाइमस्केल पर होने वाले इंटरैक्शन का अध्ययन करने में सक्षम बनाता है. हालांकि, जब मनाया प्रतिक्रिया का आधा जीवन एक विशेष डिवाइस पर reactants मिश्रण करने के लिए आवश्यक समय से कम है, यह दृष्टिकोण काफी संवेदनशील नहीं है और अब उपयुक्त नहीं है30. रोकी-प्रवाह विश्लेषण दर स्थिरांक को निर्धारित करने के लिए उपयोग किया गया है 10-6– 106 s-1 प्रथम-क्रम प्रतिक्रियाओं के लिए, और 1-109 M-1 s- 1 द्वितीय-क्रम प्रतिक्रियाओं के लिए5. बंद प्रवाह fluorimeter का उपयोग कर काइनेटिक मापदंडों के विश्वसनीय माप प्राप्त करने के लिए, प्रारंभिक और संतुलन अंक के बीच फ्लोरोसेंट संकेत का एक महत्वपूर्ण परिवर्तन आवश्यक है. हम फ्लैशका इस्तेमाल किया Cand1 acceptor के रूप में पहले हेलिक्स की कमी है, क्योंकि यह Cul1amcके साथ बेहतर fret पैदावार, और हम प्रोटीन की एकाग्रता का परीक्षण करने के लिए माप के लिए इस्तेमाल किया जाएगा । जब 5 एनएम प्रत्येक Cul1एएमसी और फ्लैशCand1 मिलाया गया था, Cul1एएमसी सिग्नल में कोई परिवर्तन नहीं देखा गया (चित्रा 4a), इस एकाग्रता का सुझाव देना माप के लिए अपर्याप्त है । जब प्रोटीन सांद्रता को ५० एनएम तक बढ़ा दिया गया, तो समय के साथ Cul1amc सिग्नल में कमी स्पष्ट हो गई (चित्र 4b), और यह परिवर्तन तब नहीं होता जब स्वीकारकर्ता प्रोटीन अनुपस्थित था (चित्र 4b) । इस परिणाम के आधार पर, हम ५० एनएम concertation पर Cul1amc का इस्तेमाल किया Cul1 के लिए कश्मीरपर मापने के लिए • Cand1 । माप के लिए उपयोग किया जाने वाला रक्तदाता प्रोटीन की सांद्रता भिन्न हो सकती है जब विभिन्न फ्रलोरोफोरों का उपयोग किया जाता है । उदाहरण के लिए, जब Cul1 cfp के साथ लेबल की गई है, तो 5 एनएम की cfpCul16 परkकी माप के लिए पर्याप्त है । इसलिए, प्रोटीन की इष्टतम एकाग्रता प्रत्येक fret जोड़ी के लिए परीक्षण किया जाना चाहिए, और सिद्धांत रूप में, उज्जवल फ्लोरोफोस कम प्रोटीन सांद्रता के उपयोग की अनुमति देते हैं और बेहतर संकेत करने वाली शोर अनुपात प्रदान करते हैं31.

fret द्वारा प्रोटीन प्रोटीन बातचीत का अध्ययन करने के लिए, यह प्रोटीन की संरचना और गतिविधि है, जो संभवतः fret के उपयोग को सीमित करने में बाधा डाले बिना उचित पदों पर प्रोटीन के लिए fluorophores संलग्न की आवश्यकता है । इस प्रोटोकॉल में, हम Cand1 के N-टर्मिनस लेबल एक tetracysteine टैग का उपयोग कर, जो विशेष रूप से फ्लैश डाई बांध और फ्लैश डाई फ्लोरोसेंट के बाद ही यह लक्ष्य प्रोटीन३२बांधता हो जाता है । हम sortase-मध्यस्थता transpeptidation का उपयोग कर Cul1 लेबल, जो एक छोटी पेप्टाइड ले जाता है sortase टैग करने के लिए एक फ्लोरोफोर के C-टर्मिनस पर Cul121,22. लेबलिंग दक्षता tetracysteine टैग के साथ > ८०% है, और sortase के साथ लगभग १००%--nta मोती का उपयोग कर unreacted प्रोटीन को हटाने के बाद अपने6 टैग (कदम 2.4.3-2.4.4). दोनों तरीकों प्रोटीन संरचना करने के लिए न्यूनतम परिवर्तन का परिचय, लक्ष्य प्रोटीन के लिए कुछ एमिनो एसिड जोड़ने. इसी तरह के तरीकों, जैसे transglutaminase मान्यता अनुक्रम (Q-tag)३३ और ybbr टैग३४, भी एक साइट-विशिष्ट तरीके से लक्ष्य प्रोटीन लेबल करने के लिए इस्तेमाल किया जा सकता. इसके अलावा, फ्लोरोसेंट रंगों की photostability भी झल्ट के उपयोग को सीमित कर सकते हैं । दोहराव या उत्तेजना प्रकाश के लिए लंबे समय जोखिम फ्लोरोफोर के photobleaching के लिए नेतृत्व कर सकते हैं, गलत परिमाणन परिणाम३५में जिसके परिणामस्वरूप. इसलिए, तैयार करने और भंडारण के चरणों के दौरान दाता और ग्राही प्रोटीन को प्रकाश से संरक्षित किया जाना चाहिए । जब समय के साथ दाता उत्सर्जन में परिवर्तन की लगातार निगरानी करने के बजाय धीरे से होने वाली घटनाओं को मापने के लिए fret का उपयोग करते हैं, दाता उत्सर्जन के छोटे रीडिंग लंबे समय के अंतराल पर लिया जाना चाहिए और नमूने के दौरान अंधेरे में रखा जाना चाहिए पूरे प्रयोग6.

क्योंकि fret संवेदनशील और मात्रात्मक है, यह macromolecules के बीच बातचीत के अध्ययन के लिए एक महत्वपूर्ण उपकरण बन गया है । इस प्रोटोकॉल के समाधान में एक प्रोटीन कॉम्प्लेक्स की गतिशीलता का अध्ययन करने के लिए fret का उपयोग करने का एक उदाहरण प्रस्तुत करता है. fret भी जीवित कोशिकाओं३६, जो शारीरिक परिस्थितियों में प्रोटीन परिसरों की गतिशीलता का खुलासा करने में शक्तिशाली है में आणविक बातचीत का अध्ययन करने के लिए लाइव सेल इमेजिंग के साथ एक साथ इस्तेमाल किया गया है । इसके अलावा, fret भी एकल अणु स्तर पर इस्तेमाल किया जा सकता है macromolecular परिसरों३७,३८की वास्तविक समय गतिशीलता का अध्ययन, जटिल के conformational परिवर्तन में अंतर्दृष्टि प्रदान करते हैं । दक्षता और fret का पता लगाने में सुधार करने के लिए, fluorophores और बढ़ाया चमक और photostability के साथ एन्टीजन महान ब्याज की हैं, जो सक्रिय रूप से इंजीनियर और अध्ययन कर रहे हैं28,३९.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों का खुलासा करने के लिए कुछ नहीं है ।

Acknowledgments

हम शू-Ou शान (कैलिफोर्निया प्रौद्योगिकी संस्थान) के लिए fret परख के विकास पर व्यावहारिक चर्चा के लिए धंयवाद । एमजी, y.z., और x.l. को स्टार्टअप फंडों द्वारा प्रड़े विश्वविद्यालय से y.z. और एक्स. एल द्वारा वित्त पोषित किया गया था । इस काम के हिस्से में संयंत्र जीव विज्ञान के लिए purdue विश्वविद्यालय केंद्र से एक बीज अनुदान द्वारा समर्थित किया गया था ।

Materials

Name Company Catalog Number Comments
Anion exchange chromatography column GE Healthcare 17505301 HiTrap Q FF anion exchange chromatography column
Benchtop refrigerated centrifuge Eppendorf 2231000511
BL21 (DE3) Competent Cells ThermoFisher Scientific C600003
Calcium Chloride Fisher Scientific C78-500
Cation exchange chromatography column GE Healthcare 17505401 HiTrap SP Sepharose FF
Desalting Column GE Healthcare 17085101
Floor model centrifuge (high speed) Beckman Coulter J2-MC
Floor model centrifuge (low speed) Beckman Coulter J6-MI
Fluorescence SpectraViewer ThermoFisher Scientific https://www.thermofisher.com/us/en/home/life-science/cell-analysis/labeling-chemistry/fluorescence-spectraviewer.html
FluoroMax fluorimeter HORIBA FluoroMax-3
FPLC GE Healthcare 29018224
GGGGAMC peptide New England Peptide custom synthesis
Glutathione beads GE Healthcare 17075605
Glycerol Fisher Scientific G33-500
HEPES Fisher Scientific BP310-100
Isopropyl-β-D-thiogalactoside (IPTG) Fisher Scientific 15-529-019
LB Broth Fisher Scientific BP1426-500
Ni-NTA agarose Qiagen 30210
Ovalbumin MilliporeSigma A2512
pGEX-4T-2 vector GE Healthcare 28954550
Protease inhibitor cocktail MilliporeSigma 4693132001
Reduced glutathione Fisher Scientific BP25211
Refrigerated shaker Eppendorf M1282-0004
Rosetta Competent Cells MilliporeSigma 70953-3
Size exclusion chromatography column GE Healthcare 28990944 Superdex 200 10/300 GL column
Sodium Chloride (NaCl) Fisher Scientific S271-500
Stopped-flow fluorimeter Hi-Tech Scientific SF-61 DX2
TCEP·HCl Fisher Scientific PI20490
Thrombin MilliporeSigma T4648
Tris Base Fisher Scientific BP152-500
Ultrafiltration membrane MilliporeSigma UFC903008 Amicon Ultra-15 Centrifugal Filter Units, Ultra-15, 30,000 NMWL

DOWNLOAD MATERIALS LIST

References

  1. Stumpf, M. P. H., et al. Estimating the size of the human interactome. Proceedings of the National Academy of Sciences of the United States of America. 105, (19), 6959-6964 (2008).
  2. Kuzmanov, U., Emili, A. Protein-protein interaction networks: probing disease mechanisms using model systems. Genome Medicine. 5, (4), 37 (2013).
  3. Titeca, K., Lemmens, I., Tavernier, J., Eyckerman, S. Discovering cellular protein-protein interactions: Technological strategies and opportunities. Mass Spectrometry Reviews. 1-33 (2018).
  4. Lapetina, S., Gil-Henn, H. A guide to simple, direct, and quantitative in vitro binding assays. Journal of Biological Methods. 4, (1), 62 (2017).
  5. Zheng, X., Bi, C., Li, Z., Podariu, M., Hage, D. S. Analytical methods for kinetic studies of biological interactions: A review. Journal of Pharmaceutical and Biomedical Analysis. 113, 163-180 (2015).
  6. Pierce, N. W., et al. Cand1 promotes assembly of new SCF complexes through dynamic exchange of F box proteins. Cell. 153, (1), 206-215 (2013).
  7. Liu, X., Reitsma, J. M., Mamrosh, J. L., Zhang, Y., Straube, R., Deshaies, R. J. Cand1-Mediated Adaptive Exchange Mechanism Enables Variation in F-Box Protein Expression. Molecular Cell. 69, (5), 773-786 (2018).
  8. Zheng, N., et al. Structure of the Cul1-Rbx1-Skp1-F boxSkp2 SCF ubiquitin ligase complex. Nature. 416, (6882), 703-709 (2002).
  9. Kleiger, G., Deshaies, R. Tag Team Ubiquitin Ligases. Cell. 166, (5), 1080-1081 (2016).
  10. Zheng, J., et al. CAND1 binds to unneddylated CUL1 and regulates the formation of SCF ubiquitin E3 ligase complex. Molecular Cell. 10, (6), 1519-1526 (2002).
  11. Hwang, J. W., Min, K. W., Tamura, T. A., Yoon, J. B. TIP120A associates with unneddylated cullin 1 and regulates its neddylation. FEBS Letters. 541, (1-3), 102-108 (2003).
  12. Min, K. W., Hwang, J. W., Lee, J. S., Park, Y., Tamura, T., Yoon, J. B. TIP120A associates with cullins and modulates ubiquitin ligase activity. Journal of Biological Chemistry. 278, (18), 15905-15910 (2003).
  13. Goldenberg, S. J., et al. Structure of the Cand1-Cul1-Roc1 complex reveals regulatory mechanisms for the assembly of the multisubunit cullin-dependent ubiquitin ligases. Cell. 119, (4), 517-528 (2004).
  14. Chuang, H. W., Zhang, W., Gray, W. M. Arabidopsis ETA2, an apparent ortholog of the human cullin-interacting protein CAND1, is required for auxin responses mediated by the SCF(TIR1) ubiquitin ligase. Plant Cell. 16, (7), 1883-1897 (2004).
  15. Feng, S., et al. Arabidopsis CAND1, an Unmodified CUL1-Interacting Protein, Is Involved in Multiple Developmental Pathways Controlled by Ubiquitin/Proteasome-Mediated Protein Degradation. the Plant Cell Online. 16, (7), 1870-1882 (2004).
  16. Cheng, Y., Dai, X., Zhao, Y. AtCAND1, a HEAT-repeat protein that participates in auxin signaling in Arabidopsis. Plant Physiology. 135, (June), 1020-1026 (2004).
  17. Lo, S. -C., Hannink, M. CAND1-Mediated Substrate Adaptor Recycling Is Required for Efficient Repression of Nrf2 by Keap1. Molecular and Cellular Biology. 26, (4), 1235-1244 (2006).
  18. Okamoto, K., Sako, Y. Recent advances in FRET for the study of protein interactions and dynamics. Current Opinion in Structural Biology. 46, 16-23 (2017).
  19. Hussain, S. A. An introduction to fluorescence resonance energy transfer (FRET). arXiv preprint. (2009).
  20. Li, T., Pavletich, N. P., Schulman, B. A., Zheng, N. High-level expression and purification of recombinant SCF ubiquitin ligases. Methods in Enzymology. 398, (1996), 125-142 (2005).
  21. Popp, M. W., Antos, J. M., Grotenbreg, G. M., Spooner, E., Ploegh, H. L. Sortagging: A versatile method for protein labeling. Nature Chemical Biology. 3, (11), 707-708 (2007).
  22. Antos, J. M., Ingram, J., Fang, T., Pishesha, N., Truttmann, M. C., Ploegh, H. L. Site-Specific Protein Labeling via Sortase-Mediated Transpeptidation. Current Protocols in Protein Science. 89, (2017).
  23. Froger, A., Hall, J. E. Transformation of Plasmid DNA into E. coli Using the Heat Shock Method. Journal of Visualized Experiments. (2007).
  24. Simpson, R. J. SDS-PAGE of Proteins. Cold Spring Harbor Protocols. 2006, (1), (2006).
  25. Kleiger, G., Saha, A., Lewis, S., Kuhlman, B., Deshaies, R. J. Rapid E2-E3 Assembly and Disassembly Enable Processive Ubiquitylation of Cullin-RING Ubiquitin Ligase Substrates. Cell. 139, (5), 957-968 (2009).
  26. Biro, F. N., Zhai, J., Doucette, C. W., Hingorani, M. M. Application of Stopped-flow Kinetics Methods to Investigate the Mechanism of Action of a DNA Repair Protein. Journal of Visualized Experiments. (37), 2-8 (2010).
  27. Patel, J. T., Belsham, H. R., Rathbone, A. J., Friel, C. T. Use of Stopped-Flow Fluorescence and Labeled Nucleotides to Analyze the ATP Turnover Cycle of Kinesins. Journal of Visualized Experiments. (92), 1-6 (2014).
  28. Bajar, B. T., Wang, E. S., Zhang, S., Lin, M. Z., Chu, J. A guide to fluorescent protein FRET pairs. Sensors (Switzerland). 16, (9), 1-24 (2016).
  29. Chen, A. K., Cheng, Z., Behlke, M. A., Tsourkas, A. Assessing the sensitivity of commercially available fluorophores to the intracellular environment. Analytical Chemistry. 80, (19), 7437-7444 (2008).
  30. Lin, C. T., Rorabacher, D. B. Mathematical approach for stopped-flow kinetics of fast second-order reactions involving inhomogeneity in the reaction cell. Journal of Physical Chemistry. 78, (3), 305-308 (1974).
  31. Toseland, C. P., Geeves, M. A. Rapid Reaction Kinetic Techniques. Fluorescent Methods for Molecular Motors. 49-65 (2014).
  32. Adams, S. R., et al. New biarsenical ligands and tetracysteine motifs for protein labeling in vitro and in vivo: Synthesis and biological applications. Journal of the American Chemical Society. 124, (21), 6063-6076 (2002).
  33. Lin, C. W., Ting, A. Y. Transglutaminase-catalyzed site-specific conjugation of small-molecule probes to proteins in vitro and on the surface of living cells. Journal of the American Chemical Society. 128, (14), 4542-4543 (2006).
  34. Yin, J., et al. Genetically encoded short peptide tag for versatile protein labeling by Sfp phosphopantetheinyl transferase. Proceedings of the National Academy of Sciences of the United States of America. 102, (44), 15815-15820 (2005).
  35. Diaspro, A., Chirico, G., Usai, C., Ramoino, P., Dobrucki, J. Photobleaching. Handbook Of Biological Confocal Microscopy. 690-702 (2006).
  36. Aoki, K., Kamioka, Y., Matsuda, M. Fluorescence resonance energy transfer imaging of cell signaling from in vitro to in vivo: Basis of biosensor construction, live imaging, and image processing. Development, Growth & Differentiation. 55, (4), 515-522 (2013).
  37. Kilic, S., et al. Single-molecule FRET reveals multiscale chromatin dynamics modulated by HP1α. Nature Communications. 9, (1), (2018).
  38. Shen, K., Arslan, S., Akopian, D., Ha, T., Shan, S. O. Activated GTPase movement on an RNA scaffold drives co-translational protein targeting. Nature. 492, (7428), 271-275 (2012).
  39. Bajar, B. T., et al. Improving brightness and photostability of green and red fluorescent proteins for live cell imaging and FRET reporting. Scientific Reports. 6, (February), 1-12 (2016).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics