Usando na transferência de energia de ressonância de fluorescência de Vitro para estudar a dinâmica dos complexos de proteínas em uma escala de tempo de milissegundo

Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Interações da proteína-proteína são essenciais para sistemas biológicos, e estudos sobre a cinética de ligação fornecem insights sobre a dinâmica e a função dos complexos da proteína. Nós descrevemos um método que quantifica os parâmetros cinéticos de uma proteína complexa usando transferência de energia de ressonância de fluorescência e a técnica de fluxo parou.

Cite this Article

Copy Citation | Download Citations

Garsamo, M., Zhou, Y., Liu, X. Using In Vitro Fluorescence Resonance Energy Transfer to Study the Dynamics Of Protein Complexes at a Millisecond Time Scale. J. Vis. Exp. (145), e59038, doi:10.3791/59038 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

As proteínas são os operadores primários de sistemas biológicos, e geralmente interagem com outro macro - ou pequenas moléculas para realizar suas funções biológicas. Tais interações podem ser altamente dinâmicas, significando as subunidades interagindo constantemente são associadas e dissociadas a determinadas taxas. Enquanto a afinidade de ligação usando técnicas tais como suspenso quantitativo revela a força da interação, estudando a cinética de ligação de medição fornece insights sobre como rápido a interação ocorre e quanto tempo cada complexo pode existir. Além disso, medir a cinética da interação na presença de um fator adicional, como um fator de troca de proteína ou uma droga, ajuda a revelar o mecanismo pelo qual a interação é regulada por outro fator, fornecendo conhecimentos importantes para o avanço de pesquisas biológicas e médicas. Aqui, descrevemos um protocolo para avaliar a cinética de ligação de um complexo de proteínas que tem uma taxa de associação intrínseca elevada e pode ser rapidamente dissociado por outra proteína. O método utiliza a transferência de energia de ressonância de fluorescência para relatar a formação do complexo proteína in vitro, e permite monitorar a rápida associação e dissociação do complexo em tempo real em um fluorímetro de fluxo parou. Usando este ensaio, as constantes de taxa de associação e dissociação da proteína complexa são quantificadas.

Introduction

Atividades biológicas em última análise, são realizadas por proteínas, mais do que interagir com outras pessoas para funções biológicas. Usando uma abordagem computacional, a quantidade total de interações da proteína-proteína em humanos é estimada em 650.000 ~1, e interrupção dessas interações muitas vezes leva a doenças2. Devido a seus papéis essenciais no controle de processos celulares e organismos, inúmeros métodos foram desenvolvidos para estudar interações da proteína-proteína, tais como levedura-dois-híbrido, complementação de fluorescência bimolecular, split-luciferase complementação e co-imunoprecipitação ensaio3. Enquanto esses métodos são bons em descobrir e confirmando as interações da proteína-proteína, eles são geralmente não-quantitativos e, portanto, fornecem informações limitadas sobre a afinidade entre os parceiros de proteína interagindo. Pull-downs quantitativas podem ser usados para medir a afinidade de ligação (por exemplo, a constante de dissociação Kd), mas ele não mede a cinética da ligação, nem pode ser aplicada quando o Kd é muito baixa devido a uma insuficiente relação sinal-ruído4. Espectroscopia de ressonância (SPR) de plasmon de superfície quantifica a cinética de ligação, mas requer uma superfície específica e a imobilização de um reagente na superfície, o que potencialmente pode alterar a propriedade de ligação do reagente5. Além disso, é difícil para SPR medir Associação rápida e taxas de dissociação5, e não é apropriado usar SPR para caracterizar o evento de troca de subunidades de proteínas em um complexo proteico. Aqui, descrevemos um método que permite medir taxas de proteína complexa montagem e desmontagem em uma escala de tempo em milissegundos. Este método foi essencial para determinar a função de Cullin -umssociated -Nedd8 -dissociated proteína 1 (Cand1) como o F-caixa proteína troca fator6,7.

Cand1 regula a dinâmica da E3 ligases do proteína (SCF) Skp1•Cul1•F-caixa, que pertencem à grande família de ligases do ubiquitin Cullin-anel. SCFs consistem no neddylation Cul1, que se liga a proteína de domínio de anel Rbx1, e uma proteína F-caixa intercambiável, o que recruta substratos e liga Cul1 através da proteína do adaptador Skp18. Como um ligase E3, SCF catalisa a conjugação da ubiquitina de seu substrato, e é ativado quando o substrato é recrutado pela proteína F-box, e quando Cul1 é modificado pela proteína ubiquitina-como Nedd89. Cand1 liga Cul1 sem modificações, e após a ligação, ele perturba tanto a associação de proteína Skp1•F-caixa com Cul1 e a conjugação de Nedd8 de Cul110,11,12,13. Como resultado, Cand1 parecia ser um inibidor da atividade do SCF in vitro, mas Cand1 deficiência em organismos causou defeitos que sugere um papel positivo de Cand1 na regulação de atividades SCF em vivo14,15,16 , 17. este paradoxo foi finalmente explicado por um estudo quantitativo que revelou as interações dinâmicas entre Cul1, Cand1 e Skp1•F-caixa de proteína. Utilizando ensaios de transferência (FRET) de energia ressonância fluorescência que detectam a formação dos complexos SCF e Cul1•Cand1, a associação e dissociação taxa constantes (k,na e kfora, respectivamente) foram medido individualmente. As medições revelaram que tanto Cand1 e Skp1•F-caixa de forma extremamente apertado complexo proteico com Cul1, mas o kfora do SCF é dramaticamente aumentado pela Cand1 e o kfora de Cul1•Cand1 é dramaticamente aumentada por Skp1•F-caixa proteína6,7. Estes resultados fornecem o apoio inicial e crítico para definir o papel de Cand1 como um fator de troca de proteína, que catalisa a formação de novos complexos SCF através da reciclagem de Cul1 desde os antigos complexos SCF.

Aqui, apresentamos o processo de desenvolvimento e usando o ensaio FRET para estudar a dinâmica do complexo Cul1•Cand17, e o mesmo princípio pode ser aplicado para estudar a dinâmica de várias biomoléculas. TRASTE ocorre quando um doador está animado com o comprimento de onda adequado, e um aceitador com espectro de excitação sobrepondo o espectro de emissão do doador está presente dentro de uma distância de 10 a 100 Å. O estado excitado é transferido para o aceitador, desse modo diminuindo a intensidade do doador e aumentando a intensidade de aceitador18. A eficiência do traste (E) depende do raio de Förster (R0) e a distância entre o doador e aceptor fluorophores (r) e é definida por: E = R06/ (R0 6 + r6). O raio de Förster (R0) depende de alguns fatores, incluindo a orientação angular de dipolo, a sobreposição espectral do par doador-aceitador e a solução usada19. Para aplicar o traste do ensaio em um fluorímetro de fluxo parou, que monitora a mudança das emissões doador em tempo real e permite medições de rápido k,na e kfora, é necessário estabelecer FRET eficiente que resulta em uma redução significativa das emissões de doador. Portanto, projetar FRET eficiente, escolhendo o par apropriado de corantes fluorescentes e sites sobre as proteínas alvo para anexar as tinturas é importante e será discutido neste protocolo.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. design o ensaio de traste.

  1. Baixe o arquivo de estrutura do complexo do Cul1•Cand1 do banco de dados da proteína (arquivo 1U6G).
  2. Exiba a estrutura de complexos em PyMOL o Cul1•Cand1.
  3. Use a função de medição no menu Assistente de PyMOL para estimar a distância entre o primeiro aminoácido da Cand1 e o último aminoácido de Cul1 (Figura 1).
  4. Carregar o Visualizador de espectros on-line (ver Tabela de materiais) e ver a excitação e espectros de emissão de 7-amino-4-metilcumarina (AMC) e FlAsH simultaneamente (Figura 2). Observe que a AMC é o doador FRET e FlAsH é o aceitador de traste.

Figure 1
Figura 1: A estrutura de cristal de Cul1•Cand1 e medição da distância entre o potencial rotulagem sites. O arquivo de estrutura de cristal foi baixado do Protein Data Bank (arquivo 1U6G) e visualizado em PyMOL. Medições entre átomos selecionados foram feitas por PyMOL. Clique aqui para ver uma versão maior desta figura.

Figure 2
Figura 2: A excitação e espectros de emissão das tinturas fluorescentes para FRET. Espectros de AMC (7-amino-4-metilcumarina) e FlAsH são mostrados. Linhas tracejadas indicam espectros de excitação e linhas sólidas indicam espectros de emissão. A imagem foi originalmente gerada pela SpectraViewer de fluorescência e foi modificada para melhor clareza. Clique aqui para ver uma versão maior desta figura.

2. preparação de Cul1 •Rbx1 daAMC, a proteína de doador FRET

  1. Construa plasmídeos para expressar o humano Cul1sortase•Rbx1 em células de Escherichia coli . Observe que os dois plasmídeos expressando co humano Cul1•Rbx1 em células de Escherichia coli são descritos em detalhes no relatório anterior20.
    1. Adicione uma sequência de DNA codificação "LPETGGHHHHHH" (marca sortase-His6 ) à extremidade 3' do Cul1 a sequência de código através de PCR padrão e clonagem métodos21,22.
    2. Sequenciar o plasmídeo novo para confirmar a inserção do gene é exata.
  2. Express co Cul1sortase•Rbx1 em células de Escherichia coli . O método é derivado de um anterior relatório20.
    1. Mix 100 ng cada dos dois plasmídeos com BL21 (DE3) células quimicamente competentes para transformação co usando o calor choque método23. Desenvolvem-se células na placa de ágar LB contendo 100 µ g/mL ampicilina e cloranfenicol 34 µ g/mL a 37 ° C durante a noite.
    2. Inocular 50 mL de cultura LB com colônias recém transformadas e crescer durante a noite a 37 ° C, com agitação de 250 rpm. Isto dá uma cultura starter.
    3. Inocular 6 frascos, cada um com 1 L de meio LB, com cultura de acionador de partida 5 mL cada e crescer a 37 ° C com 250 rpm agitação até que o OD600 ~ 1.0. Arrefecer a cultura a 16 ° C e adicionar isopropil-β-D-thiogalactoside (IPTG) a 0,4 mM. Manter a cultura a 16 ° C durante a noite com a agitação de 250 rpm.
    4. Colheita de células de Escherichia coli através de centrifugação a 5.000 x g durante 15 min e coletar pelotas de célula em tubos de Erlenmeyer de 50 mL.
      Nota: As pelotas de célula podem ser processadas para a purificação de proteínas ou ser congeladas a-80 ° C antes de prosseguir para as etapas de purificação de proteínas.
  3. Purificação da Cul1sortase•Rbx1 complexo. Este método é derivado de um anterior relatório20.
    1. Adicione 50 mL de tampão de lise (30 mM Tris-HCl, NaCl, 5 mM DTT, 10% de glicerol, 1 comprimido de 200 mM de inibidor da protease cocktail, pH 7,6) ao pellet de células de Escherichia coli expressando Cul1sortase•Rbx1.
    2. Lise as células no gelo com sonication em amplitude de 50%. Alterne entre 1 segundo e 1 segundo e concorrer a 3 min.
    3. Repita a etapa 2.3.2 x 2-3.
    4. Transfira o lisado celular em um tubo de centrifugação de 50 mL e remova os restos de células por centrifugação a 25.000 x g durante 45 min.
    5. Incube as células claras lisada com 5 mL de grânulos de glutationa em 4 ° C por 2 h.
    6. Centrifugue a mistura de grânulos-lisado a 1.500 x g por 2 min a 4 ° C. Remova o sobrenadante.
    7. Lave os grânulos com 5 mL de tampão de lise (com não inibidores de protease) e remover o sobrenadante após centrifugação a 1.500 x g por 2 min a 4 ° C.
    8. Repita a etapa 2.3.7 2x.
    9. Adicionar 3 mL de tampão de Lise para os grânulos lavados e transferir o chorume do grânulo para uma coluna vazia.
    10. Adicione 5 mL de tampão de eluição (50 mM Tris-HCl, 200 mM NaCl, glutationa reduzida de 10mm, pH 8.0) na coluna. Incubar durante 10 min e recolher o eluato.
    11. Repita a etapa 2.3.10 x 3-4.
    12. Adicionar 200 µ l de trombina de 5 mg/mL (ver Tabela de materiais) para o eluato de missanga a glutationa e incubar durante a noite a 4 ° C.
      Nota: O protocolo pode ser pausado aqui.
    13. Dilua a amostra de proteína com tampão A (25mm HEPES, 1 milímetro DTT, 5% de glicerol, pH 6.5) três vezes.
    14. Equilibrar uma coluna de cromatografia de permuta catiónica (ver Tabela de materiais) em um sistema FPLC com Buffer A.
    15. Carrega a amostra de proteína para a coluna de cromatografia de troca de cátion equilibrado em uma taxa de fluxo de 0,5 mL/min.
    16. Eluir a proteína com um gradiente de NaCl em 40 mL pela mistura de tampão A e 0 a 50% B Buffer (pH 6,5 de 25mm HEPES, 1 M NaCl, 1 milímetro DTT, 5% de glicerol,) em uma taxa de fluxo de 1 mL/min.
    17. Verifique a proteína eluted em diferentes frações utilizando SDS-PAGE24.
      Nota: O protocolo pode ser pausado aqui.
    18. As frações de eluato contendo Cul1sortase•Rbx1 da piscina.
    19. Concentre-se em pool Cul1sortase•Rbx1 amostra de 2,5 mL, passando a reserva através de uma membrana de ultrafiltração (corte de 30 kDa).
  4. Adicione AMC para o C-terminal da Cul1 através de mediada por sortase transpeptidation21,22.
    1. Alterar o buffer na amostra Cul1sortase•Rbx1 para o buffer de sortase (50 mM Tris-HCl, 150 mM NaCl, 10 mM CaCl2, pH 7,5) usando uma coluna do desalting (ver Tabela de materiais).
      1. Equilibrar uma coluna do desalting com 25 mL de tampão de sortase.
      2. Carrega 2,5 mL da amostra de •Rbx1 desortaseCul1 para a coluna. Descarte o escoamento.
      3. Eluir a amostra com 3,5 mL de tampão de sortase. Colete o escoamento.
    2. Em 900 µ l da solução de •Rbx1 de Cul1sortaseno buffer sortase, adicione 100 µ l de solução sortase 600 µM purificado e 10 µ l de peptídeo de GregorioAMC de 25 mM. Incube a mistura de reação a 30 ° C na noite escura. Nota que esta etapa irá gerar Cul1AMC•Rbx1.
      Cuidado: Corantes fluorescentes são sensíveis à luz, então evite expô-los à luz ambiente durante a preparação da proteína e amostra tanto quanto possível.
      Nota: O protocolo pode ser pausado aqui.
    3. Adicionar 50 µ l de grânulos de agarose Ni-NTA a mistura de reacção e incubar a temperatura ambiente por 30 min.
    4. Os grânulos de agarose Ni-NTA de pelotas por centrifugação a 5.000 x g por 2 min e recolher o sobrenadante.
    5. Equilibrar uma coluna de cromatografia de exclusão de tamanho (ver Tabela de materiais) com buffer (30 mM Tris-HCl, 100 mM de NaCl, 1 milímetro DTT, 10% de glicerol) no sistema FPLC.
    6. Carregar todos os Cul1AMC•Rbx1 amostra na coluna de cromatografia de exclusão de tamanho. Eluir com volume de coluna x 1,5 de buffer.
    7. Verifique as frações de eluato por SDS-PAGE24.
    8. As frações de eluato contendo Cul1 da piscinaAMC•Rbx1.
    9. Medir a concentração de proteína usando sua absorbância em 280 nm com um espectrofotômetro.
    10. Alíquota da solução de proteína e loja a-80 ° C.
      Nota: O protocolo pode ser pausado aqui.

3. preparação de FlAsHCand1, a proteína do aceitador FRET

Nota: A maioria das etapas nesta parte é igual a etapa 2. Condições que diferem são descritas em detalhes abaixo.

  1. Construa o plasmídeo para expressar o humano Cand1 de TetraCysem células de Escherichia coli .
    1. Adicionar sequência de DNA codificação "CCPGCCGSG" (marca de tetracysteine/TetraCys) antes do 15th aminoácido de Cand1 através de PCR regular25 (sequências da primeira demão: TGCTGTCCGGGCTGCTGCGGCAGCGGCATGACATCCAGCGACAAGGACTTTAG; CTAACTAGTGTCCATTGATTCCAAG).
    2. Inserir o produto do PCR em um vetor do pGEX 4T-2. Sequenciar o plasmídeo para confirmar a inserção do gene é exata e no quadro.
  2. Express TetraCysCand1in Escherichia coli células da mesma forma como passo 2.2, exceto que o plasmídeo é transformado em células competentes de Rosetta.
  3. Purificação de Cand1 de TetraCyspartir de células de Escherichia coli .
    1. Lisar as pelotas de célula de e. coli e extrair TetraCysCand1using grânulos de glutationa. Estes passos são os mesmos que passos 2.3.1–2.3.12.
    2. Dilua o eluato de proteína dos grânulos de glutationa com Buffer C (50 mM Tris-HCl, 1 milímetro DTT, 5% de glicerol, pH 7,5) por três dobras. Equilibrar uma coluna de cromatografia de troca de ânion (ver Tabela de materiais) no sistema FPLC com Buffer C e carga a amostra diluída de proteína em uma taxa de fluxo de 0,5 mL/min.
    3. Eluir a proteína com um gradiente de NaCl em 40 mL misturando Buffer C e 0 a 50% D Buffer (pH 7.5 de 50 mM Tris-HCl, NaCl de 1 M, 1 mM DTT, 5% de glicerol,) em uma taxa de fluxo de 1 mL/min. Verifique a proteína eluted em diferentes frações utilizando SDS-PAGE24e piscina as frações contendo TetraCysCand1. Observe que o TetraCysCand1 tem um volume maior de retenção de GST livre.
    4. Concentre a amostra de Cand1 de TetraCysem pool, passando a reserva através de uma membrana de ultrafiltração (corte de 30 kDa).
    5. Equilibrar a coluna de cromatografia de exclusão de tamanho com buffer de rotulagem (20 mM Tris-HCl, 100 mM de NaCl, 2mm TCEP, 1 mM EDTA, 5% de glicerol) no sistema FPLC. Carregar TetraCysCand1 amostra (500 µ l cada vez) e verificar as frações de eluato por SDS-PAGE24.
    6. Reunir todas as frações contendo TetraCysCand1 e concentrar a proteína de ~ 40 µM, passando a reserva através de uma membrana de ultrafiltração (corte de 30 kDa). Estimar a concentração de proteína usando sua absorbância em 280 nm. Armazenar a proteína como 50 alíquotas µ l a-80 ° C.
      Nota: O protocolo pode ser pausado aqui.
  4. Preparação de Cand1 FlAsH.
    1. Adicione 1 µ l de solução FlAsH (ver Tabela de materiais) para a solução de Cand1 50 µ l TetraCys.
    2. Misture bem e incubar a mistura à temperatura ambiente no escuro para 1-2 h obter Cand1 de FlAsH.
      Nota: O protocolo pode ser pausado aqui.

4. preparação de Cand1, a proteína de perseguição FRET

Nota: O protocolo de preparação de proteína é semelhante para a etapa 3, com as seguintes modificações.

  1. Introduza a sequência de código de Cand1 completos do vetor do pGEX 4T-2.
  2. Altere o buffer usado na etapa 3.3.5 para um buffer que contém 30 mM Tris-HCl, 100 mM de NaCl, 1 milímetro DTT, 10% de glicerol.
  3. Elimine etapas 3.3.7 e 3.3.8.

5. testar e confirmar o ensaio FRET

  1. Preparar o traste buffer contendo 30 mM Tris-HCl, NaCl, 0.5 mM DTT, ovalbumina de 1 mg/mL, pH 7,6, de 100 mM e usar à temperatura ambiente.
  2. Testar o traste entre Cul1AMC•Rbx1 e Cand1 de FlAsHem um fluorímetro.
    1. Em 300 µ l de tampão FRET, adicionar Cul1 •Rbx1AMC(FRET doador) a uma concentração final de 70 nM. Transferi a solução para uma cubeta.
    2. Coloque a cubeta no suporte de amostra de um fluorímetro. Excitar a amostra com luz de excitação 350 nm e digitalizar os sinais de emissão de 400 nm a 600 nm em incrementos de 1 nm.
    3. Repita a etapa 5.2.1 mas mudança Cul1AMC•Rbx1 para FlAsHCand1 (FRET aceitador). Examinar a amostra de Cand1 FlAsHusando o mesmo método da etapa 5.2.2.
    4. (Opcional) Excitar o Cand1 FlAsHcom luz de excitação 510 nm e digitalizar o sinal de emissão de 500 nm a 650 nm.
    5. No buffer FRET 300 µ l, adicionar ambos Cul1AMC•Rbx1 e Cand1 de FlAsHpara uma concentração final de 70 nM. Analise a amostra da mesma forma como na etapa 5.2.2.
  3. Confirmar o traste entre Cul1 •Rbx1AMCe Cand1 FlAsHadicionando a proteína de perseguição (sem rótulo Cand1) (Figura 3).
    1. Em 300 µ l de tampão FRET, adicione 70 nM Cul1AMC•Rbx1 e 700 nM Cand1. Verificação das emissões de amostra como na etapa 5.2.2.
    2. Em 300 µ l de tampão FRET, adicione 70 nM Cand1 FlAsHe 700 nM Cand1. Verificação das emissões de amostra como na etapa 5.2.2.
    3. Em 300 µ l de tampão FRET, adicione 70 nM Cul1AMC•Rbx1 e 70 nM Cand1 FlAsHe incubar a amostra em temperatura ambiente por 5 min. Em seguida, adicione 700 nM Cand1 e imediatamente após a adição, digitalizar a emissão da amostra como na etapa 5.2.2). Note que este passo é semelhante ao passo 5.2.5.
    4. No buffer FRET 300 µ l, adicionar sequencialmente 70 nM Cul1AMC•Rbx1, 700 nM Cand1 e 70 nM Cand1 FlAsH. Incubar a amostra em temperatura ambiente por 5 min e digitalizar a emissão da amostra como na etapa 5.2.2. Note que esta é a amostra de perseguição (linha verde na Figura 3).

6. medir a constante de velocidade de associação (k,na) de Cul1•Cand1

Nota: Detalhes de um fluorímetro parou-fluxo de funcionamento tem sido descrito em um anterior relatório26.

  1. Prepare o fluorímetro fluxo parou para medição.
    1. Ligue o fluorímetro de fluxo interrompido de acordo com as instruções do fabricante.
    2. Defina a luz de excitação a 350 nm e uso um filtro passa-faixa que permite a emissão de 450 nm e luz para passar e bloqueia a emissão de 500-650 nm luz.
    3. Mantenha as válvulas de amostra na posição de preencher e conecte uma seringa de 3 mL com água. Lave as duas seringas de amostra (A e B) com água movendo-se a unidade de seringa amostra acima e para baixo várias vezes. Descarte toda a água utilizada nesta etapa.
    4. Mantenha as válvulas de amostra na posição de preencher e conecte uma seringa de 3 mL cheia de buffer de traste. Lave as duas seringas de amostra com o buffer FRET movendo o amostra seringa de carro subindo e descendo várias vez. Descarte todo o buffer FRET utilizado nesta etapa.
  2. Tome uma medida de controle (Figura 4).
    1. Conecte uma seringa de 3 mL e carregar a seringa A com 100 nM Cul1AMC•Rbx1 no buffer de traste. Gire a válvula de amostra para a posição de dirigir .
    2. Conecte uma seringa de 3 mL e carregar a seringa B com o buffer de traste. Gire a válvula de amostra para a posição de dirigir .
    3. Use o Painel de controle sob a adquirir no software para assumir o fluorímetro fluxo parou sem gravar os resultados cinco tiros (misturar igual volume de amostras da seringa A e B da seringa).
    4. Abra o Painel de controle sob a adquirir no software e programa para gravar a emissão de Cul1AMC mais de 60 s. Em seguida dar um único tiro.
    5. Repita a etapa 6.2.4 2x.
    6. Gire a válvula de amostra para a posição de preencher . Esvaziar a seringa B e lave com o buffer de traste.
  3. Medida observada constantes de velocidade de associação (kobs) de Cul1•Cand1 (Figura 4B).
    1. Manter a amostra em seringa à mesma etapa 6.2.1.
    2. Conecte uma seringa de 3 mL e carregar a seringa B com 100 nM Cand1 FlAsHno buffer de traste. Gire a válvula de amostra para a posição de dirigir .
    3. Use o Painel de controle sob a adquirir no software para levar cinco tiros sem gravar os resultados.
    4. Abra o Painel de controle sob a adquirir no software e programa para gravar a emissão de Cul1AMC mais de 60 s. Em seguida dar um único tiro.
    5. Repita a etapa 6.3.4 2x.
    6. Esvaziar a seringa B e lave com o buffer de traste.
    7. Repita os passos 6.3.1–6.3.6 várias vezes com concentrações crescentes de FlAsHCand1 no buffer de traste.
    8. Encaixa a alteração (diminuição) fluorescentes sinais medidos ao longo do tempo de cada tiro para uma única curva exponencial. Isto dará kobsem cada medição, e a unidade é s-1. Note que a base deste cálculo foi bem discutida em um anterior relatório27.
  4. Calcule a média e desvio padrão de kobspara cada concentração de Cand1 FlAsHutilizada. Plotar a média kobscontra a concentração de Cand1 (Figura 4), e o declive da linha representa o k de Cul1•Cand1, com uma unidade de M-1 s-1.

7. medir a taxa constante de dissociação (kfora) de Cul1•Cand1 na presença de proteína Skp1•F-caixa.

Nota: Este passo é semelhante ao passo 6, com as seguintes modificações.

  1. Na seringa A, sob a posição de encher , carregar uma solução de 100 nM Cul1AMC•Rbx1 e 100 nM Cand1 FlAsHno buffer de traste. Gire a válvula de amostra para a posição "DRIVE".
  2. Em seringa B, sob a posição de encher , carrega uma solução de Skp1•Skp2 (preparado na sequência de uma anterior relatório20). Gire a válvula de amostra para a posição "DRIVE".
  3. Abra o Painel de controle sob a adquirir no software e programa para gravar a emissão de Cul1AMC acima de 30 s. Em seguida dar um único tiro. Os sinais fluorescentes aumentam ao longo do tempo após a mistura de soluções de seringa A e B de seringa (Figura 5).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Para testar o traste entre Cul1AMC e FlAsHCand1, primeiro determinamos a intensidade de emissão de 70 nM Cul1AMC (o doador) e 70 nM Cand1 FlAsH(o aceitador), respectivamente (Figura 3A-C, azul linhas). Em cada análise, somente um pico de emissão estava presente e a emissão de Cand1 FlAsH(o aceitador) foi baixa. Quando 70 nM cada de Cul1AMC e FlAsHCand1 foram misturadas para gerar FRET, dois picos de emissão estavam presentes no espectro de emissão e o pico de Cul1AMC tornou-se mais baixo e o pico de Cand1 FlAsHtornou-se mais elevado (Figura 3A -C, vermelho de linhas). Quando o Cand1 longa-metragem foi usada traste, o pico de doador mostrou uma redução de 10% na intensidade (Figura 3A, vermelho linha), e quando Cand1 com sua primeira hélice truncado foi usado, a redução da intensidade de pico do doador foi aumentada para 30% (Figura 3B -D, linhas vermelhas), sugerindo uma eficiência mais elevada FRET. Para confirmar que as alterações de sinal foram resultadas de FRET entre Cul1AMC e FlAsHCand1, 70 nM Cul1AMC (o doador) foi misturado com 700 nM unlabeled Cand1 (ponto) e 70 nM Cand1 FlAsH(o aceitador). Como resultado, o pico do doador foi totalmente restaurado e o pico do aceitador foi diminuído (Figura 3, linha verde), que confirmou que o traste observado depende a formação de Cul1 aAMCFlAsHCand1 complexo. Adição de 700 nM Skp1•Skp2 para o 70 nM Cul1AMC• Cand1FlAsHtambém totalmente restaurado pico do doador (Figura 3D, verde linha), sugerindo que o complexo Cul1•Cand1 foi totalmente interrompido por Skp1•Skp2 no estado de equilíbrio.

Figure 3
Figura 3: ensaio FRET representativo para a formação do complexo Cul1•Cand1. Amostras no buffer FRET (30 mM Tris-HCl, 100 mM de NaCl, 0.5 mM DTT, ovalbumina de 1 mg/mL, pH 7,6) estavam animadas em 350 nm e as emissões foram escaneados de 400 nm a 650 nm. Espectros de emissão (A) de 70 nM Cul1AMC, 70 nM Cand1 FlAsH(completo) e uma mistura dos dois (FRET). Cand1 (completo) representa o comprimento total Cand1. Espectros de emissão (B) de 70 nM Cul1AMC, 70 nM Cand1 FlAsHe uma mistura dos dois (FRET). Cand1 com sua hélice primeiro eliminado foi usado neste experimento e posteriormente. Espectros de emissão (C) de 70 nM Cul1AMC, 70 nM Cand1 FlAsH, uma mistura dos dois (FRET) e chase controle por FRET (Chase). A amostra de perseguição continha 70 nM Cul1AMC, 700 nM Cand1 e 70 nM Cand1 FlAsH. Espectros de emissão (D) de 70 nM Cul1AMC, uma mistura de 70 nM Cul1AMC e 70 nM Cand1 FlAsH(FRET) e 700 nM Skp1•Skp2 adicionado para a 70 nM Cul1AMCFlAsHCand1 complexo. Em cada parcela, os sinais de emissão foram normalizados para a emissão de 70 nM Cul1AMC a 450 nm. Clique aqui para ver uma versão maior desta figura.

Para medir o k de Cul1•Cand1 usando o ensaio FRET a estabelecida pelo monitoramento da redução do sinal do doador ao longo do tempo sobre o fluorímetro fluxo parou, primeiro testamos e determinar a concentração da proteína a ser usado. Quando 5 nM cada de Cul1 foram utilizadosAMC e FlAsHCand1, pouca mudança de sinal foi observada (Figura 4A), Considerando que, quando a concentração de cada proteína foi aumentada para 50 nM, a redução do sinal ao longo do tempo foi observada ( Figura 4B) e essa mudança foi abolida se reserva sem FlAsHCand1 foi adicionada (Figura 4). Portanto, 50 nM Cul1AMC foi usado para mais análises, e uma série de constantes de velocidade de associação observada (kobs) foram medidos pela mistura de 50 nM Cul1AMC com concentrações crescentes de FlAsHCand1. O kobs para cada experimento foi calculada por encaixe os pontos para uma única curva exponencial, e o kobs obtido a mesma concentração de FlAsHCand1 foram em média. Plotar a média kobs com a concentração de Cand1 e realizando uma regressão linear (Figura 4), o kna foi determinado7,27.

Figure 4
Figura 4: medida representativa da constante de velocidade de associação. (A) a fluorescência de 5 nM Cul1AMC foi monitorada por um fluorímetro de fluxo parou ao longo do tempo sobre a adição de 5 nM Cand1 FlAsH. (B) a fluorescência de 50 nM Cul1AMC foi monitorada por um fluorímetro de fluxo parou ao longo do tempo sobre a adição de 50 nM Cand1 FlAsH. (C) a fluorescência de 50 nM Cul1AMC foi monitorada por um fluorímetro de fluxo parou ao longo do tempo sobre adição de buffer de traste. (D) k para ligação de Cand1 para Cul1. kobs de Cul1•Cand1 em diferentes concentrações de Cand1 são plotadas. Inclinação linear dá no k de 1,8 x 107 M-1 s-1. Barras de erro representam ±SEM; n = 4. Todas as amostras foram elaboradas no buffer de FRET e animadas a 350 nm. Um filtro passa-banda foi usado para coletar sinais de AMC e excluir os sinais do FlAsH. Dados não foram normalizados. Clique aqui para ver uma versão maior desta figura.

Semelhante à medição de k,na, Nós medimos a constante de velocidade de dissociação observada de Cul1•Cand1, monitorando o aumento (restauração) do sinal do doador ao longo do tempo sobre o fluorímetro fluxo parou. Cul1AMC e FlAsHCand1 misturavam-se primeiro, e depois Skp1•Skp2 foi adicionado para o Cul1 preassembledAMCFlAsHCand1 sobre o fluorímetro fluxo parou. O sinal de doadores aumentou rapidamente e revelado um kobs de 0,4 s-1 (Figura 5). Em contraste, quando reserva foi adicionada para o Cul1 preassembledAMC• Cand1FlAsH, nenhum sinal de aumento foi observado, sugerindo a dissociação rápida de Cul1•Cand1 foi provocada por Skp1•Skp2.

Figure 5
Figura 5: medição representativa da constante de velocidade de dissociação. A mudança de fluorescência do doador contra o tempo foi medida após adição de 150 nM Skp1•Skp2 ou o buffer FRET para 50 nM Cul1AMCFlAsHCand1 complexo. Alterações de sinal estavam apto para uma única curva exponencial, e dá constante de dissociação observada taxa de 0,4 s-1. As condições experimentais foram semelhantes ao descrito na Figura 4. Clique aqui para ver uma versão maior desta figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

TRASTE é um fenômeno físico que é de grande interesse para o estudo e compreensão de sistemas biológicos19. Aqui, apresentamos um protocolo para teste e usando o FRET para estudar a cinética de ligação de duas proteínas de interação. Ao projetar o traste, consideramos três fatores principais: a sobreposição espectral entre o doador de emissão e aceitador da excitação, a distância entre os dois fluorophores e a orientação do dipolo do fluorophores28. Para escolher o fluorophores para FRET, sobreposto a excitação e espectros de emissão do fluorophores e procurou por fluorophores cujos picos de emissão são bem separados, enquanto o espectro de emissão do doador sobrepõe-se significativamente com a excitação espectro do aceitador (Figura 2). Para otimizar a interfluorophore distância e orientação, usamos a estrutura de cristal para a assistência, e consideramos principalmente anexar fluorophores para a termini de proteína, principalmente devido a menor risco de perturbar a proteína estrutura e atividade. Porque a distância entre a extremidade N-terminal de Cand1 (Cand1NTD) e o C-terminal da Cul1 (Cul1CTD) é menor do que a distância entre o C-terminal da Cand1 e N-terminal de Cul1 (Figura 1), nós decidimos rotular Cand1NTD e Cul1CTD. Porque nós tinha sido capazes de atingir 80%-90% de eficiência rotulagem do N-terminal de uma proteína usando a marca de tetracysteine25, optou-se por rótulo Cand1NTD com FlAsH através da marca tetracysteine. Que inicialmente rotulado o Cul1CTD com proteína fluorescente ciana (PCP), que tem algumas vantagens sobre o AMC. Primeiro, é uma etiqueta fluorescente geneticamente codificada, por isso não exige processo de rotulagem adicional nem passos que purificam a proteína fluorescente etiquetada de seu precursor sem rótulo. Em segundo lugar, PCP é mais brilhante que o AMC, e portanto, oferece maior sensibilidade do ensaio (ver discussão abaixo). Em terceiro lugar, PCP tem um espectro maior sobreposição com FlAsH, potencialmente produzindo FRET mais eficiente com FlAsH. Apesar dessas vantagens, no entanto, proteína de PCP é muito maior que a tag AMC, que pode interferir com a conformação da proteína e da interação inter molecular. Na verdade, nós não observaram FRET entre Cul1PCP e FlAsHCand1 em nosso teste, que é provavelmente devido à orientação do dipolo inadequado, ou rompimento da interação Cul1-Cand1 pela marca CFP. Que então rotulado o Cul1CTD com AMC, e observamos FRET entre Cul1AMC e FlAsHCand1. A inicial FRET usando o Cand1 completos levou à redução de 10% das emissões de doador (Figura 3A). Encontramos ainda mais que, excluindo a primeira hélice do Cand1, a distância entre Cul1 e Cand1 é reduzida de 26,8 Å para 15,5 Å (Figura 1) e Cand1 falta a primeira hélice rendeu um muito mais forte FRET com Cul1, mostrando a redução de 30% das emissões de doador Pico (Figura 3B). Além disso, um pode melhorar a eficiência do FRET, escolhendo um doador fluoróforo com maior rendimento quântico e um fluoróforo aceitador com um maior coeficiente de extinção.

Uma característica de FRET é que quando o traste ocorre, a emissão do doador diminui e a emissão dos aumentos de aceitador (Figura 3B). No entanto, fluorophores pode apresentar sensibilidade ao ambiente, e assim, a intensidade de emissão pode ser alteradas quando outra proteína está presente, mesmo na ausência de FRET29. Para confirmar que a emissão alterada observamos é devido FRET entre Cul1AMC e FlAsHCand1, adicionamos 10 x quantidade em excesso de proteína sem rótulo aceitador (Cand1) como uma perseguição. A perseguição converte a emissão do doador e o aceitador de volta para o nível normal (Figura 3), que suporta que as emissões mudou de Cul1AMC e FlAsHCand1 dependem de interação da proteína-proteína e, portanto, esse resultado confirma que estabelecemos um ensaio de traste que relata a associação e a dissociação do Cul1•Cand1. Além disso, nós adicionamos o Skp1•Skp2 para o Cul1 preassembledAMCFlAsHCand1 complexo e Skp1•Skp2 é conhecido por ser capaz de interromper a interação de Cul1-Cand16. Descobrimos que o traste entre Cul1AMC e FlAsHCand1 desapareceram (Figura 3D, linha verde) e tornou-se o espectro de emissão semelhante ao espectro de emissão da amostra perseguição (linhaFigura 3, verde), sugerindo •AMCCul1 Cand1FlAsHé dissociado por Skp1•Skp2 e Cul1AMC não exibir emissão anormal quando Skp1•Skp2 está presente.

Ao monitorar a mudança na emissão do doador, observamos diretamente a associação e dissociação de Cul1 •AMCCand1FlAsHem um fluorímetro de fluxo parou. O sistema de fluxo parou obras, injetando reagentes para uma câmara de mistura para misturar rapidamente os reagentes e interromper o fluxo, uma vez que os reagentes mistos são movidos em uma câmara de observação5. A detecção do sinal começa geralmente 1-2 milissegundos (ms) após a mistura, que permite estudar as interações que ocorrem numa escala de tempo a milissegundo. No entanto, quando a meia-vida da reação observada é menor do que o tempo necessário para misturar os reagentes em um dispositivo específico, esta abordagem não é suficientemente sensível e não é mais apropriado30. Análises de fluxo parou têm sido utilizadas para determinar as constantes de velocidade que variam de 10-6– 106 s-1 para reações de primeira ordem e 1 – 109 M-1 s-1 para reações de segunda ordem5. Para obter a medição confiável dos parâmetros cinéticos usando o fluorímetro parou-fluxo, uma mudança significativa do sinal fluorescente entre os pontos de partida e equilíbrio é necessária. Usamos o FlAsHCand1 faltando a primeira hélice como o aceitador, porque rende melhor FRET com Cul1AMCe nós testado a concentração das proteínas a ser usado para medição. Quando 5 nM cada de Cul1AMC e FlAsHCand1 não foram misturadas, nenhuma mudança na Cul1 sinalAMC foi observada (Figura 4A), sugerindo que esta concentração é insuficiente para a medição. Quando as concentrações de proteína foram aumentadas para 50 nM, a diminuição Cul1AMC sinal ao longo do tempo tornou-se aparente (Figura 4B), e essa mudança não ocorre quando a proteína aceitador estava ausente (Figura 4). Baseia-se este resultado, usamos Cul1AMC na concertação de nM 50 para medir o k para Cul1•Cand1. A concentração da proteína do dador utilizada para a medição pode variar quando fluorophores diferentes são usadas. Por exemplo, quando Cul1 é rotulado com PCP, 5 nM de PCPCul1 é suficiente para a medição de kem6. Portanto, a concentração ideal de proteína deve ser testada para cada par FRET, e em princípio, mais brilhantes fluorophores permitem o uso de concentrações menores de proteína e fornecer a melhor relação sinal-ruído31.

Para estudar as interações da proteína-proteína por FRET, que exige anexar fluorophores às proteínas em posições adequadas, sem interromper a proteína estrutura e actividade, que potencialmente limita o uso de FRET. Neste protocolo, que rotulado N-terminal de Cand1 usando uma marca de tetracysteine, que se liga especificamente a tintura FlAsH e FlAsH corante torna-se fluorescente só depois liga-se o alvo da proteína32. Que rotulado Cul1 usando transpeptidation sortase-mediada, que anexa um peptídeo curto carregando um fluoróforo para a tag sortase no C-terminal da Cul121,22. A eficiência de rotulagem é > 80% com a marca de tetracysteine e quase 100% com a tag sortase-His6 depois de remover a proteína não tenha reagida usando Ni-NTA grânulos (passos 2.4.3–2.4.4). Ambos os métodos de adicionar alguns aminoácidos à proteína alvo, introduzindo modificações mínimas na estrutura da proteína. Abordagens similares, tais como o reconhecimento de transglutaminase sequência (Q-tag)33 e o ybbR marca34, também podem ser usadas para rotular a proteína do alvo de uma forma específica do site. Além disso, fotoestabilidade dos corantes fluorescentes também pode limitar o uso de traste. Repetitiva ou longa exposição à luz de excitação pode levar a fotobranqueamento de fluoróforo, resultando em quantificação imprecisa resultados35. Portanto, os doador e aceptor de proteínas devem ser protegidas da luz durante as etapas de preparação e armazenamento. Ao usar o FRET para medir eventos que ocorrem lentamente, ao invés de monitorando constantemente a mudança na emissão do doador ao longo do tempo, leituras curtas da emissão doador devem ser colhidos em intervalos de tempo mais longos e a amostra deve ser mantida no escuro durante todo o experimento6.

Porque o traste é sensível e quantitativos, tornou-se uma ferramenta importante para estudar a interação entre macromoléculas. Este protocolo apresenta um exemplo de usando o FRET para estudar a dinâmica de uma proteína complexa em solução. FRET também tem sido usado em conjunto com a célula viva imagem para estudar interações moleculares em vida células36, que é poderosa em revelar a dinâmica dos complexos de proteínas sob condições fisiológicas. Além disso, FRET também pode ser usado no nível do único-molécula para estudar a dinâmica em tempo real de complexos macromoleculares37,38, fornecendo insights sobre a mudança conformacional do complexo. Para melhorar a eficiência e a detecção de FRET, fluorophores e biosensores com maior brilho e fotoestabilidade são de grande interesse, que estão ativamente projetado e estudou28,39.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores não têm nada para divulgar.

Acknowledgments

Agradecemos perspicaz discussão sobre o desenvolvimento do ensaio FRET-Shu-UO Shan (California Institute of Technology). M.G., Y.Z. e X.L. foram financiados por fundos de inicialização da Universidade de Purdue para Y.Z. e X.L.This trabalho foi financiado em parte por uma concessão de semente da Purdue University Center para a biologia da planta.

Materials

Name Company Catalog Number Comments
Anion exchange chromatography column GE Healthcare 17505301 HiTrap Q FF anion exchange chromatography column
Benchtop refrigerated centrifuge Eppendorf 2231000511
BL21 (DE3) Competent Cells ThermoFisher Scientific C600003
Calcium Chloride Fisher Scientific C78-500
Cation exchange chromatography column GE Healthcare 17505401 HiTrap SP Sepharose FF
Desalting Column GE Healthcare 17085101
Floor model centrifuge (high speed) Beckman Coulter J2-MC
Floor model centrifuge (low speed) Beckman Coulter J6-MI
Fluorescence SpectraViewer ThermoFisher Scientific https://www.thermofisher.com/us/en/home/life-science/cell-analysis/labeling-chemistry/fluorescence-spectraviewer.html
FluoroMax fluorimeter HORIBA FluoroMax-3
FPLC GE Healthcare 29018224
GGGGAMC peptide New England Peptide custom synthesis
Glutathione beads GE Healthcare 17075605
Glycerol Fisher Scientific G33-500
HEPES Fisher Scientific BP310-100
Isopropyl-β-D-thiogalactoside (IPTG) Fisher Scientific 15-529-019
LB Broth Fisher Scientific BP1426-500
Ni-NTA agarose Qiagen 30210
Ovalbumin MilliporeSigma A2512
pGEX-4T-2 vector GE Healthcare 28954550
Protease inhibitor cocktail MilliporeSigma 4693132001
Reduced glutathione Fisher Scientific BP25211
Refrigerated shaker Eppendorf M1282-0004
Rosetta Competent Cells MilliporeSigma 70953-3
Size exclusion chromatography column GE Healthcare 28990944 Superdex 200 10/300 GL column
Sodium Chloride (NaCl) Fisher Scientific S271-500
Stopped-flow fluorimeter Hi-Tech Scientific SF-61 DX2
TCEP·HCl Fisher Scientific PI20490
Thrombin MilliporeSigma T4648
Tris Base Fisher Scientific BP152-500
Ultrafiltration membrane MilliporeSigma UFC903008 Amicon Ultra-15 Centrifugal Filter Units, Ultra-15, 30,000 NMWL

DOWNLOAD MATERIALS LIST

References

  1. Stumpf, M. P. H., et al. Estimating the size of the human interactome. Proceedings of the National Academy of Sciences of the United States of America. 105, (19), 6959-6964 (2008).
  2. Kuzmanov, U., Emili, A. Protein-protein interaction networks: probing disease mechanisms using model systems. Genome Medicine. 5, (4), 37 (2013).
  3. Titeca, K., Lemmens, I., Tavernier, J., Eyckerman, S. Discovering cellular protein-protein interactions: Technological strategies and opportunities. Mass Spectrometry Reviews. 1-33 (2018).
  4. Lapetina, S., Gil-Henn, H. A guide to simple, direct, and quantitative in vitro binding assays. Journal of Biological Methods. 4, (1), 62 (2017).
  5. Zheng, X., Bi, C., Li, Z., Podariu, M., Hage, D. S. Analytical methods for kinetic studies of biological interactions: A review. Journal of Pharmaceutical and Biomedical Analysis. 113, 163-180 (2015).
  6. Pierce, N. W., et al. Cand1 promotes assembly of new SCF complexes through dynamic exchange of F box proteins. Cell. 153, (1), 206-215 (2013).
  7. Liu, X., Reitsma, J. M., Mamrosh, J. L., Zhang, Y., Straube, R., Deshaies, R. J. Cand1-Mediated Adaptive Exchange Mechanism Enables Variation in F-Box Protein Expression. Molecular Cell. 69, (5), 773-786 (2018).
  8. Zheng, N., et al. Structure of the Cul1-Rbx1-Skp1-F boxSkp2 SCF ubiquitin ligase complex. Nature. 416, (6882), 703-709 (2002).
  9. Kleiger, G., Deshaies, R. Tag Team Ubiquitin Ligases. Cell. 166, (5), 1080-1081 (2016).
  10. Zheng, J., et al. CAND1 binds to unneddylated CUL1 and regulates the formation of SCF ubiquitin E3 ligase complex. Molecular Cell. 10, (6), 1519-1526 (2002).
  11. Hwang, J. W., Min, K. W., Tamura, T. A., Yoon, J. B. TIP120A associates with unneddylated cullin 1 and regulates its neddylation. FEBS Letters. 541, (1-3), 102-108 (2003).
  12. Min, K. W., Hwang, J. W., Lee, J. S., Park, Y., Tamura, T., Yoon, J. B. TIP120A associates with cullins and modulates ubiquitin ligase activity. Journal of Biological Chemistry. 278, (18), 15905-15910 (2003).
  13. Goldenberg, S. J., et al. Structure of the Cand1-Cul1-Roc1 complex reveals regulatory mechanisms for the assembly of the multisubunit cullin-dependent ubiquitin ligases. Cell. 119, (4), 517-528 (2004).
  14. Chuang, H. W., Zhang, W., Gray, W. M. Arabidopsis ETA2, an apparent ortholog of the human cullin-interacting protein CAND1, is required for auxin responses mediated by the SCF(TIR1) ubiquitin ligase. Plant Cell. 16, (7), 1883-1897 (2004).
  15. Feng, S., et al. Arabidopsis CAND1, an Unmodified CUL1-Interacting Protein, Is Involved in Multiple Developmental Pathways Controlled by Ubiquitin/Proteasome-Mediated Protein Degradation. the Plant Cell Online. 16, (7), 1870-1882 (2004).
  16. Cheng, Y., Dai, X., Zhao, Y. AtCAND1, a HEAT-repeat protein that participates in auxin signaling in Arabidopsis. Plant Physiology. 135, (June), 1020-1026 (2004).
  17. Lo, S. -C., Hannink, M. CAND1-Mediated Substrate Adaptor Recycling Is Required for Efficient Repression of Nrf2 by Keap1. Molecular and Cellular Biology. 26, (4), 1235-1244 (2006).
  18. Okamoto, K., Sako, Y. Recent advances in FRET for the study of protein interactions and dynamics. Current Opinion in Structural Biology. 46, 16-23 (2017).
  19. Hussain, S. A. An introduction to fluorescence resonance energy transfer (FRET). arXiv preprint. (2009).
  20. Li, T., Pavletich, N. P., Schulman, B. A., Zheng, N. High-level expression and purification of recombinant SCF ubiquitin ligases. Methods in Enzymology. 398, (1996), 125-142 (2005).
  21. Popp, M. W., Antos, J. M., Grotenbreg, G. M., Spooner, E., Ploegh, H. L. Sortagging: A versatile method for protein labeling. Nature Chemical Biology. 3, (11), 707-708 (2007).
  22. Antos, J. M., Ingram, J., Fang, T., Pishesha, N., Truttmann, M. C., Ploegh, H. L. Site-Specific Protein Labeling via Sortase-Mediated Transpeptidation. Current Protocols in Protein Science. 89, (2017).
  23. Froger, A., Hall, J. E. Transformation of Plasmid DNA into E. coli Using the Heat Shock Method. Journal of Visualized Experiments. (2007).
  24. Simpson, R. J. SDS-PAGE of Proteins. Cold Spring Harbor Protocols. 2006, (1), (2006).
  25. Kleiger, G., Saha, A., Lewis, S., Kuhlman, B., Deshaies, R. J. Rapid E2-E3 Assembly and Disassembly Enable Processive Ubiquitylation of Cullin-RING Ubiquitin Ligase Substrates. Cell. 139, (5), 957-968 (2009).
  26. Biro, F. N., Zhai, J., Doucette, C. W., Hingorani, M. M. Application of Stopped-flow Kinetics Methods to Investigate the Mechanism of Action of a DNA Repair Protein. Journal of Visualized Experiments. (37), 2-8 (2010).
  27. Patel, J. T., Belsham, H. R., Rathbone, A. J., Friel, C. T. Use of Stopped-Flow Fluorescence and Labeled Nucleotides to Analyze the ATP Turnover Cycle of Kinesins. Journal of Visualized Experiments. (92), 1-6 (2014).
  28. Bajar, B. T., Wang, E. S., Zhang, S., Lin, M. Z., Chu, J. A guide to fluorescent protein FRET pairs. Sensors (Switzerland). 16, (9), 1-24 (2016).
  29. Chen, A. K., Cheng, Z., Behlke, M. A., Tsourkas, A. Assessing the sensitivity of commercially available fluorophores to the intracellular environment. Analytical Chemistry. 80, (19), 7437-7444 (2008).
  30. Lin, C. T., Rorabacher, D. B. Mathematical approach for stopped-flow kinetics of fast second-order reactions involving inhomogeneity in the reaction cell. Journal of Physical Chemistry. 78, (3), 305-308 (1974).
  31. Toseland, C. P., Geeves, M. A. Rapid Reaction Kinetic Techniques. Fluorescent Methods for Molecular Motors. 49-65 (2014).
  32. Adams, S. R., et al. New biarsenical ligands and tetracysteine motifs for protein labeling in vitro and in vivo: Synthesis and biological applications. Journal of the American Chemical Society. 124, (21), 6063-6076 (2002).
  33. Lin, C. W., Ting, A. Y. Transglutaminase-catalyzed site-specific conjugation of small-molecule probes to proteins in vitro and on the surface of living cells. Journal of the American Chemical Society. 128, (14), 4542-4543 (2006).
  34. Yin, J., et al. Genetically encoded short peptide tag for versatile protein labeling by Sfp phosphopantetheinyl transferase. Proceedings of the National Academy of Sciences of the United States of America. 102, (44), 15815-15820 (2005).
  35. Diaspro, A., Chirico, G., Usai, C., Ramoino, P., Dobrucki, J. Photobleaching. Handbook Of Biological Confocal Microscopy. 690-702 (2006).
  36. Aoki, K., Kamioka, Y., Matsuda, M. Fluorescence resonance energy transfer imaging of cell signaling from in vitro to in vivo: Basis of biosensor construction, live imaging, and image processing. Development, Growth & Differentiation. 55, (4), 515-522 (2013).
  37. Kilic, S., et al. Single-molecule FRET reveals multiscale chromatin dynamics modulated by HP1α. Nature Communications. 9, (1), (2018).
  38. Shen, K., Arslan, S., Akopian, D., Ha, T., Shan, S. O. Activated GTPase movement on an RNA scaffold drives co-translational protein targeting. Nature. 492, (7428), 271-275 (2012).
  39. Bajar, B. T., et al. Improving brightness and photostability of green and red fluorescent proteins for live cell imaging and FRET reporting. Scientific Reports. 6, (February), 1-12 (2016).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics